Archive pour coronavirus guerre biologique contre l’humanité

Les chaînes de l’esclavage moderne : syndrome du larbin et syndrome du mouton…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, société des sociétés, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 25 janvier 2021 by Résistance 71

 


Mieux que le mouton… production des labos Pfizer ?

 

Il y a 11 ans nous publions “Le syndrome du larbin”  ; qu’y a t’il de changé ? Rien, c’est pire !

Ne croyez-vous pas que l’heure de la révolte consciente a sonné ?… Le système étatico-capitaliste est au bout de son rouleau programmé. L’oligarchie qui le sert est en train de le faire muter en cette dictature technotronique planétaire qu’ils l’appellent “Great Reset”, “Grande Réinitialisation” ou Nouvel Ordre Mondial, peu importe, c’est de cela qu’il s’agit. Ce processus inclut une diminution drastique de la population mondiale, car 7,5 milliards de personnes, c’est en gros 7 milliards de trop pour la société partie dystopique pour les quelques 500 millions restant), partie idyllique (pour l’élite auto-proclamée), envisagée. Leur grand nettoyage a commencé avec la “pandémie” fabriqué du COVID-19 et les mesures “sanitaires” mises en place dans le monde entier. L’objectif n’est ni le virus SRAS-CoV-2 créé en laboratoire, ni ses thérapies géniques accessoires, non, l’objectif est LA FABRICATION DU CONSENTEMENT.
L’article ci-dessous envisionne le comment et pourquoi des moutons menés à l’abattoir et ce que ces moutons devraient faire pour sortir de l’hypnose induite.
Il y a des années un dessin humoristique faisait le portrait de deux moutons dans un énorme troupeau qui se dirigeait vers un bâtiment dans le lointain, l’abattoir, que les deux moutons, d’où ils étaient dans la masse en marche vers la mort , ne pouvaient pas voir. L’un disait à son pote : “Mais je te dis qu’ils vont nous tuer et qu’au final,  les hommes vont nous manger…” et son pote de rétorquer “Ah toi encore, avec tes théories du complot !”
Le fait est que dans les grandes lignes, les “théoriciens du complot” (expression inventée par la CIA du reste pour discréditer ceux qui doutaient il y a 58 ans de la version officielle de l’assassinat du président J.F.Kennedy…) ont eu raison, ce depuis le départ.
Il va falloir que la plus vaste majorité l’admette et donc… agisse en conséquence. Le BOYCOTT est une arme prouvée efficace, il est mentionné par P. Koenig ci-dessous, mais ce boycott ne doit pas être uniquement celui des systèmes électroniques (précisons ici qu’aucun d’entre nous à R71 ne possède un de ces soi-disants “smart-phones” et autres gadgets de l’esclavage électronique quotidien…), des GAFAM, mais aussi des institutions, du vote, de la participation aux activités systémiques pré-programmées. Retrouvons notre autonomie, organisons-nous de là où nous sommes, depuis nos voisinages, lieux de travail, communautés, étendons notre coopération en une vaste association de l’entraide hors état, hors institutions, hors marchandise, hors argent, hors salariat (don et partage), qui font partie de la panoplie du contrôle et de la division et de la peur obsolète et sur la voie de l’extinction. Refusons de consentir plus avant et unissons-nous dans la solidarité, ignorant la merdasse systémique ambiante moribonde et construisons la nouvelle société de l’horizontalité et du partage… La société des sociétés de notre diversité complémentaire et en rien antagoniste. Il en va aujourd’hui de notre survie dans un premier temps et de l’avenir des générations non-nées. Laissons-leur quelque chose de constructif et d’évolutif et non pas une vacuité technotronique dictatoriale contre-nature et anti-humaine.

La balle est de fait dans notre camp, c’est à nous de jouer, ce depuis un bon moment, mais bien trop ne le savent pas et attendent, attendent, attendent… et s’endorment devant leurs écrans.

Réveil donc et… “Action !”…

~ Résistance 71 ~

Voir notre page « Coronavirus guerre biologique contre l’humanité »

A lire aussi: « Les chaînes de l’esclavage », Jean-Paul Marat, 1774, réédition de 1792

“Toute révolte sans conscience politique est comme une explosion d’impuissance.”
~ Paulo Freire ~

 


A contre-courant… vers l’émancipation !

 

Le syndrome du mouton

 

Peter Koenig

 

21 janvier 2021

 

Source de l’article en français:
https://www.mondialisation.ca/le-syndrome-du-mouton/5652848

 

Peter Koenig est un analyste géopolitique et un ancien économiste principal à la Banque mondiale et à l’Organisation mondiale de la santé (OMS), où il a travaillé pendant plus de 30 ans sur l’eau et l’environnement dans le monde. Il donne des conférences dans des universités aux États-Unis, en Europe et en Amérique du Sud. Il écrit régulièrement pour des revues en ligne et est l’auteur de Implosion – An Economic Thriller about War, Environmental Destruction and Corporate Greed ; et co-auteur du livre de Cynthia McKinney « When China Sneezes : From the Coronavirus Lockdown to the Global Politico-Economic Crisis » (Clarity Press – 1er novembre 2020).

Aujourd’hui et au cours des derniers jours, de nouvelles « mesures » – des restrictions de liberté imposées par les gouvernements pour des raisons de « sécurité de la santé publique », c’est-à-dire pour empêcher la propagation des infections de la Covid – ont été renforcées dans toute l’Europe. Littéralement, ces gouvernements traîtres disent : « nous devons serrer les vis ». Sérieusement. WTF – pour qui se prennent-ils ? Des serviteurs du peuple qui les ont élus et qui les paient. C’est de la haute trahison. Mais les gens la prennent sans poser trop de questions, certaines plaintes mais pas assez fortes… nous vivons au milieu du syndrome du mouton.

Ils – ces gouvernements soi-disant amis du peuple – les appellent « mesures », un euphémisme pour dire « lockdown » [verrouillage ou confinement]- sonne mieux aux oreilles d’un public fatigué des répressions continues et de plus en plus nombreuses. Cette deuxième, voire troisième mesure de confinement dans certains pays, comprend la fermeture de nouvelles entreprises, un contrôle plus strict du travail à domicile, une plus grande distance sociale de la part de la police, le port de masques, l’interdiction des activités de groupe en intérieur, la possibilité pour cinq personnes seulement de se réunir dans un appartement… et, et, et.

Par exemple, il existe environ 75 études – à quelques exceptions près – sur l’inutilité et même les dangers du port de masque. Elles abordent surtout le danger pour les enfants et les jeunes adultes… c’est-à-dire les étudiants, mais personne, personne dans les médias achetés-compromis et contraints, soudoyés – les gouvernements occidentaux n’y prêtent la moindre attention, ni, bien sûr, la presse mainstream.

Ils imposent également un bureau à domicile, sachant très bien que tout psychologue et sociologue sérieux vous dit à quel point cela est dévastateur pour l’individu – solitude, manque de contact physique, de rencontre et d’interaction avec les collègues – ainsi que pour la société dans son ensemble. Sans contact physique, elle se brise. Tout cela est bien sûr gratuit – ainsi, toute fermeture de restaurant, tout événement où les gens se rassemblent et échangent, est interdit.

Les gens sont malheureux. Oui, mais pas assez pour arrêter cette tyrannie !Eh bien, je ferais mieux de bien me comporter, sinon je vais être puni. – LA PEUR ! – La peur conduit au syndrome du mouton – cette maladie sociale profonde qui nous frappe aujourd’hui – et ce depuis un certain temps. Elle fait beaucoup de mal non seulement à vous, mais aussi à la cohésion de la société. Les gens, nous devons nous en sortir.

Mais, il semble que les gens ne soient pas encore assez fatigués pour se lever à l’unisson, en criant « ça suffit », nous ne continuons pas, c’est de la tyrannie gouvernementale, nous cessons d’obéir.

Et oui, pour donner à la tyrannie plus de poids, plus de crédibilité, elle est renforcée par une soi-disant Task Force (TF), un groupe de « scientifiques » cooptés, spécialement mis en place par les puissances en place, pour les informer de ce qu’il faut faire. Il s’agit d’une ancienne méthode de dualité décisionnelle. Lorsque les gouvernements doivent, ou veulent, prendre des décisions qui ne sont pas populaires, ils demandent conseil à une Task Force spécialement désignée. Cependant, la Task Force a été informée et sait exactement ce qu’elle doit conseiller. C’est un mensonge prémédité, au mieux une manipulation de l’opinion publique.

Au Royaume-Uni et en France, de nouvelles mesures de verrouillage ont été imposées depuis plusieurs jours déjà, l’Autriche et la Suisse les ont annoncées il y a quelques jours – l’UE en tant qu’entité – ne dit rien, ne coordonne pas, ne veut pas voir que ces verrouillages ne détruisent pas seulement l’économie des nations individuelles, mais qu’ils conduisent l’UE entière au suicide économique. L’UE est paralysée par Washington et par l’OTAN.

Les nouveaux confinements – et peut-être d’autres – sont prévus car d’autres vagues d’épidémie COVID-19 sont en cours – jusqu’à ce que tout le monde soit vacciné – et se fasse injecter un gel électromagnétique dans le corps avec une substance modifiant l’ADN. Ainsi, ils sont maintenant totalement contrôlables dans le temps. Et l’horizon temporel fixé pour la numérisation totale de tout est 2030. L’IA et le contrôle des robots sur les humains – les transformer en transhumains – c’est l’objectif de l’Agenda 21-30 des Nations Unies. Et l’instrument pour y parvenir est l’Agenda ID2020 créé par Bill Gates (voir ceci)

Les médicaments traditionnels et très efficaces contre le coronavirus – éprouvés depuis plus de 60 ans pour d’autres infections et qui ont été utilisés avec succès en Chine pour vaincre l’épidémie, et maintenant en Argentine, en Bolivie, dans le sud du Pérou – et ailleurs dans le monde, sont désormais interdits sous peine d’amendes pour les médecins qui les prescrivent et traitent leurs patients avec ces médicaments. – Pouvez-vous imaginer ! – Donc, pas de guérison, seulement quand vous êtes vaccinés. Il est clair que derrière ce travail, qui se propage constamment, au point d’être imposé à la population, il n’y a pas que des milliards de dollars de profits pour les pharmacies, mais aussi des vaccins, en particulier les marques occidentales qui ne sont pas testées mais dont on sait scientifiquement qu’elles interfèrent avec l’ADN humain.

L’augmentation du nombre de fermetures tue plus de petites entreprises, de magasins et de restaurants. Les propriétaires de petites entreprises se retrouvent dans une situation encore plus difficile, les faillites se multiplient, les gens et leurs familles se retrouvent dans la misère et perdent leur emploi.

Imaginez un peu – l’enseignement à domicile, une famille de 4 personnes, les deux parents travaillent, les enfants doivent avoir chacun un ordinateur / portable raisonnablement puissant pour pouvoir se connecter à l’enseignant de l’école – les enfants doivent avoir des compétences informatiques raisonnables pour gérer l’enseignement à domicile, et les parents, même s’ils ont le temps, ont-ils tous des compétences informatiques raisonnables pour aider leurs enfants ? – Chaque famille, dans la société déjà très éprouvée par la maladie, dispose-t-elle des ressources nécessaires pour acheter le matériel électronique dont les enfants ont besoin ?

C’est une catastrophe. Encore une fois, un désastre injustifiée. Parce qu’il en résultera des enfants moins ou pas éduqués en Occident – les enfants non éduqués deviendront des adultes plus faciles à manipuler – eh bien, on s’attend à ce qu’ils tombent – en bloc – dans le syndrome du mouton de leurs parents. – Ou le deviendront-ils ? – C’est là que la dynamique risque de ne pas répondre aux attentes et à la pensée linéaire de l’élite.

C’est ce qui se passe dans le Nord global. Imaginez ce qui se passe dans le Sud, où la pauvreté, la misère et la famine croissantes ravagent des sociétés entières. Souvent, plus des deux tiers de la population d’un pays est pauvre et beaucoup d’entre eux se situent au niveau ou en dessous du seuil de pauvreté. Comment ces enfants seront-ils formés à distance ? – Ils ne le seront tout simplement pas. Nous avons donc une situation où le Sud produit des enfants sans éducation, parce qu’ils ne vont tout simplement pas à l’école. La plupart d’entre eux resteront pauvres, ils seront des travailleurs parfaits pour l’élite – ou de la chair à canon pour les guerres que les nations riches doivent (ou veulent) mener pour satisfaire leur avidité. N’oubliez jamais que les guerres sont rentables. Mais surtout à cause de la soif sociopathique des mondialistes pour toujours plus de pouvoir et d’argent.

En écoutant et en parlant aux gens dans la rue et aux propriétaires de petites entreprises, ils sont tous bouleversés, et beaucoup d’entre eux disent qu’ils ne survivront peut-être pas, qu’ils ne rouvriront peut-être jamais, malgré les subventions qu’ils reçoivent des gouvernements. En Suisse, le chef de « Gastronomie Suisse » a déclaré qu’avec un nouveau verrouillage, jusqu’à 50 % des restaurants pourraient ne pas survivre. Des chiffres similaires ont été mentionnés en Allemagne, en Autriche et en France – et il est certain que la situation est tout aussi dévastatrice ailleurs aussi.

Nous parlons surtout de l’Occident. La situation à l’Est, en Russie et en Chine et leurs alliés de l’Organisation de coopération de Shanghai (OCS) est différente, dans la mesure où ils ont une approche plus humaine de l’éradication de la COVID-19.

En Occident, dans certains cas, toute la vie des gens, leurs réalisations, leurs entreprises familiales, sont détruites au nom d’une règle inutile et purement oppressive. Le but de cette règle n’est pas d’éradiquer une maladie, mais les mesures anti-COVID-19 sont un moyen d’instiller la peur et de nous rendre dociles, pour les temps les plus difficiles à venir. Parce que, laissez-moi vous dire, quoi que vous pensiez, qu’en été 2021 ou l’année prochaine, en 2022, nous ne reviendrons pas à la normale – nous ne le ferons pas. Nous ne le ferons jamais. Ce, si nous les laissons faire ce qu’ils font maintenant.

Cette petite Cabale Mondialiste, via ses manipulateurs ultra-riches – des milliardaires à deux et trois chiffres, de la Silicon Valley – n’a pas seulement le pouvoir de censurer quiconque est contre la Matrice, mais ils censurent tous à l’unisson le président des États-Unis [Donald Trump]. Qu’est-ce que cela signifie pour un pays, ou pour une société dans laquelle nous vivons, une société qui se dit « démocratique » ?

Peu importe à quel point vous aimez ou n’aimez pas votre président, ne vous est-il pas venu à l’esprit que c’est l’incarnation de la liberté d’expression qui vous est retirée ? – Mais encore une fois, nous ne faisons rien. Nous regardons et nous nous plaignons, mais nous ne faisons rien. Nous laissons les choses se faire. Ne serait-ce pas une occasion en or de bloquer et de boycotter toutes les plateformes de médias sociaux ? Point final. – Vivez sans eux, bon sang, il y a 20 ou 30 ans, nous ne savions même pas qu’ils existaient, et encore moins dans quelle mesure nous serions accros à ceux-ci.

Si nous pouvons encore penser de manière indépendante, il est temps maintenant de se détacher de Facebook, Twitter, Instagram et de tous leurs noms – ne les utilisez pas. Revenez à des communications régulières d’homme à homme, à des dialogues, à des rencontres, à des appels téléphoniques, si possible sur une ligne fixe. Oui, je suis sérieux.

