Archive pour coronavirus et vaccin guerre biologique contre humanité

Les chaînes de l’esclavage moderne : syndrome du larbin et syndrome du mouton…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, société des sociétés, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 25 janvier 2021 by Résistance 71

 


Mieux que le mouton… production des labos Pfizer ?

 

Il y a 11 ans nous publions “Le syndrome du larbin”  ; qu’y a t’il de changé ? Rien, c’est pire !

Ne croyez-vous pas que l’heure de la révolte consciente a sonné ?… Le système étatico-capitaliste est au bout de son rouleau programmé. L’oligarchie qui le sert est en train de le faire muter en cette dictature technotronique planétaire qu’ils l’appellent “Great Reset”, “Grande Réinitialisation” ou Nouvel Ordre Mondial, peu importe, c’est de cela qu’il s’agit. Ce processus inclut une diminution drastique de la population mondiale, car 7,5 milliards de personnes, c’est en gros 7 milliards de trop pour la société partie dystopique pour les quelques 500 millions restant), partie idyllique (pour l’élite auto-proclamée), envisagée. Leur grand nettoyage a commencé avec la “pandémie” fabriqué du COVID-19 et les mesures “sanitaires” mises en place dans le monde entier. L’objectif n’est ni le virus SRAS-CoV-2 créé en laboratoire, ni ses thérapies géniques accessoires, non, l’objectif est LA FABRICATION DU CONSENTEMENT.
L’article ci-dessous envisionne le comment et pourquoi des moutons menés à l’abattoir et ce que ces moutons devraient faire pour sortir de l’hypnose induite.
Il y a des années un dessin humoristique faisait le portrait de deux moutons dans un énorme troupeau qui se dirigeait vers un bâtiment dans le lointain, l’abattoir, que les deux moutons, d’où ils étaient dans la masse en marche vers la mort , ne pouvaient pas voir. L’un disait à son pote : “Mais je te dis qu’ils vont nous tuer et qu’au final,  les hommes vont nous manger…” et son pote de rétorquer “Ah toi encore, avec tes théories du complot !”
Le fait est que dans les grandes lignes, les “théoriciens du complot” (expression inventée par la CIA du reste pour discréditer ceux qui doutaient il y a 58 ans de la version officielle de l’assassinat du président J.F.Kennedy…) ont eu raison, ce depuis le départ.
Il va falloir que la plus vaste majorité l’admette et donc… agisse en conséquence. Le BOYCOTT est une arme prouvée efficace, il est mentionné par P. Koenig ci-dessous, mais ce boycott ne doit pas être uniquement celui des systèmes électroniques (précisons ici qu’aucun d’entre nous à R71 ne possède un de ces soi-disants “smart-phones” et autres gadgets de l’esclavage électronique quotidien…), des GAFAM, mais aussi des institutions, du vote, de la participation aux activités systémiques pré-programmées. Retrouvons notre autonomie, organisons-nous de là où nous sommes, depuis nos voisinages, lieux de travail, communautés, étendons notre coopération en une vaste association de l’entraide hors état, hors institutions, hors marchandise, hors argent, hors salariat (don et partage), qui font partie de la panoplie du contrôle et de la division et de la peur obsolète et sur la voie de l’extinction. Refusons de consentir plus avant et unissons-nous dans la solidarité, ignorant la merdasse systémique ambiante moribonde et construisons la nouvelle société de l’horizontalité et du partage… La société des sociétés de notre diversité complémentaire et en rien antagoniste. Il en va aujourd’hui de notre survie dans un premier temps et de l’avenir des générations non-nées. Laissons-leur quelque chose de constructif et d’évolutif et non pas une vacuité technotronique dictatoriale contre-nature et anti-humaine.

La balle est de fait dans notre camp, c’est à nous de jouer, ce depuis un bon moment, mais bien trop ne le savent pas et attendent, attendent, attendent… et s’endorment devant leurs écrans.

Réveil donc et… “Action !”…

~ Résistance 71 ~

Voir notre page « Coronavirus guerre biologique contre l’humanité »

A lire aussi: « Les chaînes de l’esclavage », Jean-Paul Marat, 1774, réédition de 1792

“Toute révolte sans conscience politique est comme une explosion d’impuissance.”
~ Paulo Freire ~

 


A contre-courant… vers l’émancipation !

 

Le syndrome du mouton

 

Peter Koenig

 

21 janvier 2021

 

Source de l’article en français:
https://www.mondialisation.ca/le-syndrome-du-mouton/5652848

 

Peter Koenig est un analyste géopolitique et un ancien économiste principal à la Banque mondiale et à l’Organisation mondiale de la santé (OMS), où il a travaillé pendant plus de 30 ans sur l’eau et l’environnement dans le monde. Il donne des conférences dans des universités aux États-Unis, en Europe et en Amérique du Sud. Il écrit régulièrement pour des revues en ligne et est l’auteur de Implosion – An Economic Thriller about War, Environmental Destruction and Corporate Greed ; et co-auteur du livre de Cynthia McKinney « When China Sneezes : From the Coronavirus Lockdown to the Global Politico-Economic Crisis » (Clarity Press – 1er novembre 2020).

Aujourd’hui et au cours des derniers jours, de nouvelles « mesures » – des restrictions de liberté imposées par les gouvernements pour des raisons de « sécurité de la santé publique », c’est-à-dire pour empêcher la propagation des infections de la Covid – ont été renforcées dans toute l’Europe. Littéralement, ces gouvernements traîtres disent : « nous devons serrer les vis ». Sérieusement. WTF – pour qui se prennent-ils ? Des serviteurs du peuple qui les ont élus et qui les paient. C’est de la haute trahison. Mais les gens la prennent sans poser trop de questions, certaines plaintes mais pas assez fortes… nous vivons au milieu du syndrome du mouton.

Ils – ces gouvernements soi-disant amis du peuple – les appellent « mesures », un euphémisme pour dire « lockdown » [verrouillage ou confinement]- sonne mieux aux oreilles d’un public fatigué des répressions continues et de plus en plus nombreuses. Cette deuxième, voire troisième mesure de confinement dans certains pays, comprend la fermeture de nouvelles entreprises, un contrôle plus strict du travail à domicile, une plus grande distance sociale de la part de la police, le port de masques, l’interdiction des activités de groupe en intérieur, la possibilité pour cinq personnes seulement de se réunir dans un appartement… et, et, et.

Par exemple, il existe environ 75 études – à quelques exceptions près – sur l’inutilité et même les dangers du port de masque. Elles abordent surtout le danger pour les enfants et les jeunes adultes… c’est-à-dire les étudiants, mais personne, personne dans les médias achetés-compromis et contraints, soudoyés – les gouvernements occidentaux n’y prêtent la moindre attention, ni, bien sûr, la presse mainstream.

Ils imposent également un bureau à domicile, sachant très bien que tout psychologue et sociologue sérieux vous dit à quel point cela est dévastateur pour l’individu – solitude, manque de contact physique, de rencontre et d’interaction avec les collègues – ainsi que pour la société dans son ensemble. Sans contact physique, elle se brise. Tout cela est bien sûr gratuit – ainsi, toute fermeture de restaurant, tout événement où les gens se rassemblent et échangent, est interdit.