Pensez aux conséquences de cette tendance à ne pas parler librement, mais à une augmentation constante de l’IA par des algorithmes qui utilisent précisément les données que vous leur donnez sur la plateforme sociale pour vous asservir davantage ; par une robotisation et une numérisation toujours plus poussées – au point que nous ne réalisons même pas que nos cerveaux ont été branchés et « piratés » par des super-ordinateurs développés par la DARPA. Nous allons croire et suivre les ordres qui nous sont directement implantés par ces super-ordinateurs, gérés, devinez par qui – par la Cabale Mondialiste – à ce point que nous sommes devenus irréversiblement la personnification du Syndrome du Mouton. La DARPA (Defense Advanced Research Projects Agency) est une branche de recherche et de technologie avancée du Pentagone.

Quelqu’un veut-il cela ?

J’en doute.

Nous devons trouver un moyen d’agir maintenant. Je n’ai pas la solution. Mais peut-être qu’en nous connectant collectivement les uns aux autres spirituellement, peut-être en méditant – nous trouverons une solution – ou nous ferons émerger une solution.

Ce serait la voie noble – changer un environnement totalement abusif avec notre conscience et notre pensée spirituelle ; émettre des vibrations qui influencent notre destin collectif. Mais nous devons y croire et croire en nous-mêmes en tant que collectivité solide et solidaire.

Si nous ne parvenons pas, en tant qu’êtres humains, à revendiquer nos droits humains et civils et à les préserver, la planète finira par se désintoxiquer. Elle se débarrassera du chaos qui est tellement inhumain. Peut-être lui faut-il un ou deux cataclysmes énormes et durables : un tremblement de terre massif avec un tsunami désastreux, une éruption gigantesque d’un ou plusieurs volcans, assombrissant le ciel pendant des semaines, ou un ouragan ou une tempête de verglas monstrueux qui détruit et paralyse des parties de la civilisation, ou encore une énorme explosion solaire, mettant hors service le réseau électrique et électronique mondial – mettant fin à la numérisation de tout sur le champ. – Tout cela pourrait être bien pire que ce que la COVID-19, ou ses inventeurs, n’ont jamais fait.

Après un tel cataclysme, une grande partie de l’humanité pourrait devoir repartir de zéro – de près de zéro, et certainement sans numérisation – mais avec la liberté désormais perdue, pour repartir à zéro et se développer librement et souverainement en fonction de nos besoins.

Pendant des décennies, la « Cabale mondiale » nous a inondés de mensonges flagrants, de promesses de confort et de bien-être, mais avec l’idée que la concurrence plutôt que la coopération sera le véritable moyen de salut. Ces mensonges bien pensés ont conduit à une société de psychopathes égocentriques – non seulement, mais suffisamment pour influencer la nature même de la société, de nos vies dystopiques. Nous avons progressivement accepté, dans le LOCKSTEP, un mouvement de destruction de la société, voire de la civilisation, où on constate qu’il n’y a pas de véritable retour en arrière.

Travaillons à nous sortir du syndrome du mouton – MAINTENANT.

= = =

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 

Les virus mutent… les confinements sont prévus pour durer ad vitam aeternam… Si nous les laissons faire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 19 janvier 2021 by Résistance 71

 

 


Le Pinocchiorona-21…22…23…24…25…26…27…x+1

 

« Des chercheurs qui cherchent on en trouve, mais des chercheurs qui trouvent, on en cherche ! »
~ Coluche ~

 

Les histoires de “mutations” de la COVID19 montrent que les confinements sont prévus pour durer éternellement

 

Brandon Smith

 

Décembre 2020

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-histoires-de-mutations-de-la-covid-19-montrent-que-les-confinements-sont-concus-pour-durer-eternellement

 

Depuis de nombreux mois maintenant, j’avertis que la conception des mesures de confinement de la pandémie est perpétuelle, ce qui signifie que les mesures de confinement sont censées durer éternellement. Nous pouvons le constater dans les commentaires des élites de l’establishment qui font pression pour obtenir ces contraintes ; leur argument le plus fréquent étant que les restrictions liées à la pandémie sont la « nouvelle normalité ». Cette affirmation est soulignée par des globalistes comme Gideon Lichfield du MIT dans son article « On ne va pas revenir à la normale« .

Dans cet article, il déclare :

En fin de compte, cependant, je prédis que nous allons rétablir la capacité de socialiser en toute sécurité en développant des moyens plus sophistiqués pour identifier qui est à risque de maladie et qui ne l’est pas, et en discriminant – légalement – ceux qui le sont.

… on peut imaginer un monde dans lequel, pour prendre un vol, il faudra peut-être être inscrit à un service qui suit vos déplacements via votre téléphone. La compagnie aérienne ne pourrait pas voir où vous êtes allé, mais elle recevrait une alerte si vous avez été à proximité de personnes infectées connues ou de points chauds de la maladie. Les mêmes exigences s’appliquent à l’entrée des grandes salles de spectacles, des bâtiments gouvernementaux ou des centres de transport public. Il y aurait des scanners de température partout, et votre lieu de travail pourrait exiger que vous portiez un moniteur qui surveille votre température ou d’autres signes vitaux. Si les boîtes de nuit demandent une preuve d’âge, elles pourraient à l’avenir exiger une preuve d’immunité – une carte d’identité ou une sorte de vérification numérique via votre téléphone, montrant que vous vous êtes déjà remis ou que vous avez été vacciné contre les dernières souches de virus.

Dans mon article « Vagues de mutilation : La tyrannie médicale et la société sans cash« , j’ai démantelé les arguments de Lichfield et expliqué pourquoi les contrôles que l’establishment tente de mettre en place ont été planifiés longtemps à l’avance. Le « grand reset » et la « quatrième révolution industrielle » sont en cours de développement depuis au moins 2014, date à laquelle ces termes ont été injectés pour la première fois dans les principaux médias économiques. Les idées de société sans cash, d’« économie de partage », de surveillance biométrique des masses, de scores de crédit social, etc. font toutes partie du programme globaliste depuis des décennies. Le coronavirus n’est pour eux qu’une crise utile à exploiter pour justifier les mesures draconiennes qu’ils ont toujours voulues.

Le plan était si prévisible que j’ai même souligné, au début de l’épidémie de coronavirus, que les confinements ne prendraient pas fin même si une vaccination efficace était mise au point, car il leur suffirait de déclarer qu’une « nouvelle mutation » du virus résistante aux traitements existants a été trouvée. Ou bien, ils pourraient concevoir un tout nouveau virus et le diffuser dans la population afin de maintenir la machine à reset en marche.

Il n’est pas surprenant qu’au moment où la nouvelle a été diffusée que les vaccins Pfizer et Moderna, à peine testés et très suspects, étaient mis à la disposition du public, des rapports ont commencé à faire état de mutations du coronavirus, « plus infectieuses« , trouvées dans des endroits comme le Royaume-Uni, l’Inde et l’Afrique du Sud.

Je ne suis pas sûr que les élites puissent être plus transparentes.

Prenez le vaccin Pfizer maintenant et vous pourriez recevoir un passeport d’immunité pendant quelques mois, puis il sera annulé à chaque nouvelle mutation du virus. Vous devez donc vous soumettre à des vaccinations sans fin, dont beaucoup n’ont pas encore été testées et sont potentiellement dangereuses. Comme l’ancien vice-président de Pfizer et d’autres professionnels de la santé l’ont mis en garde, ces vaccins sont comme la roulette russe et pourraient provoquer une réaction auto-immune qui conduirait à la stérilité ou à d’autres réactions nocives.

Les vaccins eux-mêmes sont une solution à court terme, même s’ils sont efficaces. Ils nécessitent plusieurs doses au cours d’un mois, et les vaccinations doivent être renouvelées éventuellement tous les quelques mois. Fondamentalement, cela ne s’arrête jamais. Avec les mutations et les anticorps limités des vaccins, les élites pourraient maintenir les confinements et les contraintes en place pendant de nombreuses années.

L’Organisation Mondiale de la Santé indique clairement que la vaccination ne sera pas nécessairement considérée comme une solution à la propagation du virus. Cela signifie que même si vous êtes vacciné, vous serez toujours considéré comme un porteur et un transmetteur potentiel de la Covid-19, ce qui signifie que les mesures de confinement et les obligations de port de masques ne cesseront pas. Cela soulève la question suivante : quel est l’intérêt du vaccin ?

Le responsable scientifique de l’OMS cite le fait qu’il n’y a pas suffisamment de preuves pour établir que les vaccins empêchent la transmission. Selon cette logique, nous pourrions également soutenir qu’il n’y a pas de preuve que les vaccins sont efficaces à 95%, ou qu’ils sont sûrs à tout le moins.

En attendant, l’OMS et notre sympathique voisin fasciste, le Dr Anthony Fauci, répandent constamment l’histoire selon laquelle la « pire épidémie«  est encore à venir. Il faut que ce train de la peur continue à avancer sur la voie du « Grand Reset », n’est-ce pas ?

Pour les personnes qui croient réellement que la crise de la pandémie de Covid-19 prendra fin après les vaccinations de masse, je suis désolé de le dire, mais vous avez été dupés. Chaque élément de la réponse de l’establishment et chaque déclaration publique qu’ils font indique qu’ils prévoient de violer vos libertés civiles pendant longtemps. Ces promesses d’aide au coin de la rue ? Des mensonges. L’affirmation selon laquelle si vous suivez leur programme, tout reviendra à la normale ? C’est une arnaque. C’est une rhétorique creuse conçue pour vous faire taire et vous soumettre à la tyrannie médicale juste assez longtemps pour que cela devienne irréversible.

Je soupçonne qu’ils espèrent pouvoir conditionner le public au cours des prochaines années à s’adapter simplement aux contrôles jusqu’à ce que nous oubliions ce qu’était la vie avant la pandémie et le reset. Il semble cependant que le plan de reset des globalistes ne se déroule pas très bien.

Les vaccins et les nouvelles sur les mutations semblent précipités, c’est le moins qu’on puisse dire. Au départ, l’establishment a déclaré qu’il faudrait au moins 18 mois rien que pour mettre au point un vaccin à des fins d’essais et de tests, et que les confinements se poursuivraient bien au-delà de ce délai jusqu’à ce qu’une majorité de la population soit immunisée. Au lieu de cela, ils ont lancé plusieurs vaccins en six mois et le récit de la mutation fait déjà la une des journaux.

Je pense que cela est dû au fait que la résistance aux mesures de confinement face à la pandémie s’accroît et que le nombre de personnes refusant de se faire vacciner semble élevé. Comme on le dit, la révolution ne sera pas télévisée, mais il est encore impossible de la cacher complètement.

En Europe, un pourcentage énorme de la population (environ 50 % ou plus selon les pays) hésite à se faire vacciner. Aux États-Unis, les sondages montrent qu’au moins 30 % de la population refusera catégoriquement, tandis que 60 % des gens hésiteront selon l’efficacité du vaccin.

Même un grand nombre d’agents de santé refusent le vaccin, et ce sont ces personnes qui subissent le plus de pression pour se soumettre ou faire face aux conséquences.

Hilarant, les médias affirment que bien qu’il y ait eu « quelques réactions allergiques » au vaccin, il n’y a « aucune preuve d’effets secondaires graves à long terme ». Peut-être est-ce parce qu’il n’y a aucune étude des effets à long terme et qu’il y a eu un minimum d’essais avant que les vaccins ne soient mis sur le marché ? N’est-ce pas là une logique de base ? Pensent-ils vraiment que nous sommes aussi stupides ?

Jusqu’à présent, il semble que des centaines de millions de personnes ne soient pas aussi bêtes. Étonnamment, même des shérifs et des policiers dans tout le pays refusent ouvertement d’appliquer les mandats et d’infliger des sanctions au nom de la loi aux citoyens qui ne se soumettent pas. C’est vraiment un énorme obstacle pour les globalistes et leur reset.

Le virus a produit un IFR (Taux de létalité) de 0,26% chez toute personne ne se trouvant pas dans une maison de retraite avec des conditions préexistantes. Plus de 40 % des décès dus au Covid sont attribués à des personnes âgées qui souffraient déjà de nombreuses affections. Seulement 10 % environ des personnes qui finissent par être hospitalisées à cause de la Covid-19 souffrent de problèmes de santé à long terme (plus de trois mois). De plus, seuls 15 % environ des lits de soins intensifs sont utilisés aux États-Unis, ce qui signifie que les allégations de surcapacité et d’hôpitaux pleins n’étaient rien de plus que de la peur pour susciter des craintes, depuis le début.

Considérez le fait que des centaines de milliers de personnes meurent déjà chaque année de maladies infectieuses comme la grippe et la pneumonie et la Covid-19 commence à sembler beaucoup moins menaçant. Ce n’est certainement pas une excuse pour les confinements médicaux et les mesures orwelliennes de recherche des contacts.

En outre, de nombreuses études révèlent que les mesures de confinement et les masques sont totalement inefficaces pour arrêter la propagation du virus. Les États et les pays dont les contraintes sont parmi les plus strictement appliqués ont également tendance à être les endroits où les pics d’infection sont les plus élevés.

C’est pourquoi il est logique que de nombreuses personnes refusent de se conformer à ces contraintes. Les médias prétendent que nous sommes des théoriciens de la conspiration qui croient que le virus « n’existe pas » ; ce n’est pas le cas. En fait, je soupçonne depuis longtemps que le récit selon lequel le virus « n’existe pas » était une psy-op ou un homme de paille qui serait utilisé contre le mouvement de la liberté plus tard pour discréditer notre résistance aux confinements médicaux.

La plupart d’entre nous sont bien conscients de l’existence du virus. Certains d’entre nous l’ont déjà combattu et s’en sont remis. Ce que nous disons, c’est que le CDC, l’OMS et les propres statistiques de la communauté médicale montrent que la Covid-19 n’est pas une menace pour plus de 99% de la population. Si nous devons accepter leurs statistiques comme étant même très peu précises, alors la Covid-19 devient un non-problème pour la plupart des gens.

Une fois de plus, je poserai la question que les médias dominant refusent de poser :

Pourquoi dit-on à 99 % de la population qu’elle doit sacrifier son emploi, ses entreprises et ses libertés au nom de la sécurité de moins de 1 % de la population ? Pourquoi ne pas demander aux 0,26% de personnes menacées par le virus de se porter volontaires pour rester chez elles afin que le reste d’entre nous puisse reprendre une vie normale ? Pourquoi faisons-nous le contraire de ce qui est le plus logique ?

La réponse est que la réponse à la pandémie est une question de domination, et non de santé publique. Les gens commencent à s’en rendre compte et ils sont sur le point de se révolter.

Donc, la prochaine étape logique pour l’establishment, s’il veut vraiment mettre en place son programme de reset, est d’introduire une nouvelle menace. Cela signifie qu’ils ont besoin d’une « mutation » du virus ou d’un tout nouveau virus afin de créer le genre de peur nécessaire pour manipuler le public et l’amener à accepter un contrôle plus poussé.

Un nouveau virus plus mortel sera-t-il découvert ? Peut-être. Dans la plupart des cas, les virus ont tendance à évoluer vers des souches moins mortelles que l’original. Ils ont également tendance à équilibrer leur taux de propagation et leur taux de mortalité. En d’autres termes, comme toute autre créature, les virus évoluent pour survivre, et un virus ne peut pas survivre s’il tue la majorité de ses hôtes potentiels. Ainsi, ils mutent pour devenir plus infectieux, mais invariablement moins mortels.

Si une « mutation » plus mortelle que la forme actuelle de la Covid-19 apparaît sur la scène, je serais très méfiant quant à ses origines. Le plus probable est que les élites sont en panique et qu’elles utilisent le récit de la mutation comme un outil de propagande pour semer la terreur et le conformisme dans le public. Il se peut qu’il n’y ait pas de mutation du tout, ou que les mutations n’aient aucune incidence significative sur le taux de mortalité.