Les gens sont malheureux. Oui, mais pas assez pour arrêter cette tyrannie !Eh bien, je ferais mieux de bien me comporter, sinon je vais être puni. – LA PEUR ! – La peur conduit au syndrome du mouton – cette maladie sociale profonde qui nous frappe aujourd’hui – et ce depuis un certain temps. Elle fait beaucoup de mal non seulement à vous, mais aussi à la cohésion de la société. Les gens, nous devons nous en sortir.

Mais, il semble que les gens ne soient pas encore assez fatigués pour se lever à l’unisson, en criant « ça suffit », nous ne continuons pas, c’est de la tyrannie gouvernementale, nous cessons d’obéir.

Et oui, pour donner à la tyrannie plus de poids, plus de crédibilité, elle est renforcée par une soi-disant Task Force (TF), un groupe de « scientifiques » cooptés, spécialement mis en place par les puissances en place, pour les informer de ce qu’il faut faire. Il s’agit d’une ancienne méthode de dualité décisionnelle. Lorsque les gouvernements doivent, ou veulent, prendre des décisions qui ne sont pas populaires, ils demandent conseil à une Task Force spécialement désignée. Cependant, la Task Force a été informée et sait exactement ce qu’elle doit conseiller. C’est un mensonge prémédité, au mieux une manipulation de l’opinion publique.

Au Royaume-Uni et en France, de nouvelles mesures de verrouillage ont été imposées depuis plusieurs jours déjà, l’Autriche et la Suisse les ont annoncées il y a quelques jours – l’UE en tant qu’entité – ne dit rien, ne coordonne pas, ne veut pas voir que ces verrouillages ne détruisent pas seulement l’économie des nations individuelles, mais qu’ils conduisent l’UE entière au suicide économique. L’UE est paralysée par Washington et par l’OTAN.

Les nouveaux confinements – et peut-être d’autres – sont prévus car d’autres vagues d’épidémie COVID-19 sont en cours – jusqu’à ce que tout le monde soit vacciné – et se fasse injecter un gel électromagnétique dans le corps avec une substance modifiant l’ADN. Ainsi, ils sont maintenant totalement contrôlables dans le temps. Et l’horizon temporel fixé pour la numérisation totale de tout est 2030. L’IA et le contrôle des robots sur les humains – les transformer en transhumains – c’est l’objectif de l’Agenda 21-30 des Nations Unies. Et l’instrument pour y parvenir est l’Agenda ID2020 créé par Bill Gates (voir ceci)

Les médicaments traditionnels et très efficaces contre le coronavirus – éprouvés depuis plus de 60 ans pour d’autres infections et qui ont été utilisés avec succès en Chine pour vaincre l’épidémie, et maintenant en Argentine, en Bolivie, dans le sud du Pérou – et ailleurs dans le monde, sont désormais interdits sous peine d’amendes pour les médecins qui les prescrivent et traitent leurs patients avec ces médicaments. – Pouvez-vous imaginer ! – Donc, pas de guérison, seulement quand vous êtes vaccinés. Il est clair que derrière ce travail, qui se propage constamment, au point d’être imposé à la population, il n’y a pas que des milliards de dollars de profits pour les pharmacies, mais aussi des vaccins, en particulier les marques occidentales qui ne sont pas testées mais dont on sait scientifiquement qu’elles interfèrent avec l’ADN humain.

L’augmentation du nombre de fermetures tue plus de petites entreprises, de magasins et de restaurants. Les propriétaires de petites entreprises se retrouvent dans une situation encore plus difficile, les faillites se multiplient, les gens et leurs familles se retrouvent dans la misère et perdent leur emploi.

Imaginez un peu – l’enseignement à domicile, une famille de 4 personnes, les deux parents travaillent, les enfants doivent avoir chacun un ordinateur / portable raisonnablement puissant pour pouvoir se connecter à l’enseignant de l’école – les enfants doivent avoir des compétences informatiques raisonnables pour gérer l’enseignement à domicile, et les parents, même s’ils ont le temps, ont-ils tous des compétences informatiques raisonnables pour aider leurs enfants ? – Chaque famille, dans la société déjà très éprouvée par la maladie, dispose-t-elle des ressources nécessaires pour acheter le matériel électronique dont les enfants ont besoin ?

C’est une catastrophe. Encore une fois, un désastre injustifiée. Parce qu’il en résultera des enfants moins ou pas éduqués en Occident – les enfants non éduqués deviendront des adultes plus faciles à manipuler – eh bien, on s’attend à ce qu’ils tombent – en bloc – dans le syndrome du mouton de leurs parents. – Ou le deviendront-ils ? – C’est là que la dynamique risque de ne pas répondre aux attentes et à la pensée linéaire de l’élite.

C’est ce qui se passe dans le Nord global. Imaginez ce qui se passe dans le Sud, où la pauvreté, la misère et la famine croissantes ravagent des sociétés entières. Souvent, plus des deux tiers de la population d’un pays est pauvre et beaucoup d’entre eux se situent au niveau ou en dessous du seuil de pauvreté. Comment ces enfants seront-ils formés à distance ? – Ils ne le seront tout simplement pas. Nous avons donc une situation où le Sud produit des enfants sans éducation, parce qu’ils ne vont tout simplement pas à l’école. La plupart d’entre eux resteront pauvres, ils seront des travailleurs parfaits pour l’élite – ou de la chair à canon pour les guerres que les nations riches doivent (ou veulent) mener pour satisfaire leur avidité. N’oubliez jamais que les guerres sont rentables. Mais surtout à cause de la soif sociopathique des mondialistes pour toujours plus de pouvoir et d’argent.

En écoutant et en parlant aux gens dans la rue et aux propriétaires de petites entreprises, ils sont tous bouleversés, et beaucoup d’entre eux disent qu’ils ne survivront peut-être pas, qu’ils ne rouvriront peut-être jamais, malgré les subventions qu’ils reçoivent des gouvernements. En Suisse, le chef de « Gastronomie Suisse » a déclaré qu’avec un nouveau verrouillage, jusqu’à 50 % des restaurants pourraient ne pas survivre. Des chiffres similaires ont été mentionnés en Allemagne, en Autriche et en France – et il est certain que la situation est tout aussi dévastatrice ailleurs aussi.

Nous parlons surtout de l’Occident. La situation à l’Est, en Russie et en Chine et leurs alliés de l’Organisation de coopération de Shanghai (OCS) est différente, dans la mesure où ils ont une approche plus humaine de l’éradication de la COVID-19.

En Occident, dans certains cas, toute la vie des gens, leurs réalisations, leurs entreprises familiales, sont détruites au nom d’une règle inutile et purement oppressive. Le but de cette règle n’est pas d’éradiquer une maladie, mais les mesures anti-COVID-19 sont un moyen d’instiller la peur et de nous rendre dociles, pour les temps les plus difficiles à venir. Parce que, laissez-moi vous dire, quoi que vous pensiez, qu’en été 2021 ou l’année prochaine, en 2022, nous ne reviendrons pas à la normale – nous ne le ferons pas. Nous ne le ferons jamais. Ce, si nous les laissons faire ce qu’ils font maintenant.

Cette petite Cabale Mondialiste, via ses manipulateurs ultra-riches – des milliardaires à deux et trois chiffres, de la Silicon Valley – n’a pas seulement le pouvoir de censurer quiconque est contre la Matrice, mais ils censurent tous à l’unisson le président des États-Unis [Donald Trump]. Qu’est-ce que cela signifie pour un pays, ou pour une société dans laquelle nous vivons, une société qui se dit « démocratique » ?

Peu importe à quel point vous aimez ou n’aimez pas votre président, ne vous est-il pas venu à l’esprit que c’est l’incarnation de la liberté d’expression qui vous est retirée ? – Mais encore une fois, nous ne faisons rien. Nous regardons et nous nous plaignons, mais nous ne faisons rien. Nous laissons les choses se faire. Ne serait-ce pas une occasion en or de bloquer et de boycotter toutes les plateformes de médias sociaux ? Point final. – Vivez sans eux, bon sang, il y a 20 ou 30 ans, nous ne savions même pas qu’ils existaient, et encore moins dans quelle mesure nous serions accros à ceux-ci.

Si nous pouvons encore penser de manière indépendante, il est temps maintenant de se détacher de Facebook, Twitter, Instagram et de tous leurs noms – ne les utilisez pas. Revenez à des communications régulières d’homme à homme, à des dialogues, à des rencontres, à des appels téléphoniques, si possible sur une ligne fixe. Oui, je suis sérieux.

Pensez aux conséquences de cette tendance à ne pas parler librement, mais à une augmentation constante de l’IA par des algorithmes qui utilisent précisément les données que vous leur donnez sur la plateforme sociale pour vous asservir davantage ; par une robotisation et une numérisation toujours plus poussées – au point que nous ne réalisons même pas que nos cerveaux ont été branchés et « piratés » par des super-ordinateurs développés par la DARPA. Nous allons croire et suivre les ordres qui nous sont directement implantés par ces super-ordinateurs, gérés, devinez par qui – par la Cabale Mondialiste – à ce point que nous sommes devenus irréversiblement la personnification du Syndrome du Mouton. La DARPA (Defense Advanced Research Projects Agency) est une branche de recherche et de technologie avancée du Pentagone.

Quelqu’un veut-il cela ?

J’en doute.

Nous devons trouver un moyen d’agir maintenant. Je n’ai pas la solution. Mais peut-être qu’en nous connectant collectivement les uns aux autres spirituellement, peut-être en méditant – nous trouverons une solution – ou nous ferons émerger une solution.

Ce serait la voie noble – changer un environnement totalement abusif avec notre conscience et notre pensée spirituelle ; émettre des vibrations qui influencent notre destin collectif. Mais nous devons y croire et croire en nous-mêmes en tant que collectivité solide et solidaire.

Si nous ne parvenons pas, en tant qu’êtres humains, à revendiquer nos droits humains et civils et à les préserver, la planète finira par se désintoxiquer. Elle se débarrassera du chaos qui est tellement inhumain. Peut-être lui faut-il un ou deux cataclysmes énormes et durables : un tremblement de terre massif avec un tsunami désastreux, une éruption gigantesque d’un ou plusieurs volcans, assombrissant le ciel pendant des semaines, ou un ouragan ou une tempête de verglas monstrueux qui détruit et paralyse des parties de la civilisation, ou encore une énorme explosion solaire, mettant hors service le réseau électrique et électronique mondial – mettant fin à la numérisation de tout sur le champ. – Tout cela pourrait être bien pire que ce que la COVID-19, ou ses inventeurs, n’ont jamais fait.

Après un tel cataclysme, une grande partie de l’humanité pourrait devoir repartir de zéro – de près de zéro, et certainement sans numérisation – mais avec la liberté désormais perdue, pour repartir à zéro et se développer librement et souverainement en fonction de nos besoins.

Pendant des décennies, la « Cabale mondiale » nous a inondés de mensonges flagrants, de promesses de confort et de bien-être, mais avec l’idée que la concurrence plutôt que la coopération sera le véritable moyen de salut. Ces mensonges bien pensés ont conduit à une société de psychopathes égocentriques – non seulement, mais suffisamment pour influencer la nature même de la société, de nos vies dystopiques. Nous avons progressivement accepté, dans le LOCKSTEP, un mouvement de destruction de la société, voire de la civilisation, où on constate qu’il n’y a pas de véritable retour en arrière.

Travaillons à nous sortir du syndrome du mouton – MAINTENANT.

= = =

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 

Les virus mutent… les confinements sont prévus pour durer ad vitam aeternam… Si nous les laissons faire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 19 janvier 2021 by Résistance 71

 

 


Le Pinocchiorona-21…22…23…24…25…26…27…x+1

 

« Des chercheurs qui cherchent on en trouve, mais des chercheurs qui trouvent, on en cherche ! »
~ Coluche ~

 

Les histoires de “mutations” de la COVID19 montrent que les confinements sont prévus pour durer éternellement

 

Brandon Smith

 

Décembre 2020

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-histoires-de-mutations-de-la-covid-19-montrent-que-les-confinements-sont-concus-pour-durer-eternellement

 

Depuis de nombreux mois maintenant, j’avertis que la conception des mesures de confinement de la pandémie est perpétuelle, ce qui signifie que les mesures de confinement sont censées durer éternellement. Nous pouvons le constater dans les commentaires des élites de l’establishment qui font pression pour obtenir ces contraintes ; leur argument le plus fréquent étant que les restrictions liées à la pandémie sont la « nouvelle normalité ». Cette affirmation est soulignée par des globalistes comme Gideon Lichfield du MIT dans son article « On ne va pas revenir à la normale« .

Dans cet article, il déclare :

En fin de compte, cependant, je prédis que nous allons rétablir la capacité de socialiser en toute sécurité en développant des moyens plus sophistiqués pour identifier qui est à risque de maladie et qui ne l’est pas, et en discriminant – légalement – ceux qui le sont.

… on peut imaginer un monde dans lequel, pour prendre un vol, il faudra peut-être être inscrit à un service qui suit vos déplacements via votre téléphone. La compagnie aérienne ne pourrait pas voir où vous êtes allé, mais elle recevrait une alerte si vous avez été à proximité de personnes infectées connues ou de points chauds de la maladie. Les mêmes exigences s’appliquent à l’entrée des grandes salles de spectacles, des bâtiments gouvernementaux ou des centres de transport public. Il y aurait des scanners de température partout, et votre lieu de travail pourrait exiger que vous portiez un moniteur qui surveille votre température ou d’autres signes vitaux. Si les boîtes de nuit demandent une preuve d’âge, elles pourraient à l’avenir exiger une preuve d’immunité – une carte d’identité ou une sorte de vérification numérique via votre téléphone, montrant que vous vous êtes déjà remis ou que vous avez été vacciné contre les dernières souches de virus.