Ironiquement, en lançant à la hâte les vaccins et les histoires de mutation, les élites se sont sabotées elles-mêmes. Elles ont voulu faire un blitzkrieg du public avec les confinements et elles ont rencontré une résistance plus forte que prévu. Ils ont donc mis le programme de vaccination sur un train fou et maintenant le public se méfie de se faire injecter un modèle de vaccin à peine testé. Maintenant, ils font la promotion du croque-mitaine de la mutation et cela ne fait que faire se demander pourquoi les gens devraient prendre n’importe quel vaccin ? Si le virus va continuellement muter, alors pourquoi prendre un vaccin douteux qui pourrait être inutile en quelques mois ?

Le récit de la mutation ne fait qu’exposer davantage ce qui est vraiment à l’ordre du jour : ce que les élites veulent, c’est un enfermement sans fin. Il n’y a pas de programme pour sauver des vies ou aplatir la courbe. Tout l’argument de la santé est une absurdité totale. Rien de ce qui a été fait jusqu’à présent ne soutient l’idée que la santé publique est la priorité. Au lieu de cela, nous assistons à une course folle vers le totalitarisme en utilisant la Covid-19 comme excuse, et l’effort échoue.

= = =

Voir notre page « Coronavirus, guerre contre l’humanité »

 

COVID-19 fabrication de pandémie et falsification des données, mensonges d’état pour dictature technotronique… Présentation du livre « Le virus et le président » (Izambert-Janvier)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 16 janvier 2021 by Résistance 71

 



 

COVID-19 le vaccin inachevé

 

Jean-Loup Izambert et Claude Janvier

 

Reçu par courriel des auteurs le 13 janvier 2021

 

Commander le livre : https://www.is-ebooks.com/produit/194/9782368452905/le-virus-et-le-president 

 

Impossible d’ignorer que Pfizer et Moderna ont créés en moins d’une année un vaccin ARN messager décrit et salué par des médecins, des politiciens et la presse main stream comme révolutionnaire et efficace contre le Coronavirus. Une vraie prouesse ! Et une vaste fumisterie qui cache les objectifs réels de ces  producteurs de « vaccins miracle ». Avec la complicité du gouvernement français.

Tout est bon pour inciter les citoyens à se faire injecter le précieux liquide. Du chef de l’Etat, en passant par les ministres, les parlementaires, les médias et une certaine caste de médecins, la propagande bat son plein. Comme si cela ne suffisait pas, un collectif d’artistes s’est formé afin de marteler le message tout en louant les vertus de ce vaccin1. Du reste que connaissent-ils ces artistes du processus de la mise au point d’un vaccin ? Rien ! Strictement rien ! Leur démarche est guidée par le bla-bla des lobbyistes des laboratoires et des toubibs médiatiques comme Karine Lacombe, récemment promue pour recevoir la Légion d’honneur en récompense de … Et bien, bonne question, on ne sait pas. Certainement pour son nombre d’interviews record. Elle va bientôt figurer en pôle position dans le Guinness. Pendant ce temps-là, d’autres docteurs et infirmières travaillant en milieu hospitalier nuits et jours ne bénéficieront pas de la même reconnaissance officielle. Pour ces derniers le pouvoir réserve matraques, gazages, arrestations et amendes s’ils viennent à protester contre sa politique de liquidation du système de santé publique.

Quant aux artistes engagés pour la vaccination, on retrouve entre autre Berléand2 qui avait dévoilé son mépris pour le peuple et les Gilets Jaunes, et le décevant Grand Corps Malade. En effet, avec sa chanson « Pas essentiel », on s’attendait à plus de réflexion3. Ce qui est dommage c’est que tout ce beau monde est fermement persuadé que, grâce à cette vaccination, la vie va reprendre comme avant. Retour à la normale, jouée en partition uniquement pour pipeau et violon ! 

Cette légion d’honneur, distribuée à tout-va comme des confettis à des enfants, ne signifie plus grand chose à part récompenser certains malfaisants. Jacques Servier, feu le grand patron des laboratoires du même nom, s’était vu remettre la décoration prestigieuse en plein scandale du Médiator. Rappelons que pendant trente ans, de 1976 à 2009, ce produit dangereux à été prescrit à plus de 5 millions de patients. Jugement final en 2021. Un record de « rapidité » dû à l’état de délabrement avancé du système judiciaire français que mettent en évidence depuis plusieurs années les enquêtes de la Commission européenne pour l’efficacité de la justice (CEPEJ). Entre 220 et 300 décès à court terme et entre 1300 et 1800 à long terme4.  Ce qui n’a pas empêché Nicolas Sarkozy, alors chef de l’Etat à l’époque, de remettre à Servier, le 7 juillet 2009, la plaque et le cordon de grand-croix – la plus haute distinction – de la Légion d’honneur5, alors que la célèbre pneumologue Irène Frachon, dans son livre – Médiator 150 mg, combien de morts ? – publié deux ans plus tôt dénonçait les méfaits du médicament « miracle ». 

Mais revenons à ce vaccin miraculeux fabriqué en moins d’un an. Les chercheurs ont bossé nuit et jour. Quand il y a des bénéfices à faire, pas d’hésitation…

Effets indésirables graves : la question est loin d’être résolue

Le professeur Raoult que l’on ne présente pas déclare le 8 janvier 2021 que ce vaccin n’est pas la baguette magique qui va arrêter l’épidémie. Extrait de l’article « … Je pense que la plupart d’entre eux (les vaccins) ne présentent pas de risques à court terme. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : il ne s’est pas passé de choses extraordinaires. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : Je ne le crois pas non plus. »6.

Côté Pfizer, le vaccin Covid-19 assurerait une efficacité globale de 80,2 % après la première injection, atteignant 94,1 % 14 jours après la seconde injection7.  

Côté Vidal, la bible des médecins, au 10 décembre 2020, dans son article  « Vaccin Pfizer/Biontech contre la Covid-19 : Enfin des données à analyser ! » : « un taux de protection de 52,4 % dès la première injection » mais surtout : « Les questions relatives à l’efficacité qui demeurent en suspens », « Des effets indésirables post-injection plus sévères chez les moins de 56 ans », « Les questions relatives à la toxicité qui demeurent en suspens »… Puis plus loin : « La possibilité d’effets indésirables graves, rares ou décalés dans le temps »8 ; « La toxicité chez les moins de 16 ans, les femmes enceintes et allaitantes et les personnes immunodéprimées ». Le Vidal souligne en conclusion : « la question d’une éventuelle toxicité à long terme se pose toujours, ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » En  cas d’effets indésirables graves possibles, qui ne semblent  nullement gêner ceux qui vaccinent avec ces vaccins inachevés, rendez-vous à l’hôpital s’il reste des lits hospitaliers ou au…cimetière. 

Le prix de l’incompétence

Comment ignorer que le développement et la mise au point d’un vaccin prend en moyenne une dizaine d’années en respectant le principe de précaution qui permet de s’assurer qu’il soit sans danger pour l’homme avant sa mise sur le marché ?

« Des prototypes de candidats-vaccins sont mis au point en laboratoire à partir de germes, puis on lance la production pharmaceutique et on réalise les premiers tests sur des animaux. Il faut ensuite obtenir des autorisations réglementaires pour mener des essais cliniques, plus vastes sur l’Homme. »9

Admettons quand même que ce vaccin soit efficace à 94,1 %. Si tel était le cas, et s’il protégeait réellement les vaccinés, pourquoi obliger ceux qui n’ont pas envie d’être vacciné à l’être ? Pourquoi vouloir établir un « passeport de santé/vaccination » qui serait exigible avant de prendre un avion, de monter dans un train, ou d’aller au spectacle ? La vérité semble ailleurs…

Nos braves artistes partant en guerre pour que tout le monde se fasse vacciner, feraient bien de revoir leurs copies. Car, s’ils s’imaginent que les salles de spectacles, les théâtres, les cinémas, et les restaurants (pour manger un petit bout en fin de soirée), vont réouvrir très vite, ils se fourrent le doigt dans l’oeil jusqu’au coude. 

Comment voulez-vous que le Conseil scientifique donne son feu vert à la liberté, vu que Jean-François Delfraissy, le  président du Conseil scientifique du pouvoir, a déclaré le 18 décembre 2020 que 2021 ressemblera à 2020.10. Tout comme il avait déjà déclaré en 2009 qu’il allait falloir vacciner deux fois les Français contre le virus de la grippe H1N1, alors présentée comme une terrible pandémie. Terrible au point qu’elle disparut en une année presqu’aussi vite qu’elle avait surgit … Coût pour l’Etat de ces prévisions aussi alarmistes qu’infondées et fumeuses : plus de 500 millions d’euros pour la seule opération vaccin dont des millions de doses seront annulées après dédommagements financiers de ses producteurs et 15 millions d’autres détruites ! Banco. 

Comme le reconnut lui-même le professeur Delfraissy une fois que l’orage fût passé, il « n’était pas un spécialiste des virus de la grippe », pas plus qu’il ne l’est d’ailleurs aujourd’hui de ce coronavirus. Voilà qui « rassure » et laisse déjà entrevoir que la nouvelle ardoise laissée par ce régime et ses conseillers – des milliards d’euros avec un nouveau surendettement du pays – pourrait bien tomber plus vite que prévu comme des tuiles sur la place publique.  

Un vaccin est normalement sensé vous immuniser contre une maladie. Si vous êtes vacciné contre le tétanos, vous êtes protégé à 100 %. Extrait du Vidal : « La vaccination contre le tétanos est efficace à 100 % et cette maladie a quasiment disparu dans les pays, dont la France, où une politique vaccinale complète est appliquée et réalisée. De 2005 à 2017, 112 cas de tétanos ont été déclarés en France – sois moins de 10 par an. » Si le vaccin contre la Covid-19 ne peut être efficace à 100% en 2021, aucun de ses fabricants ne peut garantir sa sûreté. Ceux-ci ne s’étendent pas sur ses possibles effets secondaires. Comme on les comprend. 

Si le vaccin vous rend malades, on y est pour rien…

Une réunion du comité consultatif de la Food and Drug Administration (FDA) des États-Unis intitulée Vaccins et produits biologiques connexes qui s’est tenue le 22 octobre 2020 n’a-t-elle pas listé 22 conséquences négatives possibles, y compris la mort, avec ces vaccins alors en cours d’élaboration ?11 Cette liste, projet de travail sur les événements indésirables très graves pouvant survenir, n’incluait pas tous les effets négatifs mineurs et non étudiés sur la santé qui résulteront de ces injections pour une raison simple : ceux-ci ne peuvent apparaître qu’au bout de plusieurs années.

Voilà qui explique pourquoi les dirigeants de ces transnationales de la pharmacie ont été jusqu’à solliciter très fortement la Commission « européenne » afin qu’elle les décharge de leurs responsabilités sur les effets secondaires. Extrait de l’article LCI du 22 septembre 2020 : «  Le 27 août, la Commission européenne a confirmé être en discussion avec les laboratoires » sur ce sujet. Ces clauses sont ainsi en discussion afin de « compenser les risques élevés pris par les laboratoires ». Risques élevés ? Risques de pertes de profits faramineux par la vente de vaccins qui ne peuvent qu’être inachevés dans leur conception au moment de leur mise sur le marché ? Non, risques financier pour des effets secondaires liés à « une éventuelle toxicité à long terme (qui) se pose toujours » en début d’année 2021 « ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » Et c’est justement pourquoi « les contrats d’achat anticipé prévoient que les états membres de l’UE indemnisent les fabricants pour les responsabilités encourues dans certaines conditions. »12 

Cerise sur le gâteau, ces vaccins ne garantiraient qu’une immunité de quelques mois, variable selon les fabricants. Ensuite rebelote pour une injection et jackpot pour Pfizer, Moderna et les autres. 

On imagine mal que des producteurs de vaccins assurés de l’efficacité et de la sûreté de leurs produits aillent quémander l’aide d’un Etat qu’ils ne cessent de stipendier au nom de la « libéralisation des entreprises » et auquel ils reprochent un prétendu « interventionnisme » pour qu’il prenne à sa charge les déboires qui pourraient survenir après l’injection de leur « vaccin révolutionnaire » 

Aussi, nul besoin d’être un grand devin pour deviner que le délire confinatoire avec port du masque et couvre feu va continuer alors que le mardi 12 mars 2020, l’inénarable Directeur général de la Santé, Jérôme Salomon, déclarait que « 98% des gens guérissent » de la Covid-19. Et attention, en matière de coronavirus le haut fonctionnaire Jérôme sait de quoi il parle : c’est lui qui annonça le 3 février 2020 qu’ « il n’y a pas d’épidémie en France, même pas de chaîne de transmission dans notre pays et aucune circulation du virus sur le territoire. » Le jour même la France comptait ses six premiers cas confirmés porteurs du virus SRAS-CoV-2, 57 le 29 du même mois et 191 avec le premier décès le 3 mars !

Notre enquête

 Se soigner ? Du repos chez soi, et pour aider, du zinc, de la vitamine D, de la vitamine C, de l’aspirine ou du Doliprane13, 14. Mais alors que devient l’Hydroxychloroquine, interdite par la « sinistre » de la Santé Buzyn aux médecins généralistes bien que ceux-ci parviennent à soigner des malades à l’hôpital s’ils sont traités dès les premiers symptômes ? 

Difficile de s’y retrouver dans les affirmations les plus contradictoires qui agitent la communauté scientifique auxquelles s’ajoutent les fausses  nouvelles diffusées par le Premier ministre et certaines administrations. Rien d’étonnant pourtant puisque ce coronavirus est nouveau pour les chercheurs, du moins pour ceux qui ne travaillent pas à la mise au point d’armes biologiques offensives dans l’un de ces laboratoires de l’armée des Etats-Unis échappant à tout contrôle international. Mais ceci est une autre histoire, celle de guerres biologiques et chimiques qui ne commencent ni en République populaire de Chine, ni en France mais au cœur de la Maison Blanche…

Nous sommes journalistes et non scientifiques et notre rôle est de rapporter avec rigueur à la population les informations et les idées qui circulent dans la société. Nous n’avons pas la prétention d’affirmer ce qu’il faut faire ou ne pas faire au plan médical ainsi que s’y ridiculisent des éditocrates parisiens et autres médecins imaginaires autoproclamés qui se répandent dans des médias dont les transnationales de Big Pharma sont l’un des principaux annonceurs. Par contre nous avons la détermination inébranlable de dénoncer les fausses informations, d’où qu’elles viennent, en nous appuyant sur des sources fiables – Insee, CNRS, Inserm, etc. -, en vérifiant et croisant leurs données et en analysant les faits avec le nécessaire recul. 

La pratique rigoureuse de l’enquête journalistique implique de suivre la « règle des trois principes » : bannir toute idée reçue, ne faire confiance à personne, vérifier les informations par recoupements. C’est pourquoi nous pouvons affirmer que ce gouvernement ment à l’opinion publique lorsqu’il prend prétexte d’une prétendue virulence du virus pour imposer de nouvelles mesures qui détruisent le contrat social français. Parvenu à ce stade de mensonge d’Etat, ce gouvernement n’a plus d’autre choix que d’entretenir la peur pour endiguer la révolte qui menace et permettre aux sociétés transnationales de la pharmacie d’écouler leurs millions de doses de vaccins autant inutiles qu’inachevés. 

Vous doutez ?