Dans mon article « Vagues de mutilation : La tyrannie médicale et la société sans cash« , j’ai démantelé les arguments de Lichfield et expliqué pourquoi les contrôles que l’establishment tente de mettre en place ont été planifiés longtemps à l’avance. Le « grand reset » et la « quatrième révolution industrielle » sont en cours de développement depuis au moins 2014, date à laquelle ces termes ont été injectés pour la première fois dans les principaux médias économiques. Les idées de société sans cash, d’« économie de partage », de surveillance biométrique des masses, de scores de crédit social, etc. font toutes partie du programme globaliste depuis des décennies. Le coronavirus n’est pour eux qu’une crise utile à exploiter pour justifier les mesures draconiennes qu’ils ont toujours voulues.

Le plan était si prévisible que j’ai même souligné, au début de l’épidémie de coronavirus, que les confinements ne prendraient pas fin même si une vaccination efficace était mise au point, car il leur suffirait de déclarer qu’une « nouvelle mutation » du virus résistante aux traitements existants a été trouvée. Ou bien, ils pourraient concevoir un tout nouveau virus et le diffuser dans la population afin de maintenir la machine à reset en marche.

Il n’est pas surprenant qu’au moment où la nouvelle a été diffusée que les vaccins Pfizer et Moderna, à peine testés et très suspects, étaient mis à la disposition du public, des rapports ont commencé à faire état de mutations du coronavirus, « plus infectieuses« , trouvées dans des endroits comme le Royaume-Uni, l’Inde et l’Afrique du Sud.

Je ne suis pas sûr que les élites puissent être plus transparentes.

Prenez le vaccin Pfizer maintenant et vous pourriez recevoir un passeport d’immunité pendant quelques mois, puis il sera annulé à chaque nouvelle mutation du virus. Vous devez donc vous soumettre à des vaccinations sans fin, dont beaucoup n’ont pas encore été testées et sont potentiellement dangereuses. Comme l’ancien vice-président de Pfizer et d’autres professionnels de la santé l’ont mis en garde, ces vaccins sont comme la roulette russe et pourraient provoquer une réaction auto-immune qui conduirait à la stérilité ou à d’autres réactions nocives.

Les vaccins eux-mêmes sont une solution à court terme, même s’ils sont efficaces. Ils nécessitent plusieurs doses au cours d’un mois, et les vaccinations doivent être renouvelées éventuellement tous les quelques mois. Fondamentalement, cela ne s’arrête jamais. Avec les mutations et les anticorps limités des vaccins, les élites pourraient maintenir les confinements et les contraintes en place pendant de nombreuses années.

L’Organisation Mondiale de la Santé indique clairement que la vaccination ne sera pas nécessairement considérée comme une solution à la propagation du virus. Cela signifie que même si vous êtes vacciné, vous serez toujours considéré comme un porteur et un transmetteur potentiel de la Covid-19, ce qui signifie que les mesures de confinement et les obligations de port de masques ne cesseront pas. Cela soulève la question suivante : quel est l’intérêt du vaccin ?

Le responsable scientifique de l’OMS cite le fait qu’il n’y a pas suffisamment de preuves pour établir que les vaccins empêchent la transmission. Selon cette logique, nous pourrions également soutenir qu’il n’y a pas de preuve que les vaccins sont efficaces à 95%, ou qu’ils sont sûrs à tout le moins.

En attendant, l’OMS et notre sympathique voisin fasciste, le Dr Anthony Fauci, répandent constamment l’histoire selon laquelle la « pire épidémie«  est encore à venir. Il faut que ce train de la peur continue à avancer sur la voie du « Grand Reset », n’est-ce pas ?

Pour les personnes qui croient réellement que la crise de la pandémie de Covid-19 prendra fin après les vaccinations de masse, je suis désolé de le dire, mais vous avez été dupés. Chaque élément de la réponse de l’establishment et chaque déclaration publique qu’ils font indique qu’ils prévoient de violer vos libertés civiles pendant longtemps. Ces promesses d’aide au coin de la rue ? Des mensonges. L’affirmation selon laquelle si vous suivez leur programme, tout reviendra à la normale ? C’est une arnaque. C’est une rhétorique creuse conçue pour vous faire taire et vous soumettre à la tyrannie médicale juste assez longtemps pour que cela devienne irréversible.

Je soupçonne qu’ils espèrent pouvoir conditionner le public au cours des prochaines années à s’adapter simplement aux contrôles jusqu’à ce que nous oubliions ce qu’était la vie avant la pandémie et le reset. Il semble cependant que le plan de reset des globalistes ne se déroule pas très bien.

Les vaccins et les nouvelles sur les mutations semblent précipités, c’est le moins qu’on puisse dire. Au départ, l’establishment a déclaré qu’il faudrait au moins 18 mois rien que pour mettre au point un vaccin à des fins d’essais et de tests, et que les confinements se poursuivraient bien au-delà de ce délai jusqu’à ce qu’une majorité de la population soit immunisée. Au lieu de cela, ils ont lancé plusieurs vaccins en six mois et le récit de la mutation fait déjà la une des journaux.

Je pense que cela est dû au fait que la résistance aux mesures de confinement face à la pandémie s’accroît et que le nombre de personnes refusant de se faire vacciner semble élevé. Comme on le dit, la révolution ne sera pas télévisée, mais il est encore impossible de la cacher complètement.

En Europe, un pourcentage énorme de la population (environ 50 % ou plus selon les pays) hésite à se faire vacciner. Aux États-Unis, les sondages montrent qu’au moins 30 % de la population refusera catégoriquement, tandis que 60 % des gens hésiteront selon l’efficacité du vaccin.

Même un grand nombre d’agents de santé refusent le vaccin, et ce sont ces personnes qui subissent le plus de pression pour se soumettre ou faire face aux conséquences.

Hilarant, les médias affirment que bien qu’il y ait eu « quelques réactions allergiques » au vaccin, il n’y a « aucune preuve d’effets secondaires graves à long terme ». Peut-être est-ce parce qu’il n’y a aucune étude des effets à long terme et qu’il y a eu un minimum d’essais avant que les vaccins ne soient mis sur le marché ? N’est-ce pas là une logique de base ? Pensent-ils vraiment que nous sommes aussi stupides ?

Jusqu’à présent, il semble que des centaines de millions de personnes ne soient pas aussi bêtes. Étonnamment, même des shérifs et des policiers dans tout le pays refusent ouvertement d’appliquer les mandats et d’infliger des sanctions au nom de la loi aux citoyens qui ne se soumettent pas. C’est vraiment un énorme obstacle pour les globalistes et leur reset.

Le virus a produit un IFR (Taux de létalité) de 0,26% chez toute personne ne se trouvant pas dans une maison de retraite avec des conditions préexistantes. Plus de 40 % des décès dus au Covid sont attribués à des personnes âgées qui souffraient déjà de nombreuses affections. Seulement 10 % environ des personnes qui finissent par être hospitalisées à cause de la Covid-19 souffrent de problèmes de santé à long terme (plus de trois mois). De plus, seuls 15 % environ des lits de soins intensifs sont utilisés aux États-Unis, ce qui signifie que les allégations de surcapacité et d’hôpitaux pleins n’étaient rien de plus que de la peur pour susciter des craintes, depuis le début.