Fausses informations gouvernementales

Un nouvel exemple de l’esbroufe gouvernementale appert en début d’année 2021 : le nombre de personnes contaminées par la Covid-19 annoncé en décembre 2020 par le gouvernement, son ministre de la santé et son administration, et relayé par la plupart des médias, est de 1068 cas confirmés par semaine par million d’habitants. Cette statistique est diffusée par la plateforme ouverte des données publiques françaises (www.data.gouv.fr, https://LaFibre.info/Covid19, Comparatif du nombre de cas Covid-19 par semaine entre pays rapporté par million d’habitants, mise à jour du 06 décembre 2020 à 17h.)

Or, si l’on examine de près les chiffres du réseau Sentinelles de l’Institut national de la santé et de la recherche médicale (Inserm) composé de 1200 cabinets médicaux sur tout le territoire, ce rapport s’avère bien différent : 14 cas pour 100 000 personnes soit environ 140 cas pour un million d’habitants. Huit fois moins ! Rappelons que le taux de Sentinelles correspond aux vrais malades symptomatiques rencontrés dans les cabinets médicaux et testés. Ainsi que l’indique le réseau Sentinelles dans son bulletin sur la situation observée pour la semaine 53 – du 28 décembre 2020 au 03 janvier 2021-, « à partir des données cliniques et virologiques concernant les cas d’IRA (NdA : Infections respiratoires aiguës) vus en consultation de médecine générale, il est possible d’estimer la part de ces cas dus au COVID-19. » En semaine 53 à cheval entre décembre 2020 et janvier 2021, « aucun prélèvement n’a été testé positif au SARS-CoV-2 (COVID-19) parmi les prélèvements analysés. Ceci permet d’estimer que le taux d’incidence des cas d’IRA dus au SARS-CoV-2 (COVID-19) vus en médecine générale serait inférieur à 14 cas pour 100 000 habitants, représentant moins de 9 097 nouveaux cas de COVID-19 ayant consulté un médecin généraliste. » Précision de l’Inserm : « Cette estimation est stable par rapport aux semaines précédentes. » Quel média vous a rapporté ces faits et cette « stabilité par rapport aux semaines précédentes » ?… Le seuil épidémique étant de 150 à 200 cas pour 100 000 personnes, il est permis d’affirmer que le virus est en voie de disparition. 

Aussi, la troisième vague, le reconfinement, le couvre-feu et autres mesures annoncées par le gouvernement à grand renfort de médias semblent n’avoir qu’une raison d’être : entretenir la peur pour écouler le stock de millions de doses de vaccins ! Olivier Veran, ministre des Solidarités et de la Santé, ne tient visiblement pas à jouer « Bachelot 2 le retour » sur les traces de la « sinistre » de la Santé du gouvernement Fillon. Rappelez-vous : en 2010 celle-ci, suivant à la lettre les conseils du même Jean-François Delfraissy et de son équipe pour contrer la grippe H1N1, s’était retrouvée avec des dizaines de millions de doses de vaccins inutiles…

Les « profiteurs pandémiques »

Ceux qui depuis le début de l’année 2020 n’arrêtent pas de diffuser des annonces gouvernementales et d’administrations sans les vérifier puisqu’émises par des sources officielles  – donc a priori crédibles – se retrouvent, devant les arguments que nous présentons aux lecteurs, seuls et démunis avec le sentiment d’avoir été trompés par le pouvoir et ses représentants pour les plus honnêtes et professionnels d’entre eux. Si, si, il en existe encore… Si des erreurs peuvent survenir dans la création et la diffusion d’informations, celles-ci répétées dans le temps sur un même sujet façonnent ce qui s’appelle un mensonge d’Etat.

Ceux qui en font les frais ? 

Les professionnels de la santé et, d’une manière générale, les salariés des entreprises, les transporteurs, commerçants, artisans, hôteliers-restaurateurs, patrons de boîtes nuits, autocaristes, TPE et PME-PMI, les professions du spectacle et de l’événementiel, les salles de sports…Bref, tous les entrepreneurs et indépendants, qui grâce à leur travail et à leur dur labeur font vivre leurs familles et donnent de la convivialité à notre nation sont en train de disparaître.

En revanche, comme nous le montrons dans Le virus et le président, les « profiteurs pandémiques » se portent plutôt très bien. Parmi eux, les sociétés transnationales du CAC 40 – dont celles de la pharmacie – qui, tout en réalisant les plus importants chiffres d’affaires reçoivent, bon an mal an, plus de 200 milliards d’euros de subventions publiques et d’exonérations fiscales de l’Etat et de l’Union dite « européenne » et continuent de coter à la hausse en Bourse tout en tuant des milliers et des milliers d’emplois en France. C’est un peu aussi pourquoi nous disons que lorsque le président Macron qui a consacré son temps, depuis qu’il s’est assis en 2012 près de l’ancien président François Hollande, a privatiser l’économie, créer du chômage, réduire encore le système de santé publique, endetter le pays, déclare vouloir « reconstruire une économie forte et souveraine » c’est un peu comme si une dinde fêtait Noël.

Le livre qui dérange

Le virus et le président n’oublie pas ces fauteurs de crise tant sanitaire qu’économique et financière. Vous y lirez comment les privilégiés du système se gavent des richesses de notre beau pays avec le concours de parlementaires qui, pour la plupart, ne sont plus que des sortes de greffiers de la Commission « européenne » qui confinent le budget de la Santé publique dans l’une des dernières places du budget de l’Etat. Pendant que la France du travail et de la création perd sa santé jusqu’à l’agonie sur l’une des toutes premières marches du podium du taux de suicide d’Europe occidentale, des profiteurs sans scrupules la pillent en flux tendu 24 heures sur 24. La fable du « vaccin miracle » inachevé contre la Covid-19 ne raconte pas une autre histoire que celle des manigances de ces accapareurs à la recherche de profit maximum immédiat quelles qu’en soient les conséquences pour le peuple.

Ce vol noir de corbeaux sur le pays qu’ils enchaînent à coups d’ordonnances de l’Union « européenne » et de lois liberticides et anti-sociales est le tableau « idyllique » annoncé par Klaus Schwab, le fondateur de Davos et de son Forum Economique Mondial, ainsi qu’il l’explique dans son livre, Covid-19 : la grande réinitialisation. C’est écrit noir sur blanc et ce n’est pas complotiste. C’est une réalité qui est en train de s’étendre, comme une gangrène malfaisante à toute la planète15. Aussi, le temps de la perdition, de la désespérance et du silence est révolu. Place à la réflexion, au débat et à l’action ! 

Notre livre Le virus et le président, (IS Edition, www.is-edition.com), qui vient de sortir souhaite y contribuer, peut vous éclairer, vous permettre de comprendre comment et pourquoi le pouvoir vous trompe, favoriser le débat, inciter à rechercher et à écrire les propositions qui permettront de changer de cap. Enquêtes minutieuses, faits, chiffres, zestes d’humour16… 

Le vaccin inachevé ? Comme pour ses promoteurs et propagandistes, au vu de ce qui précède, vous aurez deviné notre position. 

Jean-Loup Izambert et Claude Janvier

Notes :

1.https://www.msn.com/fr-fr/actualite/france/appel-de-200-artistes-pour-la-vaccination-c-est-le-seul-moyen-de-sortir-de-ce-bordel/ar-BB1cyLhj?ocid=msedgdhp et https://www.leparisien.fr/culture-loisirs/covid-19-l-appel-de-200-personnalites-de-la-culture-qui-veulent-se-faire-vacciner-06-01-2021-8417619.php

2.https://www.lefigaro.fr/cinema/ils-me-font-ch-francois-berleand-s-explique-devant-des-gilets-jaunes-20191209

3.https://www.youtube.com/watch?v=NencPkx7qgY

4.https://www.lepoint.fr/justice/proces-mediator-dernier-round-07-07-2020-2383304_2386.

5.https://www.nouvelobs.com/societe/20111010.OBS2124/nicolas-sarkozy-et-la-legion-d-honneur-le-revers-de-la-medaille.html

6.https://www.lindependant.fr/2021/01/08/covid-19-pour-didier-raoult-le-vaccin-nest-pas-la-baguette-magique-qui-va-arreter-lepidemie-9299989.php

7.https://www.vidal.fr/actualites/26337-vaccin-pfizer-biontech-contre-la-covid-19-enfin-des-donnees-a-analyser.html

8.https://www.vidal.fr/actualites/26105-vaccins-contre-la-covid-19-doit-on-s-inquieter-du-risque-de-maladie-aggravee-chez-les-personnes-vaccinees.html

9.https://www.santemagazine.fr/traitement/medicaments/vaccins/vaccins-contre-le-coronavirus-quelles-differences-pour-qui-quand-873097

10.https://www.ouest-france.fr/sante/virus/coronavirus/covid-19-jean-francois-delfraissy-2021-ressemblera-a-2020-7091792 

11.FDA U.S., Food & Drug Administration, Steve Anderson, VRBPAC, meeting October 22, 2020. Vaccines and Related Biological Products Advisory Committee (VRBPAC), October 22, 2020. Meeting Announcement. La FDA révèle une longue liste de problèmes de santé graves pouvant résulter de la vaccination contre le covid-19, y compris la mort, par Lance D.Jolmage, Natural News, mercredi 09 décembre 2020.

12.https://www.lci.fr/sante/vaccins-contre-le-covid-19-les-laboratoires-seront-ils-vraiment-decharges-de-toute-responsabilite-en-cas-d-effets-secondaires-2165265.html

13.https://france3-regions.francetvinfo.fr/occitanie/haute-garonne/toulouse/collectif-medecins-preconise-utilisation-vitamine-du-zinc-prevenir-formes-graves-covid-1908356.html

14.https://www.bfmtv.com/sante/en-combien-de-temps-guerit-on-du-coronavirus_AN-202003120174.html

15.https://blogs.mediapart.fr/semcheddine/blog/011220/covid-19-grande-reinitialisation-ou-insurrection-des-consciences et  https://lecourrierdesstrateges.fr/2020/12/29/le-great-reset-annonce-t-il-la-fin-du-travail-independant/

16.https://www.is-edition.com/actualites/parution-le-virus-et-le-president-jean-loup-izambert-claude-janvier/

 

Lectures complémentaires sur notre page « Coronavirus, guerre contre l’humanité »

 

Un an… Ce que l’on sait du SRAS-CoV2 et de la « pandémie » COVID-19 associée : une mise à jour des données récentes (Denis Rancourt)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , on 12 janvier 2021 by Résistance 71

 

Une remarquable synthèse de Denis Rancourt sur ce qu’on sait aujourd’hui SCIENTIFIQUEMENT sur le SRAS-CoV-2 et la « pandémie » COVID-19 associée. A lire et diffuser au plus grand large et sans aucune modération.
Nous devons stopper cette imposture avant qu’elle ne nous enferme dans sa dictature technotronique eugéniste programmée.
~ Résistance 71 ~

 

 

Mise à jour des données récentes concernant la politique COVID-19

Les mesures de confinement n’empêchent pas les décès, la transmission ne se fait pas par contact, les masques n’apportent aucun bénéfice, les vaccins sont intrinsèquement dangereux.

 

Denis Rancourt

 

28 décembre 2020

 

Source Research Gate

 

url de l’article en français :
https://lesakerfrancophone.fr/mise-a-jour-des-donnees-scientifiques-recentes-concernant-la-politique-covid-19#fn-98503-18

Le texte en PDF :
Denis_Rancourt_Mise_a_jour_des_donnees_de_ce_quon_sait_sur_le_SRAS-CoV-2

Les mesures sans précédent de confinement universel, de confinement institutionnel strict des maisons de soins, de masquage universel de la population, d’obsession hygiénique des surfaces et des mains et de déploiement accéléré des vaccins sont contraires à la science connue et aux récentes études de référence. Le gouvernement a fait preuve d’imprudence par action et de négligence par omission. Des mesures institutionnelles sont nécessaires depuis longtemps pour endiguer la corruption dans le domaine de la médecine et de la politique de santé publique.

Introduction – Pandémie iatrogène de panique

Le contexte politico-sanitaire est un contexte dans lequel, jusqu’en 2019, le consensus scientifique et politique passé en revue était que les mesures globales généralement et universellement appliquées en 2020 étaient 1 2 :

  • non recommandées sans être justifiées par des preuves quantitatives suffisantes des circonstances épidémiologiques locales (juridictionnelles) (transmissibilité, gravité de la maladie, impact), et sans être mises en balance avec les préjudices économiques, sanitaires et sociaux locaux qui en résultent
  • pour de nombreuses mesures (recherche des contacts, mise en quarantaine des personnes exposées, contrôle des entrées et des sorties, fermeture des frontières), « non recommandé en aucune circonstance », quelle que soit la gravité de la maladie respiratoire virale pandémique (modérée, élevée ou extraordinaire)

Le contexte politico-sanitaire est également un contexte dans lequel il existe une histoire récente documentée de « paniques répétées de pandémie de santé » dans laquelle « les experts en maladies souhaitent attirer l’attention du public et faire pencher les décisions d’allocation de ressources en faveur de la maladie qui les intéresse ». 3. Bonneux et Van Damme, en 2011, l’ont exprimé ainsi 4 :

“Les paniques répétées de pandémie de santé causées par un virus aviaire H5N1 et un nouveau virus de grippe humaine A(H1N1) font partie de la culture de la peur [réf.] Le pire des scénarios a remplacé l’évaluation équilibrée des risques. Le pire des scénarios est motivé par la conviction que le danger auquel nous sommes confrontés est tellement catastrophique que nous devons agir immédiatement. Plutôt que d’attendre des informations, nous avons besoin d’une frappe préventive. Mais si les ressources achètent des vies, le gaspillage des ressources gaspille des vies. Le stockage préventif d’antiviraux largement inutiles et les politiques irrationnelles de vaccination contre un virus H1N1 exceptionnellement bénin ont gaspillé plusieurs milliards d’euros et érodé la confiance du public dans les responsables de la santé. [réf.] La politique de lutte contre la pandémie n’a jamais été guidée par des preuves, mais par la crainte des pires scénarios.”

En outre, un important scandale de conflit d’intérêts concernant les recommandations de l’OMS en matière de pandémie de grippe a été exposé en détail en 2010, où les enquêteurs Cohen et Carter ont conclu : « Parmi les principaux scientifiques qui conseillent l’Organisation mondiale de la santé sur la planification d’une pandémie de grippe, certains ont fait un travail rémunéré pour les entreprises pharmaceutiques qui ont tout à gagner des conseils qu’ils ont rédigés. Ces conflits d’intérêts n’ont jamais été rendus publics par l’OMS ». 5

En 2020, rien de tout cela n’avait d’importance. Nous sommes entrés dans un monde de propagande, avec des institutions captives. Le principe de précaution (le gouvernement doit prouver l’absence probable de dommages avant d’imposer des politiques dangereuses) a été renversé, et la charge de la preuve a été imposée à la science pour justifier a posteriori des mesures sans précédent, rapidement imposées en l’absence de science ou même en s’opposant à elle. Malheureusement, une grande partie ou la plupart de l’establishment scientifique s’est conformé au nouveau programme.

Récemment, il y a eu à la fois des événements dramatiques (lancement du vaccin) et des communications scientifiques importantes, depuis que j’ai publié mes deux premiers articles scientifiques concernant la politique autour de la COVID-19, le 11 avril 2020 6 et le 3 août 2020 7, ainsi que des articles sur les préjudices mortels des réponses gouvernementales, déduits des données sur la mortalité toutes causes confondues, dépendantes du temps et de la juridiction 8 9.

Mes deux premières analyses ont porté sur la science et la politique des masques 10 11. La présente mise à jour des développements récents porte à nouveau sur les masques, et comprend en outre des points clés sur les mesures de confinement et les vaccins.

La rigueur des mesures n’a aucun effet sur le nombre total de décès attribués à la COVID-19

Deux grandes études récentes ont été menées à l’échelle mondiale.

Dans leur article du 21 juillet 2020 intitulé « Une analyse au niveau national mesurant l’impact des actions gouvernementales, de l’état de préparation du pays et des facteurs socio-économiques sur la mortalité de la COVID-19 et les résultats sanitaires associés » (50 pays), Chaudhry et al. ont indiqué 12 :

“La fermeture rapide des frontières, le confinement total et les tests à grande échelle n’ont pas été associés à la mortalité de la COVID-19 par million de personnes. (Résumé / Résultats)

Lorsque la mortalité de la COVID-19 a été évaluée, les variables significativement associées à une augmentation du taux de mortalité par million étaient la prévalence de l’obésité dans la population et le PIB par habitant. En revanche, les variables qui étaient négativement associées à une augmentation de la mortalité de la COVID-19 étaient la réduction de la dispersion des revenus au sein de la nation, la prévalence du tabagisme et le nombre d’infirmières par million d’habitants. En effet, un plus grand nombre d’infirmières dans un système de soins de santé donné était associé à une réduction de la mortalité. Les taux de mortalité étaient également plus élevés dans les comtés dont la population était plus âgée […]. Enfin, les mesures gouvernementales telles que la fermeture des frontières, le confinement total et un taux élevé de tests COVID-19 n’ont pas été associées à des réductions statistiquement significatives du nombre de cas critiques ou de la mortalité globale. (Section 3.4)”

Dans leur article du 19 novembre 2020 « Mortalité du fait de la COVID-19 : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées » (160 pays), De Larochelambert et al. ont trouvé 13 :

“Résultats : Des taux de mortalité plus élevés sont observés dans les zones de latitude [25/65°] et de longitude [-35/-125°]. Les critères nationaux les plus associés au taux de mortalité sont l’espérance de vie et son ralentissement, le contexte de santé publique (fardeau des maladies métaboliques et non transmissibles (MNT) par rapport à la prévalence des maladies infectieuses), l’économie (produit national de croissance, soutien financier) et l’environnement (température, indice ultra-violet). La rigueur des mesures mises en place pour lutter contre la pandémie, y compris le confinement, ne semble pas être liée au taux de mortalité.

Conclusion : Les pays qui ont déjà connu une stagnation ou une régression de l’espérance de vie, avec des revenus et des taux de mortalité élevés, ont eu le plus lourd tribut à payer. Ce fardeau n’a pas été allégé par des décisions publiques plus strictes. Des facteurs inhérents ont prédéterminé la mortalité de la Covid-19 : leur compréhension peut améliorer les stratégies de prévention en augmentant la résilience de la population grâce à une meilleure condition physique et une meilleure immunité. (Résumé)”

L’American Institute for Economic Research (AIER Staff) a passé en revue ces études et 22 autres études qui aboutissent à des conclusions similaires, dans son rapport du 19 décembre 2020 intitulé « Les confinements ne contrôlent pas le coronavirus : Les preuves » 14.

Par conséquent, dans l’ensemble, le nombre total de cas critiques et le nombre total de décès étaient associés à l’état de santé préexistant et à l’état sociétal de la population, et cela n’a pas été amélioré par les mesures gouvernementales visant à ralentir la transmission.

Il est important de noter qu’en plus des études sur les associations avec la mortalité totale, la dépendance temporelle et la granularité (dépendance juridictionnelle) de la mortalité toutes causes confondues montrent que la déclaration de pandémie de l’OMS du 11 mars 2020 et la recommandation universelle de « préparer vos hôpitaux » ont été suivies d’un grand nombre de décès, probablement induits par les infections et le confinement strict des maisons de soins non ventilées pour les personnes malades et âgées 15 16.

La pandémie iatrogène de propagande en terme de psychologie de masse et la sociologie autour de la COVID-19 de 2020 commencent à être étudiées par des méthodes quantitatives 17.

La corruption de la science est mise à nue – Masques et PCR

Un aspect positif de ce que l’on peut appeler la « pandémie de propagande » actuelle est que la corruption systémique généralisée de l’establishment scientifique est exposée, non seulement par des rétractations très médiatisées d’articles publiés dans des revues de premier plan, mais aussi par des éditoriaux critiques. Par exemple, le 13 novembre 2020, le rédacteur exécutif Kamran Abbasi l’a exprimé en termes très clairs dans les pages de l’éminent BMJ 18 :

“La science est supprimée pour des raisons politiques et financières. La Covid-19 a déclenché une corruption de l’État à grande échelle, et elle est nuisible à la santé publique. [réf] Les politiciens et l’industrie sont responsables de ce détournement opportuniste. Les scientifiques et les experts de la santé le sont également. La pandémie a révélé comment le complexe politico-médical peut être manipulé en cas d’urgence, à un moment où il est encore plus important de sauvegarder la science.”

J’en donne trois exemples.

Premièrement, le biais systémique est palpable dans une mini-saga récente sur les masques, publiée dans les pages du New England Journal of Medicine 19 20 21.

Gandhi et Rutherford ont écrit un article intitulé « Perspective », publié le 29 octobre 2020 22. Les auteurs avancent l’idée extraordinaire que se masquer réduit la gravité de la maladie chez les personnes infectées. Ils commencent par l’affirmation propagandiste selon laquelle le masquage facial universel est « l’un des piliers de la lutte contre la pandémie de Covid-19 ». Ils poursuivent en avançant l’argument fantastique suivant : les masques peuvent réduire l’inoculum viral et donc provoquer des infections asymptomatiques dans lesquelles le sujet développe une immunité. Cela a alarmé les répondants car le mécanisme proposé est ce que l’on pourrait appeler « l’immunité acquise naturellement grâce aux masques ». Admettre tout type d’immunité naturelle, qui est une dure réalité de la biologie de l’évolution, est devenu sacrilège.

Deux groupes de chercheurs ont publié des réfutations contre Gandhi et Rutherford, dans la même revue.

Rasmussen et al. ont écrit 23 :

“Il n’y a pas suffisamment de preuves pour soutenir l’affirmation selon laquelle les masques réduisent la dose infectieuse du SRAS-CoV-2 et la gravité de la Covid-19, et encore moins que leur utilisation peut induire une immunité protectrice. […] La suggestion que les masques offrent une alternative à la vaccination sans preuve que les bénéfices l’emportent sur les grands risques encourage implicitement les comportements irresponsables.”

Brosseau et al. ont, pour leur part, réajusté diplomatiquement les vues exposées par Gandhi et Rutherford en ramenant les lecteurs à la science et à la réalité établies 24 :

“La réplication virale est liée à la dose, mais la gravité de la maladie ne l’est pas. L’épidémiologie indique que l’apparition de formes graves de Covid-19 est associée à des conditions préexistantes et à d’autres facteurs de risque, tels que l’âge, le sexe et la grossesse [réf].

Bien qu’elle n’ait pas encore été démontrée dans des modèles expérimentaux, la dose infectieuse du SRAS-CoV-2 est probablement similaire à celle du SRAS-CoV – environ 300 virions [réf]. Quelle que soit la gravité de la maladie, les gens présentent des charges virales élevées et un virus infectieux pendant au moins 8 jours après l’apparition des symptômes. La parole normale peut générer jusqu’à 3000 particules de 1 micron par minute dans l’air expiré, [ref] et chaque particule pourrait contenir plus de 250 virions, ce qui signifie qu’une seule minute de parole génère potentiellement plus de 750 000 virions. Les revêtements de visage en tissu ont une efficacité très variable en fonction de la capacité de filtrage et de l’ajustement. Le port d’un couvre-visage en tissu à proximité d’une personne infectée pendant plusieurs minutes peut ne pas empêcher la réception d’une dose infectieuse, qui, comme indiqué ci-dessus, n’est pas corrélée à une maladie moins grave.”

Les auteurs de l’article original n’ont pas été dissuadés et ont répondu :

« Plus de preuves s’accumulent pour supporter cette idée » et « il y a de plus en plus de preuves à la fois physiques et d’enquêtes épidémiologiques que les masques en tissu (s’ils sont portés correctement) réduisent à la fois la transmission et l’acquisition » 25 L’examen de leurs sources montre que les auteurs ont une vision généreuse de ce qui peut constituer une « preuve » à l’appui. Voir également 26, concernant la tournure que prend l’« accumulation de preuves » dans le contexte politique des masques faciaux.

Deuxièmement, un exemple étonnant, toujours à propos des masques, est fourni dans les pages de Nature Medicine. Ici, l’équipe de prévision de la COVID-19 de l’IHME, le 23 octobre 2020 (« étude de l’IHME »), a déclaré que le port universel de masque serait d’une grande utilité aux États-Unis 27 :

“L’utilisation du port universel de masque pourrait sauver 129 574 (entre 85 284 – 170 867) vies supplémentaires entre le 22 septembre 2020 et la fin février 2021, ou 95 814 (entre 60 731 – 133 077) vies supplémentaires en supposant une adoption moindre du port du masque (85%), par rapport au scénario de référence. (Résumé)”

Si les masques offrent un avantage aussi important, il est impossible de comprendre comment aucun des nombreux grands essais contrôlés randomisés (ECR) dont les résultats sont vérifiés, n’a détecté cet avantage. Il est impossible d’obtenir les résultats négatifs souvent répétés dans les études ECR de qualité suffisante pour informer la politique sanitaire, si les prémisses et les conclusions de l’étude IHME sont correctes. L’étude de l’IHME a été réfutée avant même sa publication.

L’étude de l’IHME est fatalement défectueuse sur au moins deux points :

  1. La méta-régression utilisée pour estimer (« suggérer », selon leurs termes) que le port universel du masque permet une réduction de 40% et plus de la transmission est sans valeur, et est le fruit d’un biais constructif ;
  2. Ils ont utilisé des données incorrectes pour évaluer la conformité du masquage de la population américaine pour la période concernée.

Cette dernière faille fatale a été exposée par Magness, dans son rapport publié dans le Wall Street Journal, intitulé « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées » 28 :

“Malheureusement, les conclusions des modélisateurs de l’IHME contenaient une erreur que même un examen minimal aurait dû permettre de détecter. Le nombre prévu de vies sauvées et le cas implicite d’une obligation de port de masques sont basés sur une statistique erronée. En utilisant une enquête datant de plusieurs mois, les modélisateurs de l’IHME ont supposé à tort que le taux d’adoption de masques aux États-Unis ne s’élevait qu’à 49% à la fin du mois de septembre, et qu’il y avait donc une grande marge de manœuvre pour passer à une « adoption universelle », définie comme 95%, ou à un taux plus plausible de 85%. Cependant, selon les résultats d’une enquête plus récente, le taux d’adoption de masques aux États-Unis tourne autour de 80 % depuis l’été.”

Magness ne fait aucune mention de la prémisse fictive de l’étude de l’IHME selon laquelle le port universel de masques réduit la transmission de 40 % et plus.

Troisièmement, dans l’un des plus grands scandales de l’épisode COVID-19, un test d’amplification en chaîne par polymérase par transcription inverse (RT-PCR) a été mis au point à la hâte, dans des circonstances douteuses, qui n’est ni un diagnostic de la présence de virus infectieux, ni spécifique du SRAS-CoV-2, et déployé par les États pour la confirmation de l’infection chez les individus symptomatiques, et pour les tests de masse de la population générale asymptomatique.

Le dit test RT-PCR a été présenté ainsi par Corman et al. 29, et leur propre article indique :

“Nous avions pour objectif de développer et de déployer une méthodologie de diagnostic robuste à utiliser dans les laboratoires de santé publique sans disposer de matériel viral. […]

Dans toutes ces situations [toutes les applications passées de la RT-PCR pour « détecter les virus responsables des sécrétions respiratoires »], les isolats de virus étaient disponibles comme substrat principal pour établir et contrôler les tests et les performances des tests.

Dans le cas présent du 2019-nCoV, les isolats de virus ou les échantillons provenant de patients infectés ne sont pas encore disponibles pour la communauté internationale de la santé publique. Nous faisons ici rapport sur l’établissement et la validation d’un flux de diagnostics pour le dépistage et la confirmation spécifique du 2019-nCoV, conçu en l’absence d’isolats de virus disponibles ou d’échantillons originaux de patients. La conception et la validation ont été rendues possibles par l’étroite parenté génétique avec le CoV-SARS de 2003, et facilitées par l’utilisation de la technologie des acides nucléiques synthétiques. […]

Le présent rapport décrit la mise en place d’un processus de diagnostic pour la détection d’un virus émergent en l’absence de sources physiques d’acide nucléique génomique viral. La rapidité et l’efficacité de l’effort actuel de déploiement et d’évaluation ont été rendues possibles par les réseaux de recherche nationaux et européens mis en place en réponse aux crises sanitaires internationales de ces dernières années, ce qui démontre l’énorme capacité de réaction qui peut être dégagée par l’action coordonnée des laboratoires universitaires et publics [réf]. Cette capacité des laboratoires ne soutient pas seulement les interventions immédiates de santé publique, mais permet aux sites d’enrôler des patients lors de réponses rapides de recherche clinique.”

Un consortium international de scientifiques des sciences de la vie estime que l’article de Corman et al. présente des lacunes technologiques et méthodologiques fatales : Voir le rapport de Borger et al qui concluent, parmi plusieurs critiques, que 30 :

Il s’agit là de graves erreurs de conception, puisque le test ne peut pas faire la distinction entre le virus entier et les fragments de virus. Le test ne peut pas être utilisé comme un diagnostic pour les virus du SRAS.

En outre, l’absence du gène HE dans le CoV-1 et le CoV-2 du SRAS fait de ce gène le témoin négatif idéal pour exclure d’autres coronavirus. Le document de Corman-Drosten ne contient pas ce contrôle négatif, ni aucun autre contrôle négatif. Le test PCR du papier Corman-Drosten ne contient donc ni témoin positif unique ni témoin négatif permettant d’exclure la présence d’autres coronavirus. Il s’agit là d’un autre défaut de conception majeur qui classe le test comme inadapté au diagnostic.

Nous constatons de graves conflits d’intérêts pour au moins quatre auteurs, outre le fait que deux des auteurs de l’article de Corman-Drosten (Christian Drosten et Chantal Reusken) sont membres du comité de rédaction d’Eurosurveillance. Un conflit d’intérêt a été ajouté le 29 juillet 2020 (Olfert Landt est PDG de TIB-Molbiol ; Marco Kaiser est chercheur senior au GenExpress et est conseiller scientifique de TIB-Molbiol), qui n’était pas déclaré dans la version originale (et qui manque toujours dans la version PubMed) ; TIB-Molbiol est la société qui a été « la première » à produire des kits PCR (Light Mix) basés sur le protocole publié dans le manuscrit de Corman-Drosten, et selon leurs propres termes, ils ont distribué ces kits de test PCR avant même que la publication ne soit soumise à relecture [réf] ; de plus, Victor Corman & Christian Drosten ont omis de mentionner leur deuxième affiliation : le laboratoire de test commercial « Labor Berlin ». Tous deux sont responsables du diagnostic des virus dans ce laboratoire [réf.] et la société opère dans le domaine des tests PCR en temps réel.

À la lumière de notre réexamen du protocole de test pour identifier le CoV-2 du SRAS décrit dans le document de Corman-Drosten, nous avons identifié des erreurs et des failles inhérentes qui rendent le test PCR du SRAS-CoV-2 inutile.”