Considérez le fait que des centaines de milliers de personnes meurent déjà chaque année de maladies infectieuses comme la grippe et la pneumonie et la Covid-19 commence à sembler beaucoup moins menaçant. Ce n’est certainement pas une excuse pour les confinements médicaux et les mesures orwelliennes de recherche des contacts.

En outre, de nombreuses études révèlent que les mesures de confinement et les masques sont totalement inefficaces pour arrêter la propagation du virus. Les États et les pays dont les contraintes sont parmi les plus strictement appliqués ont également tendance à être les endroits où les pics d’infection sont les plus élevés.

C’est pourquoi il est logique que de nombreuses personnes refusent de se conformer à ces contraintes. Les médias prétendent que nous sommes des théoriciens de la conspiration qui croient que le virus « n’existe pas » ; ce n’est pas le cas. En fait, je soupçonne depuis longtemps que le récit selon lequel le virus « n’existe pas » était une psy-op ou un homme de paille qui serait utilisé contre le mouvement de la liberté plus tard pour discréditer notre résistance aux confinements médicaux.

La plupart d’entre nous sont bien conscients de l’existence du virus. Certains d’entre nous l’ont déjà combattu et s’en sont remis. Ce que nous disons, c’est que le CDC, l’OMS et les propres statistiques de la communauté médicale montrent que la Covid-19 n’est pas une menace pour plus de 99% de la population. Si nous devons accepter leurs statistiques comme étant même très peu précises, alors la Covid-19 devient un non-problème pour la plupart des gens.

Une fois de plus, je poserai la question que les médias dominant refusent de poser :

Pourquoi dit-on à 99 % de la population qu’elle doit sacrifier son emploi, ses entreprises et ses libertés au nom de la sécurité de moins de 1 % de la population ? Pourquoi ne pas demander aux 0,26% de personnes menacées par le virus de se porter volontaires pour rester chez elles afin que le reste d’entre nous puisse reprendre une vie normale ? Pourquoi faisons-nous le contraire de ce qui est le plus logique ?

La réponse est que la réponse à la pandémie est une question de domination, et non de santé publique. Les gens commencent à s’en rendre compte et ils sont sur le point de se révolter.

Donc, la prochaine étape logique pour l’establishment, s’il veut vraiment mettre en place son programme de reset, est d’introduire une nouvelle menace. Cela signifie qu’ils ont besoin d’une « mutation » du virus ou d’un tout nouveau virus afin de créer le genre de peur nécessaire pour manipuler le public et l’amener à accepter un contrôle plus poussé.

Un nouveau virus plus mortel sera-t-il découvert ? Peut-être. Dans la plupart des cas, les virus ont tendance à évoluer vers des souches moins mortelles que l’original. Ils ont également tendance à équilibrer leur taux de propagation et leur taux de mortalité. En d’autres termes, comme toute autre créature, les virus évoluent pour survivre, et un virus ne peut pas survivre s’il tue la majorité de ses hôtes potentiels. Ainsi, ils mutent pour devenir plus infectieux, mais invariablement moins mortels.

Si une « mutation » plus mortelle que la forme actuelle de la Covid-19 apparaît sur la scène, je serais très méfiant quant à ses origines. Le plus probable est que les élites sont en panique et qu’elles utilisent le récit de la mutation comme un outil de propagande pour semer la terreur et le conformisme dans le public. Il se peut qu’il n’y ait pas de mutation du tout, ou que les mutations n’aient aucune incidence significative sur le taux de mortalité.

Ironiquement, en lançant à la hâte les vaccins et les histoires de mutation, les élites se sont sabotées elles-mêmes. Elles ont voulu faire un blitzkrieg du public avec les confinements et elles ont rencontré une résistance plus forte que prévu. Ils ont donc mis le programme de vaccination sur un train fou et maintenant le public se méfie de se faire injecter un modèle de vaccin à peine testé. Maintenant, ils font la promotion du croque-mitaine de la mutation et cela ne fait que faire se demander pourquoi les gens devraient prendre n’importe quel vaccin ? Si le virus va continuellement muter, alors pourquoi prendre un vaccin douteux qui pourrait être inutile en quelques mois ?

Le récit de la mutation ne fait qu’exposer davantage ce qui est vraiment à l’ordre du jour : ce que les élites veulent, c’est un enfermement sans fin. Il n’y a pas de programme pour sauver des vies ou aplatir la courbe. Tout l’argument de la santé est une absurdité totale. Rien de ce qui a été fait jusqu’à présent ne soutient l’idée que la santé publique est la priorité. Au lieu de cela, nous assistons à une course folle vers le totalitarisme en utilisant la Covid-19 comme excuse, et l’effort échoue.

= = =

Voir notre page « Coronavirus, guerre contre l’humanité »

 

Communiqué de presse de l’association Réaction 19 concernant la plainte pénale déposée contre l’utilisation des vaccins

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, Internet et liberté, média et propagande, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 5 janvier 2021 by Résistance 71

 

 


+ Moderna + AstraZeneca… L’humanité en péril

 

Association Réaction 19

 

4 janvier 2021

 

Communiqué de l’Association Réaction 19

4 janvier 2021

L’Association RÉACTION 19, co-présidée par Messieurs Carlo Alberto BRUSA et Riccardo MEREU, est une association loi 1901 qui compte aujourd’hui près de 40 000 adhérents et plus de 60 000 sympathisants, dont l’objet est de veiller au respect des libertés fondamentales, notamment dans le cadre de l’épidémie de la COVID-19.

L’Association RÉACTION 19 a, le 16 décembre 2020, déposé une plainte concernant les thérapies géniques Pfizer/BioNTech et Moderna, communément dénommées « vaccins ». Des chefs de :

  • mise en danger délibérée de la vie d’autrui ;
  • tromperie aggravée ;
  • abus de faiblesse ;
  • extorsion aggravée.

Déjà plus de 5 000 personnes ont déclaré s’associer à cette plainte, ce chiffre ne cessant de croître. Leurs interventions volontaires seront déposées auprès du Procureur de la République dans les prochains jours.

La plainte, enregistrée sous le numéro 20351000746, demeure entre les mains de la Justice et du Procureur de la République de Paris.

L’Association RÉACTION 19 a également adressé aux prescripteurs desdits « vaccins », notamment à l’ensemble des députés et sénateurs, au président de la République, au premier ministre, au ministre de la Santé et aux médecins, une déclaration d’engagement de responsabilité civile et pénale quant aux effets secondaires de ces « vaccins » pouvant aller jusqu’à la mort.

À ce jour, aucun des prescripteurs susdits n’a signé cette déclaration et n’a donc accepté d’engager sa responsabilité personnelle sur les conséquences de cette politique vaccinale.

Fait à Paris, le 30 décembre 2020.