Bon nombre des critiques de Borger et al ont déjà été prouvées par des vérifications détaillées en laboratoire, comme le remarquable article de Singanayagam et al 31, qui utilise la RT-PCR avec le gène cible RdRp, qui montre (en particulier leur figure 3 A) :

  • L’importance du nombre de cycles de PCR (Ct), à la fois dans le compte rendu clinique et dans l’interprétation clinique
  • Qu’à l’exception des cas d’hospitalisation extrême (qui n’ont pas été étudiés), tous les cas positifs détectés avec la RT-PCR plus de 10 jours après l’apparition des symptômes ou l’exposition correspondaient à des virus non infectieux (fragments de virus morts) (aucun virus n’a pu être cultivé dans des cultures cellulaires optimales)
  • Qu’aucun délai n’a été observé pour la détection de ces virus non infectieux (fragments de virus morts), car ceux-ci ont été obtenus, avec une Ct=28-39, jusqu’à 60 jours après l’apparition des symptômes ou l’exposition.
  • Qu’à moins de 10 jours, avec un Ct=18-40, près de la moitié des « positifs » étaient des virus non infectieux (fragments de virus morts)
  • Un seuil opérationnel de Ct=30, au-delà duquel les « positifs » ont moins de 40% de probabilité (<8% à Ct>35) de correspondre à un virus viable, indépendamment du temps relatif à l’apparition des symptômes ou à l’exposition (leur figure 2)

De tels résultats concernant la fausse détection de virus présumés viables ont également été obtenus dans la grande étude plus récente de Jaafar et al. 32 qui ont utilisé l’amplification par RT-PCR du gène E que l’on pense être un peu moins spécifique du SRAS-CoV-2.

Il est clair que le test RT-PCR utilisé dans le monde entier est en soi sans valeur. Il produit de grandes quantités de « positifs » qui ne correspondent à aucun virus infectieux viable, qu’il s’agisse du SRAS-CoV-2 ou d’un autre. On n’y remédie que partiellement si les laboratoires se limitent à des Ct<30, sans parler du grand potentiel d’autres mauvaises pratiques de laboratoire sur le terrain.

Ajoutez à cela la malhonnêteté de la santé publique qui consiste à fabriquer une nouvelle définition de ce qui constitue un « cas ». Un « cas » est défini en médecine comme une infection active, symptomatique et diagnostiquée. Ce n’est plus le cas. Tout cas « positif » dans le « test » RT-PCR défectueux est désormais considéré comme un « cas ». La campagne massive de tests RT-PCR de la population générale asymptomatique, qui n’a aucune utilité clinique ou épidémiologique, alimente ainsi la propagande médiatique de la peur, avec des conséquences désastreuses : Tests RT-PCR non pertinent → signifie « cas » → propagande → mesures arbitraires / plus grand mal → popularité des dirigeants 33

La transmission ne se fait pas par contact

Le 17 septembre 2020, une étude approfondie a été publiée par Meyerowitz et al 34 dans l’une des principales revues médicales du monde, Annals of Internal Medicine, qui a conclu ce qui aurait dû être évident dès le départ, même pour l’OMS : La transmission par contact des maladies respiratoires virales, y compris le SRAS-CoV-2, est hors sujet.

Selon les termes de Meyerowitz et al :

“Des preuves solides provenant de rapports de cas et de groupes de cas indiquent que la transmission respiratoire est dominante, la proximité et la ventilation étant les principaux déterminants du risque de transmission. Dans les quelques cas où un contact direct ou une transmission fomitive est présumé, la transmission respiratoire n’a pas été complètement exclue. L’infectiosité atteint son maximum environ un jour avant l’apparition des symptômes et diminue dans la semaine qui suit, et aucune transmission liée tardivement (après qu’un patient a eu des symptômes pendant environ une semaine) n’a été documentée. Le virus présente une dynamique de transmission hétérogène : La plupart des personnes ne transmettent pas le virus, tandis que certaines provoquent de nombreux cas secondaires dans des groupes de transmission appelés « super-dispersion ». (Résumé)

[…] Il n’existe actuellement aucune preuve concluante de la transmission par fomite ou par contact direct du SRAS-CoV-2 chez l’homme.”

Cette conclusion a des implications de grande portée :

  • Elle signifie que la « recherche des contacts » est une absurdité pour les maladies respiratoires virales. Il n’est donc pas étonnant que l’OMS ait recommandé en 2019 que la recherche des contacts soit « déconseillée en toutes circonstances » (voir ci-dessus). Pourquoi l’OMS a-t-elle rejeté la transmission par aérosol pour la COVID-19 ? C’est de l’anti-science arbitraire. 35
  • Cela signifie que le lavage compulsif des mains et le nettoyage des surfaces sont des absurdités épidémiologiques, avec des conséquences négatives évidentes, comme les rappels massifs de désinfectants toxiques 36.
  • Cela signifie que les gouvernements et l’OMS ont été négligents pendant plus d’une décennie en n’étudiant pas, en ne recommandant pas et en ne mettant pas en œuvre des politiques de ventilation axées sur la transmission pour l’environnement bâti. En fait, l’OMS a enterré son propre rapport d’experts sur le sujet de 2009, sous la rubrique « eau / assainissement / santé » sur son site web 37, et un article de synthèse exhaustif du domaine public a été publié en 2007 38.
  • Cela signifie que le verrouillage des portes et des fenêtres des maisons de soins pour personnes âgées constitue le pire scénario possible pour prévenir les épidémies dans les maisons de soins 39 40.

Li et al 41 ont conclu (leur étude a été citée plus de 600 fois) :

“Dix des 40 études examinées ont été considérées comme concluantes en ce qui concerne l’association entre la ventilation des bâtiments et la transmission d’infections aéroportées. Il existe des preuves solides et suffisantes pour démontrer l’association entre la ventilation, les mouvements d’air dans les bâtiments et la transmission / propagation de maladies infectieuses telles que la rougeole, la tuberculose, la varicelle, la grippe, la variole et le SRAS. (Résumé)”

J’ai fait valoir que c’est précisément parce que la principale voie de transmission est constituée de fines particules d’aérosol que les masques ne peuvent pas réduire la transmission 42 43.

Face à la preuve irréfutable que les masques ne réduisent pas le risque d’infection de leur porteur 44 45, l’OMS et le complexe de santé publique ont inventé le « masque magique à sens unique », qui empêche la transmission par le porteur, tout en ne le protégeant pas. Les médias ont été ravis de propager ce fantasme, contraire aux lois de la physique, concernant la circulation de l’air porteur d’aérosols par les voies de moindre impédance à travers et autour des masques faciaux. Ce fantasme est ce qu’on appelle le « contrôle à la source », que de nombreux scientifiques qualifiés ont également répété.

En fait, même une stricte quarantaine de niveau militaire des jeunes adultes en bonne santé ne peut empêcher la transmission 46.

Les infirmières le savent. En Ontario, deux décisions importantes de tribunaux administratifs, en 2015 et en 2018, avec de longues audiences d’experts de tous bords, ont conclu que les infirmières de plusieurs grands hôpitaux ne pouvaient pas être obligées de porter des masques, qu’elles soient vaccinées ou non, car cela ne protégerait pas les patients 47 :

« Je pense qu’il y a maintenant un consensus qui se développe dans la communauté arbitrale selon lequel il ne fait aucun doute que ces politiques ne protègent pas vraiment les patients. L’arbitre a été assez ferme en décrivant les preuves apportées par l’hôpital comme insuffisantes, inadéquates et totalement non convaincantes », a dit Sharan Basran, avocate des infirmières.

Le port du masque dans la population générale n’apporte aucun bénéfice détectable

Depuis le 11 avril 2020, j’ai fait valoir en détail que les masques ne fonctionnent pas, et j’ai disséqué et exposé la fausse idée du contraire48 49. À cette époque, il n’y avait pas encore eu d’étude de qualité suffisante pour informer la politique sanitaire sur le port du masque dans la population générale.

Le 18 novembre 2020, Bundgaard et al ont publié leur vaste essai contrôlé randomisé (ECR) sur des participants sélectionnés dans la population générale danoise. Selon leurs propres termes 50 :

“Un total de 3030 participants ont été assignés au hasard à la recommandation de porter des masques, et 2994 ont été assignés au contrôle ; 4862 ont terminé l’étude. L’infection par le SRAS-CoV-2 s’est produite chez 42 participants à qui l’on avait recommandé de porter un masque (1,8%) et chez 53 participants du groupe témoin (2,1%). La différence entre les groupes était de -0,3 point de pourcentage (IC à 95%, -1,2 à 0,4 point de pourcentage ; P = 0,38) (rapport de cotes, 0,82 [IC, 0,54 à 1,23] ; P = 0,33). L’imputation multiple tenant compte de la perte au suivi a donné des résultats similaires. Bien que la différence observée ne soit pas statistiquement significative, les IC de 95% sont compatibles d’une réduction de 46% jusqu’à une augmentation de 23% de l’infection. (Résumé / Résultats)

[…] la recommandation de porter un masque chirurgical en dehors de la maison, entre autres, n’a pas réduit, à des niveaux conventionnels de signification statistique, l’incidence de l’infection par le SRAS-CoV-2 par rapport à l’absence de recommandation de port de masque. […] Les masques faciaux fournis aux participants étaient des masques chirurgicaux de haute qualité avec un taux de filtration de 98% [réf]. (Discussion)”

Pour être clair, « 95% d’IC sont compatibles avec une réduction de 46% jusqu’à une augmentation de 23% de l’infection » signifie que, dans les limites de l’incertitude, le port d’un masque pourrait avoir augmenté la probabilité d’être infecté de 23%. Telle est la nature de l’évaluation du risque relatif, lorsque l’impact comparatif sur le risque absolu est trop minime pour être détecté.

Les auteurs semblent avoir été contraints par le processus d’« examen par les pairs » de souligner que leur étude n’a pas été conçue pour tester l’hypothèse que j’ai évoquée plus haut, à savoir le masque magique à sens unique : « … et aucune évaluation de la capacité des masques à diminuer la transmission de maladies de leurs porteurs à d’autres personnes. »

À ce stade, quelque quinze (15) ECR de niveau politique plus tard, avec des résultats vérifiés, il faut se demander ce qu’il faudrait pour que le complexe de santé publique abandonne son nouvel enthousiasme pour le port de masque forcé de la population générale, ou au moins pour financer la recherche sur les préjudices répartis et les coûts sociétaux de cette politique draconienne.

Des études sur les préjudices quantifiables et potentiels du port de masque universel commencent à être publiées, tant dans des revues médicales régulières que dans des revues alternatives. Si le « principe de précaution » était plus qu’un simple effet de mode, de telles études auraient été nécessaires avant l’adoption de lois et d’obligations en matière de port de masque universel.

Le 6 juillet 2020, par exemple, Fikenzer et al ont publié une étude rigoureuse sur l’effet physiologique des masques sur 12 hommes en bonne santé (âgés de 38 ± 6 ans). Ils ont conclu 51 :

Les masques médicaux ont un impact négatif marqué sur la capacité cardio-pulmonaire, ce qui entrave considérablement les activités physiques et professionnelles pénibles. De plus, les masques médicaux nuisent considérablement à la qualité de vie de leur porteur. Ces effets doivent être considérés par rapport aux effets protecteurs potentiels des masques faciaux sur les transmissions virales. Les données quantitatives de cette étude peuvent donc éclairer les recommandations médicales et les décideurs politiques.”

En novembre 2020, Borovoy et al. 52 ont publié une étude approfondie des connaissances biologiques et médicales qui leur permet de déduire un potentiel important de dommages significatifs liés au port de masque. Ils soulignent à juste titre le rôle connu mais sous-estimé des bactéries dans les pandémies virales, et passent également en revue les maladies respiratoires dues aux bactéries buccales.

Les vaccins sont intrinsèquement dangereux

Le 13 juillet 2020, Arvin et al. ont publié dans les pages de la revue scientifique de premier plan Nature un important rappel à la réalité sous la forme d’une vaste « Perspective » (revue). L’article, à lire attentivement, est un exposé détaillé sur l’ignorance de l’homme concernant l’interférence artificielle avec le système immunitaire humain. Tout étudiant en sciences devrait conclure que « surtout, nous ne savons rien ». Les auteurs l’affirment sous une forme enjolivée 53 :

“L’augmentation de la maladie dépendante des anticorps (ADE) est une préoccupation générale pour le développement de vaccins et de thérapies par anticorps car les mécanismes qui sous-tendent la protection par anticorps contre tout virus ont un potentiel théorique d’amplifier l’infection ou de déclencher une immunopathologie nocive. Cette possibilité doit être examinée attentivement à ce stade critique de la pandémie de coronavirus 2019 (COVID-19), qui est causée par le coronavirus 2 du syndrome respiratoire aigu sévère (SRAS-CoV-2).

Nous passons ici en revue les observations relatives aux risques d’ADE de la maladie, et leurs implications potentielles pour l’infection par le SRAS-CoV-2. À l’heure actuelle, il n’existe pas de résultats cliniques, d’essais immunologiques ou de biomarqueurs connus qui permettent de différencier une infection virale grave d’une maladie à immunité renforcée, que ce soit par la mesure des anticorps, des cellules T ou des réponses intrinsèques de l’hôte. Les systèmes in vitro et les modèles animaux ne permettent pas de prédire le risque d’ADE de la maladie, en partie parce que les mécanismes de protection et les mécanismes potentiellement nuisibles médiés par les anticorps sont les mêmes et que la conception de modèles à base d’animaux dépend de la compréhension de la manière dont les réponses antivirales de l’hôte peuvent devenir nuisibles chez l’homme.

Les implications de notre manque de connaissances sont doubles. Premièrement, des études complètes sont nécessaires de toute urgence pour définir les corrélats cliniques de l’immunité protectrice contre le SRAS-CoV-2. Deuxièmement, étant donné qu’il est impossible de prévoir de manière fiable l’apparition de la maladie après une vaccination ou un traitement par anticorps – quel que soit le virus responsable – il sera essentiel de s’appuyer sur une analyse minutieuse de la sécurité chez l’homme à mesure que les interventions immunitaires contre la COVID-19 progressent. (Résumé)”

Compte tenu du déploiement qui a suivi, cela signifie que nous nous sommes lancés aveuglément dans une expérience à grande échelle sur des sujets humains, sans essais sur des animaux, sans transparence scientifique, sans possibilité de consentement éclairé, sous l’impulsion de sociétés pharmaceutiques qui ne veulent que le bien de l’humanité.

Le 1er octobre 2020, Wehenkel 54 a publié un article dans lequel il a étudié 39 pays et a constaté une forte association entre le taux national de vaccination contre la grippe (IVR) des personnes âgées de 65 ans et plus et le nombre de décès dus à la COVID-19 par million d’habitants. Les résultats sont préliminaires mais peuvent constituer un exemple documenté de « renforcement de la maladie dépendant des anticorps (ADE) » impliquant la COVID-19. Tous les taux de décès par COVID-19 les plus élevés ont été enregistrés dans les pays où l’IVR est supérieure à 50 % (voir ses figures 1 et 3). Je sens une opportunité de financement de la recherche pour défaire cette découverte.

Denis G. Rancourt

Chercheur, Association des libertés civiles de l’Ontario

L’auteur présente ci dessous ses compétences pour examiner les données scientifiques sur la COVID-19

Je suis retraité et ancien professeur titulaire de physique à l’université d’Ottawa. Le poste de professeur titulaire est le plus haut grade universitaire. Au cours de mes 23 ans de carrière en tant que professeur d’université, j’ai développé de nouveaux cours et j’ai enseigné à plus de 2000 étudiants universitaires, à tous les niveaux, et dans trois facultés différentes (sciences, ingénierie, arts). J’ai supervisé plus de 80 stages de recherche ou diplômes à tous les niveaux, du post-doctorant aux étudiants de troisième cycle en passant par les chercheurs de premier cycle du CRSNG. J’ai dirigé un laboratoire de recherche interdisciplinaire de renommée internationale, et j’ai attiré d’importants fonds de recherche pendant deux décennies.

J’ai été invité une quarantaine de fois à participer à des conférences scientifiques majeures, que ce soit en séance plénière, en tant que conférencier principal ou en session spéciale. J’ai publié plus de 100 articles de recherche dans des revues scientifiques de premier plan évaluées par des pairs, dans les domaines de la physique, de la chimie, de la géologie, de la bio-géochimie, de la science des mesures, de la science du sol et de la science environnementale.

Mon facteur d’impact de l’indice H scientifique est de 40, et mes articles ont été cités plus de 5 000 fois dans des revues scientifiques à comité de lecture (profil sur Google Scholar).

Mes connaissances personnelles et ma capacité à évaluer les faits présentés dans cet article sont fondées sur mon éducation, ma recherche, ma formation et mon expérience, comme suit :

  1. En ce qui concerne les nanoparticules environnementales. Les maladies respiratoires virales sont transmises par la plus petite fraction de taille des particules d’aérosols chargées de virions, qui sont des nanoparticules environnementales réactives. Par conséquent, les stabilités chimiques et physiques et les propriétés de transport de ces particules d’aérosol sont à la base du mécanisme dominant de contagion par l’air. Mes travaux approfondis sur les nanoparticules environnementales réactives sont reconnus au niveau international et portent sur les aspects suivants : précipitation et croissance, réactivité de surface, agglomération, charge de surface, transformation de phase, décantation et sédimentation, et dissolution réactive. En outre, j’ai enseigné la dynamique des fluides (l’air est un fluide compressible) et la sédimentation gravitationnelle au niveau universitaire, et j’ai effectué des recherches sur les applications industrielles de la technologie de filtration (les masques faciaux sont des filtres).
  2. En ce qui concerne la science moléculaire, la dynamique moléculaire et la complexation de surface. Je suis un expert en structures, réactions et dynamiques moléculaires, y compris la complexation moléculaire des surfaces biotiques et abiotiques. Ces processus sont à la base de la fixation des virus, de la fixation des antigènes, de la réplication moléculaire, de la fixation aux fibres des masques, de la charge des particules, de la perte et de la croissance des particules d’aérosol, et de tous ces phénomènes impliqués dans la transmission et l’infection virale, et dans les mesures de protection. J’ai enseigné pendant de nombreuses années la mécanique quantique au niveau universitaire avancé, qui est la théorie fondamentale des atomes, des molécules et des substances ; et dans mes recherches publiées, j’ai développé la théorie et la méthodologie de la diffraction des rayons X pour la caractérisation des petites particules de matériaux.
  3. En ce qui concerne les méthodes d’analyse statistique. L’analyse statistique des études scientifiques, y compris l’analyse robuste de la propagation des erreurs et les estimations robustes des biais, fixe la limite de ce qui peut être déduit de manière fiable de toute étude d’observation, y compris les essais contrôlés randomisés en médecine, et y compris les mesures sur le terrain pendant les épidémies. Je suis un expert en analyse d’erreurs et en analyse statistique de données complexes, au niveau de la recherche dans de nombreux domaines scientifiques. Les méthodes d’analyse statistique sont à la base de la recherche médicale.
  4. En ce qui concerne la modélisation mathématique. Une grande partie de l’épidémiologie est basée sur des modèles mathématiques de transmission et d’évolution des maladies dans la population. J’ai des connaissances et une expérience au niveau de la recherche en matière de modèles mathématiques prédictifs et exploratoires et de méthodes de simulation. J’ai des connaissances d’expert liées aux incertitudes des paramètres et aux dépendances des paramètres dans ces modèles. J’ai réalisé des simulations approfondies de la dynamique épidémiologique, en utilisant des modèles compartimentaux standard (SIR, MSIR) et de nouveaux modèles.
  5. En ce qui concerne les méthodes de mesure. En science, il existe cinq grandes catégories de méthodes de mesure : (1) la spectroscopie (y compris la spectroscopie nucléaire, électronique et vibratoire), (2) l’imagerie (y compris la microscopie optique et électronique, et l’imagerie par résonance), (3) la diffraction (y compris la diffraction des rayons X et des neutrons, utilisée pour élaborer des structures moléculaires, des défauts et des structures magnétiques), (4) les mesures de transport (y compris les taux de réaction, les transferts d’énergie et les conductivités), et (5) les mesures des propriétés physiques (y compris la densité spécifique, les capacités thermiques, la réponse aux contraintes, la fatigue des matériaux…). J’ai enseigné ces méthodes de mesure dans un cours interdisciplinaire de troisième cycle que j’ai développé et donné à des étudiants de troisième cycle (M.Sc. et Ph.D.) en physique, biologie, chimie, géologie et ingénierie pendant de nombreuses années. J’ai fait des découvertes et des progrès fondamentaux dans les domaines de la spectroscopie, de la diffraction, de la magnétométrie et de la microscopie, qui ont été publiés dans des revues scientifiques de premier plan et présentés lors de conférences internationales. Je connais la science des mesures, la base de toutes les sciences, au plus haut niveau.

Traduit par Hervé pour le Saker Francophone

Notes

  1. 2019–OMS : « Mesures de santé publique non pharmaceutiques pour atténuer le risque et l’impact de la grippe épidémique et pandémique », avec annexe, Organisation mondiale de la santé, octobre 2019 : OMS . Rapport, ISBN : 978-92-4-151683-9, pp 91, « Annexe : Rapport des revues systématiques de la littérature », WHO/WHE/IHM/GIP/2019.1, pp 125
  2. 2017–OMS : « Évaluation de la gravité de la grippe pandémique (PISA) : Un guide de l’OMS pour évaluer la gravité de la grippe dans les épidémies et pandémies saisonnières », Organisation mondiale de la santé, mai 2017, WHO/WHE/IHM/GIP/2017.2
  3. 2011–Bonneux : Luc Bonneux & Wim Van Damme. « La santé, c’est plus que la grippe ». Bulletin de l’Organisation mondiale de la santé 2011;89:539-540. doi : 10.2471/BLT.11.089086
  4. Ibid note 3
  5. 2010–Cohen : Cohen, D. et Carter, P. « L’OMS et les « conspirations » de la grippe pandémique ». BMJ 2010 ; 340:c2912. doi. (Publié le 04 juin 2010)
  6. 2020–Rancourt : « Les masques ne fonctionnent pas : un examen de la science en rapport avec la politique sociale de Covid-19 ». Rancourt, DG (11 avril 2020) ResearchGate, a obtenu 400 000 lectures, puis a été retiré de la plate-forme, selon ce rapport. Maintenant sur vixra.org , et sur rcreader.com. Et voir les Digi-Debates sur les critiques de l’article : « Digi-Debates. The Face Mask Debate », Digi Debates YouTube Channel, 25 juillet 2020, et à l’adresse suivante
  7. 2020–Rancourt : « Masques faciaux, mensonges, foutus mensonges, et fonctionnaires de la santé publique : « Un ensemble croissant de preuves ». ResearchGate (3 août 2020). DOI : 10.13140/RG.2.2.25042.58569
  8. 2020–Rancourt : « Mortalité toutes causes confondues lors de la COVID-19 : Pas de fléau et une signature probable d’homicide de masse par la réponse du gouvernement », par Rancourt, DG (2 juin 2020) ResearchGate. DOI: 10.13140/RG.2.2.24350.77125
  9. 2020–Rancourt : D. G. Rancourt, Marine Baudin, Jérémie Mercier. « Évaluation de la virulence du SRAS-CoV-2 en France, à partir de la mortalité toutes causes confondues 1946-2020 ». ResearchGate (20 août 2020). DOI: 10.13140/RG.2.2.16836.65920/1  (Version en français)
  10. Ibid note 6
  11. Ibid note 7
  12. 2020–Chaudhry : Chaudhry, Rabail et autres (2020) « Une analyse au niveau national mesurant l’impact des actions du gouvernement, de la préparation du pays et des facteurs socio-économiques sur la mortalité COVID-19 et les résultats sanitaires associés ». EClinicalMedicine, Volume 25, 100464 (21 juillet 2020 – The Lancet)
  13. 2020–De Larochelambert : De Larochelambert Q, Marc A, Antero J, Le Bourg E et Toussaint J-F (2020). « Covid-19 Mortalité : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées ». Frontiers in Public Health 8:604339. doi : 10.3389/fpubh.2020.604339 (19 novembre 2020 – frontiersin.org)
  14. 2020–AIER : « Les confinements ne contrôlent pas le coronavirus : Les preuves ». AIER Staff. Institut américain de recherche économique. 19 décembre 2020
  15. Ibid note 8
  16. Ibid note 9
  17. 2020–Yam : Kai Chi Yam, Joshua Conrad Jackson, Christopher M. Barnes, Jenson Lau, Xin Qin, Hin Yeung Lee. « L’augmentation des cas de COVID-19 est associée au soutien des dirigeants mondiaux ». Actes de l’Académie nationale des sciences. Oct 2020, 117 (41) 25429-25433 ; DOI : 10.1073/pnas.2009252117
  18. 2020–Abbasi : Abbasi, Kamran (rédacteur en chef). « Covid-19 : politisation, « corruption » et suppression de la science ». Journal médical britannique. BMJ 2020 ; 371 :m4425.
  19. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 – Potentiel de « variolation » dans l’attente d’un vaccin ». 29 octobre 2020. N Engl J Med 2020 ; 383:e101. DOI : 10.1056/NEJMp2026913
  20. 2020–Rasmussen : Angela L. Rasmussen et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.
  21. 2020–Brosseau : Lisa M. Brosseau et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.)
  22. Ibid note 19
  23. Ibid note 20
  24. Ibid note 21
  25. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (réponse de Gandhi et al.)
  26. Ibid note 7
  27. 2020–IHME : IHME COVID-19 Forecasting Team, Reiner, R.C., Barber, R.M. et al. « Modélisation des scénarios COVID-19 pour les États-Unis ». Nature Medicine (2020). doi
  28. 2020 — Magness : Phillip W. Magness. « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées ». Wall Street Journal (11 novembre 2020)
  29. 2020 : Corman Victor M, Landt Olfert, Kaiser Marco, Molenkamp Richard, Meijer Adam, Chu Daniel KW, Bleicker Tobias, Brünink Sebastian, Schneider Julia, Schmidt Marie Luisa, Mulders Daphne GJC, Haagmans Bart L, van der Veer Bas, van den Brink Sharon, Wijsman Lisa, Goderski Gabriel, Romette Jean-Louis, Ellis Joanna, Zambon Maria, Peiris Malik, Goossens Herman, Reusken Chantal, Koopmans Marion PG, Drosten Christian. « Détection de nouveaux coronavirus en 2019 (2019-nCoV) par RT-PCR en temps réel ». Euro Surveill. 2020;25(3):pii=2000045. doi
  30. 2020–Borger : Borger, Pieter et al « Rapport d’examen Corman-Drosten et al Eurosurveillance 2020 – L’examen externe par les pairs du test RT-PCR pour détecter le SRAS-CoV-2 révèle 10 failles scientifiques majeures au niveau moléculaire et méthodologique : conséquences pour les résultats faussement positifs ». Consortium international des scientifiques en sciences de la vie (ICSLS). 27 novembre 2020
  31. 2020–Singanayagam : Singanayagam Anika, Patel Monika, Charlett Andre, Lopez Bernal Jamie, Saliba Vanessa, Ellis Joanna, Ladhani Shamez, Zambon Maria, Gopal Robin. « Durée de l’infectiosité et corrélation avec les valeurs seuils du cycle RT-PCR dans les cas de COVID-19, Angleterre, janvier à mai 2020 ». Euro Surveill. 2020;25(32):pii=2001483. doi
  32. 2020–Jaafar : Jaafar R, Aherfi S, Wurtz N, Grimaldier C, Hoang VT, Colson P, Raoult D, La Scola B. « Corrélation entre 3790 échantillons positifs au qPCR et des cultures cellulaires positives, y compris 1941 isolats de SRAS-CoV-2 ». Clin Infect Dis. 2020 Sep 28:ciaa1491. doi : 10.1093/cid/ciaa1491. Epub avant impression. PMID : 32986798 ; PMCID : PMC7543373 – academic.oup.com
  33. Ibid note 17
  34. 2020–Meyerowitz : Eric A. Meyerowitz, Aaron Richterman, Rajesh T. Gandhi, et al « Transmission du SRAS-CoV-2 : Un examen des facteurs viraux, des hôtes et de l’environnement ». Ann Intern Med. – Epub avant impression 17 septembre 2020. doi:10.7326/M20-5008 – acpjournal.org
  35. Ibid note 7
  36. 2020–CBC : La presse canadienne : « Santé Canada rappelle plus de 50 désinfectants pour les mains dans une liste évolutive ». (5 août 2020) – cbc.ca
  37. 2009–OMS : « Ventilation naturelle pour la lutte contre les infections dans les établissements de santé – Lignes directrices de l’OMS 2009 ». Éditeurs : James Atkinson, Yves Chartier, Carmen Lúcia Pessoa-Silva, Paul Jensen, Yuguo Li et Wing-Hong Seto, pp 106, 2009, ISBN : 978 92 4 154785 7 – OMS
  38. 2007–Li : Li Y, Leung GM, Tang JW, Yang X, Chao CY, Lin JZ, Lu JW, Nielsen PV, Niu J, Qian H, Sleigh AC, Su HJ, Sundell J, Wong TW, Yuen PL. « Rôle de la ventilation dans la transmission aérienne d’agents infectieux dans l’environnement bâti – une étude systématique multidisciplinaire ». Air intérieur. 2007 Feb;17(1):2-18. doi : 10.1111/j.1600-0668.2006.00445.x. PMID : 17257148
  39. Ibid note 8
  40. Ibid note 9
  41. Ibid note 38
  42. Ibid note 6
  43. Ibid note 7
  44. Ibid note 6
  45. Ibid note  7
  46. 2020–Letizia : Letizia AG, Ramos I, Obla A, Goforth C, Weir DL, Ge Y, Bamman MM, Dutta J, Ellis E, Estrella L, George MC, Gonzalez-Reiche AS, Graham WD, van de Guchte A, Gutierrez R, Jones F, Kalomoiri A, Lizewski R, Lizewski S, Marayag J, Marjanovic N, Millar EV, Nair VD, Nudelman G, Nunez E, Pike BL, Porter C, Regeimbal J, Rirak S, Santa Ana E, Sealfon RSG, Sebra R, Simons MP, Soares-Schanoski A, Sugiharto V, Termini M, Vangeti S, Williams C, Troyanskaya OG, van Bakel H, Sealfon SC. « Transmission du SRAS-CoV-2 parmi les recrues dans la Marine pendant la quarantaine ». N Engl J Med. 2020 Dec 17;383(25):2407-2416. doi : 10.1056/NEJMoa2029717. Epub 2020 11 nov. PMID : 33176093 ; PMCID : PMC7675690. (11 novembre 2020) – nejm.org
  47. 2018–Brown : « L’ONA remporte un deuxième arbitrage contre les hôpitaux sur la politique des vaccins ou des masques » (13 septembre 2018), Canadian Lawyer Magazine – canadianlawyermag.com
  48. Ibid note 6
  49. Ibid note 7
  50. 2020–Bundgaard : Bundgaard H, Bundgaard JS, Raaschou-Pedersen DET, von Buchwald C, Todsen T, Norsk JB, Pries-Heje MM, Vissing CR, Nielsen PB, Winsløw UC, Fogh K, Hasselbalch R, Kristensen JH, Ringgaard A, Porsborg Andersen M, Goecke NB, Trebbien R, Skovgaard K, Benfield T, Ullum H, Torp-Pedersen C, Iversen K. « Efficacité de l’ajout d’une recommandation sur les masques à d’autres mesures de santé publique pour prévenir l’infection par le SRAS-CoV-2 chez les porteurs de masques danois : un essai contrôlé randomisé ». Ann Intern Med. 2020 Nov 18:M20-6817. doi : 10.7326/M20-6817. Epub avant impression. PMID : 33205991 ; PMCID : PMC7707213. – acpjournals.org
  51. 2020–Fikenzer : Fikenzer S, Uhe T, Lavall D, Rudolph U, Falz R, Busse M, Hepp P, Laufs U. « Effets des masques chirurgicaux et des masques FFP2/N95 sur la capacité d’exercice cardio-pulmonaire ». Clin Res Cardiol. 2020 Dec;109(12):1522-1530. doi : 10.1007/s00392-020-01704-y. Epub 2020, 6 juillet. PMID : 32632523 ; PMCID : PMC7338098 – springer.com
  52. 2020–Borovoy : Boris Borovoy, Colleen Huber, Maria Crisler. « Masques, fausse sécurité et dangers réels, Partie 2 : Défis microbiens des masques ». Primary Doctor Medical Journal. Novembre 2020 – pdmj.org
  53. 2020–Arvin : Arvin AM, Fink K, Schmid MA, Cathcart A, Spreafico R, Havenar-Daughton C, Lanzavecchia A, Corti D, Virgin HW. « Une perspective sur le renforcement potentiel du SRAS-CoV-2 dépendant des anticorps ». Nature. 2020 Aug;584(7821):353-363. doi : 10.1038/s41586-020-2538-8. Epub 2020 13 juillet. PMID : 32659783 – nature.com
  54. 2020–Wehenkel : Wehenkel C. 2020. « Association positive entre les décès dus au COVID-19 et les taux de vaccination contre la grippe chez les personnes âgées dans le monde ». PeerJ 8:e10112  – doi 

= = =

Lecture complémentaire:

Notre page « Coronavirus, guerre contre l’humanité »

 


Faites-leurs confiance… Ils ne vous veulent que du bien !