Pour l’Association RÉACTION 19
Monsieur Carlo Alberto BRUSA
Président
63, rue la Boétie – 75008 PARIS
Mail : reaction19fr@gmail.com

= = =

Format PDF :

Communiqué-de-presse-relatif-à-la-plainte-pénale-rel-ative-aux-vaccins

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Dictature COVID-19 : Les labos poussent les gouvernements à les exonérer de toute responsabilité pour leurs vaccins chimériques…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

 

 

 

Les labos pharmaceutiques s’exonèrent de toute responsabilité sur les effets secondaires des vaccins covid

 

Anonyme

 

25 décembre 2020

https://www.lefigaro.fr/societes/vaccins-covid-19-l-ue-nbsp-indemnisera-les-laboratoires-en-cas-de-problemes-20200827

Bill Gates admet que ses vaccins changeront le génome

https://youtu.be/ksEVaO806Oo (vidéo à enregistrer avant censure)

Fauci le pantin de Bill Gates qui veut imposer les vaccins aux américains avoue que les vaccins covid peuvent être pires que le covid lui même

https://metro.co.uk/2020/05/12/americas-top-coronavirus-doctor-warns-vaccine-make-covid-19-worse-12692519/?ito=cbshare (article à enregistrer avant censure)

Bill Gates admet que ses vaccins peuvent tuer

https://www.armstrongeconomics.com/world-news/corruption/gates-admits-700000-people-may-die-from-his-vaccine/?__cf_chl_jschl_tk__=62eb6c7077991213fdafe4e84df29c5a07ebf0d4-1608836399-0-AVlKQVPOLfSy9QfQp3lKiMepwzABRTxxWMfww9Whtf27OPGp9Pysbzlln1vrkzWizhdh6sdzI5srwLQcRmU9Oi9E1O19KBS-t2bK9oY-kqIXxvzXo1evnUHmG-l9_fyt9BC82pusuzl4UQGKD99EyWzQQE8WO-spDIG2E8X-kqGWxXx7WeDjvlfQDbMemduSicRT22up-wqnYkzixyqrGvZ03FPAlCreAGCM0rYoEZcLZFPQFUVk7yyvxEUB6t1kl0wF9_gLrccxEoZtTl5ZLrhwVLAEPphfWMbYdrMIwW4CSEJyIQAnGO-mLBLRZV7otU94GN1ZQNccruGGk4-J3LKg0QjK58r7il0j3drDYjegmDieMGRAHBb3V7spLOlqZnk9Cg6q0UHKS6L_4uc_z1gDYNjz hY4WhEzoc4E6tfrWFkISoYiR0iLFQWZLiVk4z0GdxWuZPk33MketC3pa9do

https://resistance71.wordpress.com/2020/10/06/coronavirus-vaccin-covid19-et-controle-mondial-de-la-population/

les labos des vaccins AstraZeneca (NYSE: AZN), GlaxoSmithKline (NYSE: GSK), Janssen (NYSE: JNJ), Merck (NYSE: MRK), Novavax (NASDAQ: NVAX), Pfizer (NYSE: PFE), Sanofi Pasteur (NASDAQ) : SNY), Takeda (NYSE: TAK), Abbott (NYSE: ABT) et CureVac (NASDAQ: CVAC) ont tous demandé à être exonérés de toute responsabilité sur les effets secondaires de leurs vaccins OGM à ADN ou ARN

https://seekingalpha.com/news/3608810-coronavirus-vaccine-makers-seek-eu-liability-protections

AstraZeneca , GlaxoSmithKline, Janssen , Merck, Novavax , Pfizer , Sanofi , Takeda, Abbott CureVac sont tous financés par Bill Gates ou d’autres géants du web (comme le milliardaire Dietmar Hopp, co-fondateur du géant allemand du logiciel SAP https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html). ou collaborent avec lui

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2016/10/OPP1156831

https://observer.com/2020/05/coronavirus-vaccine-update-novavax-merck-bill-gates-funding/

https://nypost.com/2020/09/15/bill-gates-says-pfizer-has-best-shot-at-early-covid-19-vaccine/

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2015/10/OPP1127586

https://america-wake-up.com/2020/05/04/the-anthony-fauci-bill-gates-george-soros-sanofi-pasteur-china-corona-virus-vaccine-connection/

https://www.fiercebiotech.com/biotech/sanofi-pasteur-announces-vaccine-discovery-collaboration-bill-melinda-gates-foundation

https://www.takeda.com/newsroom/newsreleases/2016/takeda-receives-$38-million-grant-from-the-bill–melinda-gates-foundation-to-support-polio-eradication-in-developing-countries/

https://edition.cnn.com/2020/08/14/investing/curevac-ipo-coronavirus-vaccine-bill-melinda-gates/index.html

Pourquoi les géants du web investissent dans les vaccins?

Tout simplement parce que le but des vaccins c’est de donner une identité numérique, marque de la bête connecté à la 5G

https://www.kla.tv/Coronavirus-fr/16685

une autre vidéo qui en parle a été censurée sur

http://stoplinkyvarest.canalblog.com/archives/2020/09/21/38547121.html

vaccin connecté à la 5G

https://resistance71.wordpress.com/2020/10/09/dictature-technotronique-en-marche-vaccin-covid-arnm-hydrogel-enzyme-luciferase-cocktail-modificateur-genetique/

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

https://resistance71.wordpress.com/2020/12/16/laffaire-du-vaccin-contre-la-covid-19-nest-pas-une-affaire-sanitaire-mais-celle-de-la-normalisation-de-lidentite-numerique-philippe-guillemant-physicien-cnrs/

 

Déclaration de responsabilité civile et pénale pour l’administration du vaccin Pfizer / BioNTech ou Moderna dans le cadre de la COVID-19 (Association Réaction19, format PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 26 décembre 2020 by Résistance 71


Mais que diable vont-ils nous injecter ?…

POUR DIFFUSION IMMEDIATE

Résistance 71

26 décembre 2020

Devant la menace sanitaire de ces vaccins OGM à ARNm dont personne ne peut savoir ce qu’ils génèreront sur le long terme sur le génome humain et le manque de transparence total les concernant, ainsi que l’ineptie totale pour les gouvernements et surtout l’UE d’avoir totalement exonéré de toute responsabilité légale les labos pharmaceutiques Pfizer / BioNTech, Moderna, voici un document de responsabilité civile ayant valeur légale que ceux qui désirent se faire vacciner peuvent faire signer au médecin et chargé de mission sanitaire les injectant.
Le document est réalisé par l’association REACTON19, Paris 8ème, rue de la Boétie, « pour toute personne concernée par le « vaccin » Pfizer/BioNTech ou Moderna ».

Ne faites confiance à aucune des instances promouvant cette saloperie, elles sont noyées ainsi que les individus qui les dirigent, dans le conflit d’intérêt le plus grossier et ce à tous les niveaux, que ce soit financier ou politique.

Voici le document à faire signer, diffusez, imprimez, distribuez… (PDF)
Déclaration-de-responsabilité-civile-et-pénale-du-médecin-1

Test COVID-19 RT-PCR : deux textes vitaux pour comprendre la fraude des chiffres statistiques de la pandémie (PDF)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 17 décembre 2020 by Résistance 71

 

 

Résistance 71

 

17 décembre 2020

 

Nous avons traduit et publié récemment ces deux textes que Jo nous a réunis en un temps record dans ce PDF vital à la compréhension de l’enfumage auquel nous sommes tous victimes et qui vise à la mise en place d’une bonne partie de la grille de contrôle technotronique planétaire, comme l’explique par ailleurs le physicien Philippe Guillemant, et du contrôle eugéniste de la population mondiale par l’oligarchie en charge de faire perdurer le système étatico-capitaliste en phase de mutation vers son objectif final transhumaniste.
La mise en place d’une dictature sanitaire planétaire ne peut reposer que sur une seule chose ressentie par la vaste majorité des gens: la peur, voire la psychose face à quelque chose qu’on ne peut pas voir ni maîtriser (plutôt, qu’on ne VEUT pas maîtriser). Quoi de mieux donc qu’un nouveau croquemitaine invisible et nuisible à souhait, entre ainsi en scène le nouveau coronavirus (créé en laboratoire) :

Bébert Corona. Pour que la peur soit effective, durable, ajustable et modulable il faut qu’elle s’appuie sur la « science », mais pas n’importe quelle science… celle des chiffres, des statistiques et des extrapolations modélisées, comme à l’accoutumée maintenant ; de cette science qui privilégie les modèles informatiques à l’observation de faits de terrain.
Pour ce faire, il faut des chiffres, mais pas n’importe lesquels et certainement pas ceux qui résulteraient d’une observation réelle de terrain, mais de chiffres « adaptés » pour la circonstance, non pas falsifiés par quelques personnes mal intentionnées, ce serait vite repérable, mais par un protocole litigieux à moins, frauduleux au pire, pratiqué à l’insu et au plein gré de toutes et tous. Entre en scène les kits de test RT-PCR pour Real Time-Polymerase Chain Reaction… Tout est en place… le virus a été largué dans la nature… Que la fête commence !

Qu’est-ce que ce test PCR et quel usage en est-il fait ? Quelques réponses essentielles dans ces deux articles que nous avons traduits et que Jo nous a mis en PDF, à lire et diffuser sans aucune modération.

Dossier-special-CoV19-fraude-tests-RT-PCR
format PDF

 

Entretien du Pr. Personne avec France-Soir au sujet de sa suspension.
Nous devons dire ici que depuis quelques semaines, nous sommes étonnés de voir France-Soir
comme voix critique dans les médias de masse français au sujet de cette crise COVID.
Tout à leur honneur, ne crachons pas dans la soupe…

 

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , on 16 décembre 2020 by Résistance 71

 

 

Le principal but de la vaccination n’est pas d’ordre sanitaire

 

Philippe Guillemant*

 

Novembre 2020

 

Source:
https://www.mondialisation.ca/le-principal-but-de-la-vaccination-nest-pas-dordre-sanitaire/5651962

 

Le principal but de la vaccination est de parvenir à une normalisation du port d’identité numérique par chaque citoyen.

Il sera en effet permis que le contrôle de ses droits d’accès à différents lieux (restaurants, boutiques, gares etc.) se fasse de manière automatique, ce qui ouvrira un immense marché, celui des objets connectés, tellement savoureux qu’il est capable de transformer des informaticiens en virologues.

Cela permettra également l’introduction d’une monnaie numérique déjà préparée par la suppression progressive de l’argent liquide.

Il y a deux cas à considérer :

– Port d’identité numérique non intimement liée au corps : mobile, bracelet, montre, sac à main…

– Port d’identité numérique intimement liée au corps : bague, puce sous la peau, identification génique…

Dans le second cas il sera impossible, sauf opération chirurgicale, de se débarrasser de son identité.

Dans un premier temps, seul le premier cas est à considérer sérieusement.

Ce n’est que lorsque l’usage d’une identité numérique sera normalisé par l’habitude (de vivre autrement) que le second cas s’imposera naturellement pour renforcer la sécurité de l’usage.

Aujourd’hui, ce port d’identité numérique est déjà réalisé via nos mobiles, mais aucun usage n’en est fait, sauf marginal comme dans le cas de l’application TousAntiCovid.

Tout le monde a le droit d’entrer dans n’importe quelle boutique et de voyager sans être obligé d’avoir un portable.

D’autre part, le traçage des déplacements permis par un mobile est très grossier, sa précision étant comprise entre 1 et 10 mètres.

On peut considérer que pour l’instant, avoir un portable est inoffensif.

Tout cela pourrait changer avec le contrôle vaccinal automatisé et la généralisation des objets connectés via la 5G et même dès la 4G.

En particulier le traçage ne serait plus réalisé par GPS, mais par analyse et triangulation de signaux via les objets alentours et sera à terme 100 à 1000 fois plus précis, à mesure que la technologie évoluera.

Le port non lié au corps d’identité numérique, dans un environnement peuplé d’objets connectés (maisons, voitures, routes, villes…)

permettrait les recueils de données suivants par une I.A. :

– Vérification d’autorisation d’accès pour les vaccinés

– Contrôle de vitesse et stationnement (voiture connectée)

– Identification de toutes sortes d’infractions à la conduite

– Identification des personnes avec qui l’on déjeune

– Mémorisation de tous les déplacements

– Calcul de temps de travail ou temps de présence…

– Détection de déplacement inhabituel…

– Etc

Il convient de préciser qu’aucune loi ne pourrait empêcher l’implémentation des algorithmes correspondants, mais seulement en interdire l’usage. Toutefois, il serait extrêmement difficile de détecter qu’un tel usage n’est pas effectué.

Seule son exploitation pourrait être rendue visible, mais cela laisse une grande place à une exploitation inavouée, par exemple par une société d’assurance où le calcul des droits est déjà réalisé de façon informatique.

Considérons maintenant le deuxième cas, et allongeons la liste précédente :

– Maison intelligente (interactions, commandes, dialogues…)

– Analyse d’activités privées (dormir, lire, faire l’amour…)

– Surveillance de l’activité des enfants

– Analyse des interactions familiales

– Analyse de situation (repos, activité, chute…)

– Analyse de comportement (geste brusque, activité sportive…)

– Détection et mémorisation des habitudes

– Etc

J’en oublie certainement, sachant qu’il est difficile d’imaginer d’avance tout ce que la quatrième révolution industrielle pourrait nous inventer.

Je ne parle ici que d’un transhumanisme très doux, presque acceptable, sans faire référence à quoi que ce soit d’intrusif comme une puce dans le cerveau, des nanorobots dans nos veines ou une vision artificielle et connectée.

Mais il va de soi que l’acceptation de ces technologies intrusives est conditionnée à l’acceptation de l’usage d’identité numérique.

La question de savoir si nous allons effectivement rentrer dans ce nouveau monde, ou pas, va donc dépendre du niveau d’acceptation du vaccin.

Il est en effet peu probable que l’on oblige chaque citoyen à porter une identité numérique lors de ses déplacements si 50% de la population n’est pas vaccinée, car on ne va pas limiter à ce point la liberté de circulation. Par contre, si seulement 5% de la population n’est pas vaccinée, il est fort probable qu’on entrera dans ce nouveau monde.

La réalité sera évidemment bien plus complexe que cette simplification binaire, qui n’a d’autre but que d’éveiller aux véritables enjeux.

Donc, je le répète, nous ne sommes pas confrontés à un problème sanitaire avec le virus.