 

Escalier de la Grande Réinitialisation… Échafaud vers le N.O.M ou Ascenseur vers l’Émancipation ?

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, N.O.M, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, terrorisme d'état with tags , , , , , , , on 9 janvier 2021 by Résistance 71

A nous de choisir… à personne d’autre…
A la croisée des chemins ce sera N.O.M ou ÉMANCIPATION et Société des Sociétés

Colonialisme, meurtre par décret et Grand Reset COVID19 (PDF)

Posted in actualité, altermondialisme, colonialisme, coronavirus CoV19, crise mondiale, démocratie participative, France et colonialisme, gilets jaunes, militantisme alternatif, politique et social, politique française, résistance politique, santé et vaccins, société des sociétés, terrorisme d'état with tags , , , , , , , , on 7 janvier 2021 by Résistance 71

Résistance 71

7 janvier 2021

La grande logique linéaire du binôme état-capitalisme : du colonialisme et de sa résultante génocidaire à la tentative de contrôle définitif de l’humanité par la dictature sanitaire technotronique et son grand reset COVID-19 planifié de longue date. Un PDF compilation de Jo pour une vision panoramique de l’affaire, comprendre pour mieux agir :

Meurtre_par_decret_et_Grand_Reset_CoV19
PDF

1871-2021 : L’année nouvelle sous le signe de la Commune Universelle ?…

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, démocratie participative, gilets jaunes, média et propagande, militantisme alternatif, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , on 1 janvier 2021 by Résistance 71

 

 

« Un spectacle épouvantable et douloureux s’est élevé devant mes yeux : j’ai écarté le rideau de la corruption des Hommes. »
~ Friedrich Nietzsche ~

 

Résistance 71

 

1er janvier 2021

 

2020 a été placée sous le signe du passage avéré au Nouvel Ordre Mondial dictatorial planétaire oligarchique par le truchement de cette crise « pandémie » de la COVID-19 provoquée par ce monstre de laboratoire SRAS-CoV-2 (voir notre page « Coronavirus, guerre contre l’humanité » pour suivre la chronologie de cette supercherie planétaire par les chiffres bidouillés de cette « science » modélisée régnante et d’un test n’étant pas fait pour des diagnostiques cliniques). La classe régnante, pilotée par la haute finance et Big Pharma a pour mission de souffler le chaud et le froid et d’entretenir le malaise public entre la peur et la panique sciemment induites afin de pousser toujours plus avant leur agenda totalitaire de leur dictature technotronique planétaire. Il n’est en rien question de contrôler une « pandémie » générée par une maladie létale à 0,15% des gens infectés et symptomatiques, mais de forcer une thérapie génique sous forme de « vaccins » chimériques, visant à la transformation du génome humain et au puçage nonotech de la population mondiale pour qu’à terme, se referme la grille de contrôle technotronique sur une humanité stérilisée et asservie.
De plus en plus de gens se rendent compte de l’agenda en cours, des médecins et professeurs encore intègres, de par le monde, se lèvent et dénoncent cette horreur transgénique qui, si nous laissons faire, nous sera imposée si non plus directement, mais indirectement par toujours plus de privation de libertés et de droits (qui n’en sont pas, juste de simples privilèges temporaires, révocables à souhait par les ordures du haut de la pyramide devant un système arrivé à terme dans sa folie du contrôle absolu et créé à ces fins).
L’empereur est nu, l’oligarchie de ce système étatico-capitaliste moribond avance désormais totalement à découvert et sait que le temps ne joue plus pour elle, contrairement à ses décennies de préparation en mode « camouflage et hypocrisie » maintenant l’illusion démocratique par nécessité. L’humanité est victime depuis des siècles d’un pillage criminel en bande organisée et l’heure est venue d’y mettre fin à tout jamais.
Bien entendu, l’avenir peut paraître toujours bien sombre, mais l’oligarchie et le système qu’elle sert ne semblent puissants que parce que nous les laissons faire, tout n’est qu’illusion de puissance parce que nous consentons par aveuglement et anesthésie quasi générale dans le pseudo-confort marchand transfiguré en société du spectacle. Aujourd’hui, il en va de nos vies et de la vie des générations futures, des non-nés que les eugénistes aux manettes ne veulent pas voir venir au monde. Nous arrivons à cette croisée des chemins dont nous parlons depuis des années, on la distingue là, dans la fine brume de ce brouillard artificiel qui s’estompe au fil de la prise de conscience individuelle et collective du piège dans lequel on nous a enfermé pas à pas en anesthésiant notre conscience politique.
Grand espoir il y a car qui sait peut agir.
2021 est l’année du cent-cinquantenaire de la Commune de Paris (1871-2021), de cet esprit communard et gouailleur d’un peuple français qui une fois de plus se trouve en position de mener la charge sur la voie de l’émancipation finale. Si une chose doit être apprise de cette foutaise pandémique créée et entretenue qu’est cette crise du SRAS-CoV-2 / COVID-19, c’est qu’au vu de la gestion de cette crise, il doit être clair une fois pour toute qu’il n’y a pas de solution au sein du système. L’heure n’est pas à une chimérique énième révolution qui, par définition, nous ramènera, à terme, au point de départ de ce samsâra politico-social, mais à une véritable (r)évolution nous faisant enfin prendre la tangente échappatoire de ce cercle vicieux induit pour nous propulser dans les limbes de la Commune Universelle,  dans la complémentarité non antagoniste d’une société des sociétés de l’amour, de l’entraide, de la compassion et de la fraternité vraies… de notre humanité vraie enfin réalisée.
Ceci n’est pas une « utopie », l’utopie nous la vivons maintenant, celle de croire que ce système qui nous oppresse est l’aboutissement à quelques réformes près, de ce que nous pouvons faire de mieux sur cette planète et se résoudre aux desiderata de maîtres nous réduisant toujours plus avant dans ce néo-esclavagisme technotronique chimérique et mortifère sous ce slogan devenu classique du « il n’y a pas d’alternative ».
La Commune Universelle de notre humanité enfin réalisée est la seule voie pour notre émancipation et notre épanouissement social définitif, elle ne pourra survenir que lorsqu’un nombre critique de gens, partout, agira communément dans l’intérêt de tous en commençant par clamer un NON ! retentissant à la face de l’hydre hideuse à la barre du bateau ivre nous dirigeant vers les récifs infranchissables d’un capitalisme décadent. 2020 nous a fait (entre)voir le monstre, le rideau est retiré et il navigue en pleine vue de tous. Nous savons ce qu’il nous reste à faire, unis, ensemble. Ne cédons plus à la peur, la division, la haine et la rancœur insufflées et distillées par l’haleine putride du plus froid des monstres froids et faisons de 2021 l’année du grand chambardement et du grand commencement de cette Commune Universelle, fruit de l’émancipation !
Le SRAS-CoV-2 / COVID-19 est un révélateur, il faut le voir comme une chance inouïe qui nous est donnée de mettre un terme définitif à la tyrannie du plus petit nombre au service d’un système autant criminel qu’obsolète et contre-nature. Saisissons la et devenons enfin ceux que nous sommes !…

Meilleurs vœux 2021 à toutes et à tous !

Vive la Commune Universelle de notre humanité enfin réalisée !

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Dictature COVID-19 : Les labos poussent les gouvernements à les exonérer de toute responsabilité pour leurs vaccins chimériques…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

 

 

 

Les labos pharmaceutiques s’exonèrent de toute responsabilité sur les effets secondaires des vaccins covid

 

Anonyme

 

25 décembre 2020

https://www.lefigaro.fr/societes/vaccins-covid-19-l-ue-nbsp-indemnisera-les-laboratoires-en-cas-de-problemes-20200827

Bill Gates admet que ses vaccins changeront le génome

https://youtu.be/ksEVaO806Oo (vidéo à enregistrer avant censure)

Fauci le pantin de Bill Gates qui veut imposer les vaccins aux américains avoue que les vaccins covid peuvent être pires que le covid lui même

https://metro.co.uk/2020/05/12/americas-top-coronavirus-doctor-warns-vaccine-make-covid-19-worse-12692519/?ito=cbshare (article à enregistrer avant censure)

Bill Gates admet que ses vaccins peuvent tuer

https://www.armstrongeconomics.com/world-news/corruption/gates-admits-700000-people-may-die-from-his-vaccine/?__cf_chl_jschl_tk__=62eb6c7077991213fdafe4e84df29c5a07ebf0d4-1608836399-0-AVlKQVPOLfSy9QfQp3lKiMepwzABRTxxWMfww9Whtf27OPGp9Pysbzlln1vrkzWizhdh6sdzI5srwLQcRmU9Oi9E1O19KBS-t2bK9oY-kqIXxvzXo1evnUHmG-l9_fyt9BC82pusuzl4UQGKD99EyWzQQE8WO-spDIG2E8X-kqGWxXx7WeDjvlfQDbMemduSicRT22up-wqnYkzixyqrGvZ03FPAlCreAGCM0rYoEZcLZFPQFUVk7yyvxEUB6t1kl0wF9_gLrccxEoZtTl5ZLrhwVLAEPphfWMbYdrMIwW4CSEJyIQAnGO-mLBLRZV7otU94GN1ZQNccruGGk4-J3LKg0QjK58r7il0j3drDYjegmDieMGRAHBb3V7spLOlqZnk9Cg6q0UHKS6L_4uc_z1gDYNjz hY4WhEzoc4E6tfrWFkISoYiR0iLFQWZLiVk4z0GdxWuZPk33MketC3pa9do

https://resistance71.wordpress.com/2020/10/06/coronavirus-vaccin-covid19-et-controle-mondial-de-la-population/

les labos des vaccins AstraZeneca (NYSE: AZN), GlaxoSmithKline (NYSE: GSK), Janssen (NYSE: JNJ), Merck (NYSE: MRK), Novavax (NASDAQ: NVAX), Pfizer (NYSE: PFE), Sanofi Pasteur (NASDAQ) : SNY), Takeda (NYSE: TAK), Abbott (NYSE: ABT) et CureVac (NASDAQ: CVAC) ont tous demandé à être exonérés de toute responsabilité sur les effets secondaires de leurs vaccins OGM à ADN ou ARN

https://seekingalpha.com/news/3608810-coronavirus-vaccine-makers-seek-eu-liability-protections

AstraZeneca , GlaxoSmithKline, Janssen , Merck, Novavax , Pfizer , Sanofi , Takeda, Abbott CureVac sont tous financés par Bill Gates ou d’autres géants du web (comme le milliardaire Dietmar Hopp, co-fondateur du géant allemand du logiciel SAP https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html). ou collaborent avec lui

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2016/10/OPP1156831

https://observer.com/2020/05/coronavirus-vaccine-update-novavax-merck-bill-gates-funding/

https://nypost.com/2020/09/15/bill-gates-says-pfizer-has-best-shot-at-early-covid-19-vaccine/

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2015/10/OPP1127586

https://america-wake-up.com/2020/05/04/the-anthony-fauci-bill-gates-george-soros-sanofi-pasteur-china-corona-virus-vaccine-connection/

https://www.fiercebiotech.com/biotech/sanofi-pasteur-announces-vaccine-discovery-collaboration-bill-melinda-gates-foundation

https://www.takeda.com/newsroom/newsreleases/2016/takeda-receives-$38-million-grant-from-the-bill–melinda-gates-foundation-to-support-polio-eradication-in-developing-countries/

https://edition.cnn.com/2020/08/14/investing/curevac-ipo-coronavirus-vaccine-bill-melinda-gates/index.html

Pourquoi les géants du web investissent dans les vaccins?

Tout simplement parce que le but des vaccins c’est de donner une identité numérique, marque de la bête connecté à la 5G

https://www.kla.tv/Coronavirus-fr/16685

une autre vidéo qui en parle a été censurée sur

http://stoplinkyvarest.canalblog.com/archives/2020/09/21/38547121.html

vaccin connecté à la 5G

https://resistance71.wordpress.com/2020/10/09/dictature-technotronique-en-marche-vaccin-covid-arnm-hydrogel-enzyme-luciferase-cocktail-modificateur-genetique/

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

https://resistance71.wordpress.com/2020/12/16/laffaire-du-vaccin-contre-la-covid-19-nest-pas-une-affaire-sanitaire-mais-celle-de-la-normalisation-de-lidentite-numerique-philippe-guillemant-physicien-cnrs/

 

Déclaration de responsabilité civile et pénale pour l’administration du vaccin Pfizer / BioNTech ou Moderna dans le cadre de la COVID-19 (Association Réaction19, format PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 26 décembre 2020 by Résistance 71


Mais que diable vont-ils nous injecter ?…

POUR DIFFUSION IMMEDIATE

Résistance 71

26 décembre 2020

Devant la menace sanitaire de ces vaccins OGM à ARNm dont personne ne peut savoir ce qu’ils génèreront sur le long terme sur le génome humain et le manque de transparence total les concernant, ainsi que l’ineptie totale pour les gouvernements et surtout l’UE d’avoir totalement exonéré de toute responsabilité légale les labos pharmaceutiques Pfizer / BioNTech, Moderna, voici un document de responsabilité civile ayant valeur légale que ceux qui désirent se faire vacciner peuvent faire signer au médecin et chargé de mission sanitaire les injectant.
Le document est réalisé par l’association REACTON19, Paris 8ème, rue de la Boétie, « pour toute personne concernée par le « vaccin » Pfizer/BioNTech ou Moderna ».

Ne faites confiance à aucune des instances promouvant cette saloperie, elles sont noyées ainsi que les individus qui les dirigent, dans le conflit d’intérêt le plus grossier et ce à tous les niveaux, que ce soit financier ou politique.

Voici le document à faire signer, diffusez, imprimez, distribuez… (PDF)
Déclaration-de-responsabilité-civile-et-pénale-du-médecin-1