Ce problème-là est peanuts à coté du choix de société qui se trouve devant nous, qu’une politique de gouvernance mondiale semble avoir déjà fait à notre place.

Mais je le répète une fois de plus, mon avis est qu’on n’entrera pas dans ce nouveau monde.

(*)

Philippe Guillemant est un ingénieur physicien français diplomé de l’Ecole Centrale Paris et de l’Institut de Physique du Globe. Il est Docteur en Physique et Habilité à Diriger des Recherches. Il exerce son activité au CNRS (UMR 7343, laboratoire IUSTI de Polytech’ Marseille) où il est Ingénieur de Recherche Hors Classe.

Spécialiste d’intelligence artificielle, ses travaux ont débouché sur la création de deux entreprises innovantes licenciées par le CNRS: Synapsys et Uratek, qui lui ont valu plusieurs distinctions dont le Cristal du CNRS.

Son site : http://guillemant.net/

= = =

Lire notre page « Coronavirus, guerre contre l’humanité »

Dernières réflexions et analyses du pr. Raoult qui atomise une harpie du système au passage… Délectable !

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, média et propagande, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 14 décembre 2020 by Résistance 71

Résistance 71

14 décembre 2020

Excellentissime entretien du Professeur Didier Raoult qui exprime ses réserves sur les vaccins et continue sa démolition en règle de la méthodologie pseudo-scientifique qui régit cette « crise coronavirus » du SRAS-CoV-2. Au passage, il démonte la harpie Ferrari, avec Raoult c’est du 2 en 1.

LF: « mais moi je vais me faire vacciner !… »

DR (hilare) : mais c’est très bien, allez-y !

A voir et diffuser sans aucune modération…

Et aussi… Notre page « Coronavirus, guerre biologique contre l’humanité »

Vaccin CoV19 et stérilisation des populations ?…Des éléments plus que troublants

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 12 décembre 2020 by Résistance 71

 

 

Un vaccin covid qui stérilise la population pour un virus moins mortel que la grippe ?

 

Anonyme (reçu par courriel)

 

12 décembre 2020

 

La protéine d’origine virale du placenta et la protéine d’origine virale du sperme ressemblent à la protéine d’origine covid

vaccination covid= stérilisation des femmes et des hommes ?

8% de l’ADN humain est d’origine virale, les virus participent au système de reproduction humaine, si le covid ressemble au virus participant à la reproduction humaine, le vaccin covid s’attaquera à la fertilité humaine

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

La protéine d’origine virale chargé de la création du  placenta ressemble à la protéine créé par le covid,  donc il y a un risque que le vaccin covid  va causer l’infertilité tant des femmes que des hommes, car la syncytine 1 est présent aussi dans le sperme

https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

La syncytine 1 est une protéine d’origine virale joue un rôle essentiel lors de la formation du placenta au moment de la grossesse

La syncytine est une glycoprotéine d’enveloppe rétrovirale possédant des capacités fusogéniques induisant la formation de syncytium (cellules polynucléées découlant de fusion cellulaire). Elle est abondamment exprimée au niveau du placenta durant la grossesse. Chez l’humain les cytotrophoblastes jouent un rôle crucial dans le développement fœtal et placentaire. https://fr.wikipedia.org/wiki/Syncytine_1

« Qu’y a-t-il, dans ces protéines syncytines créés par les virus de l’ADN humain https://fr.wikipedia.org/wiki/Syncytine_1, de si nécessaire à la formation du placenta ? « Pour qu’ils puissent pénétrer dans la cellule hôte, les rétrovirus ont la faculté de faire fusionner la membrane de leur enveloppe avec la paroi cellulaire, explique M. Heidmann. Cette fusion de deux membranes est rendue possible par les syncytines puisque ce sont elles qui interagissent avec la surface de la cellule qui va être infectée. » Or ce mécanisme de fusion membranaire permet la formation de structures géantes appelées « syncytia » et constituées par la réunion de cellules individuelles… Une structure que l’on retrouve dans le placenta, à l’interface entre le foetus et la mère. »

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

là une preuve que le covid 19 est en partie similaire au virus du placenta qui permet la création des bébés: 

« les protéines de pointe du COVID 19 contiennent également des protéines homologues à la syncytine protéine d’origine virale chargé de la formation du placenta »

.http://www.francesoir.fr/societe-sante/vaccination-sars-cov-2-le-dr-wodarg-et-le-dr-yeadon-disent-stop

Pfizer admet que son vaccin peut causer la stérilisation des femmes

« Responsable de la recherche chez Pfizer : Le vaccin Covid entrainera la stérilisation des femmes

Le vaccin contient une protéine de pointe (voir image) appelée syncytine-1, vitale pour la formation du placenta humain chez la femme. 

Si le vaccin fonctionne de telle sorte que nous formons une réponse immunitaire CONTRE la protéine de pointe, nous entraînons également le corps féminin à attaquer la syncytine-1, ce qui pourrait entraîner une stérilité chez les femmes pour une durée indéterminée.

Après quelques recherches, il s’avère que la syncytine 1 est également présente dans le sperme, de sorte que ce ne sont pas seulement les femmes qui seront stérilisées, mais aussi les hommes

https://www.researchgate.net/publication/261257414_Syncytin-1_and_its_receptor_is_present_in_human_gametes

https://healthandmoneynews.wordpress.com/2020/12/02/head-of-pfizer-research-covid-vaccine-is-female-sterilization/

Contrairement aux trolls qui prétendent que l’ARN ne peut pas modifier notre génome car est dans le cytoplasme de la cellule, ils oublient que certains virus possèdent une enzyme appelés transcriptase inverse qui permet de transcrire de l’ARN à l’ADN, et donc de modifier l’ADN à partir de l’ARN
https://fr.wikipedia.org/wiki/Transcriptase_inverse

 

or le covid qui est un virus manipulé en laboratoire https://fort-russ.com/2020/05/major-researchers-uncover-new-evidence-showing-covid-19-was-lab-created/, possède des fragments du VIH selon Le prof luc Montaigner qui l’a étudié
https://youtu.be/Vx91DZTjNTI

 

or le VIH possède dans son génome l’enzyme transcriptase inverse
https://en.wikipedia.org/wiki/Reverse-transcriptase_inhibitor#Non-nucleoside_reverse-transcriptase_inhibitor

 

ainsi donc les vaccins à ARN pourront modifier notre génome mais rassurez vous, les virus à ARN seuls sans vaccins ne peuvent pas modifier votre génome
la raison est que les enzymes de nos corps ainsi que nos anticorps détruisent tout ARN étranger venant de l’extérieur
c’est la raison pour laquelle pour protéger leur ARN de virus, ils l’engloberont de nanoparticules lipides, afin que le corps l’identifie comme lui appartenant et ne l’attaque pas, et le laisse entrer dans ses cellules pour faire de la modification génétique à partir de la transcription inverse une fois que l’ARN sera dans le cytoplasme de la cellule, donc le vaccin à ARN modifiera le génome à partir de la transcriptase inverse (de l’ARN à l’ADN)
la transcriptase normal tout court dont parlent les trolls c’est de l’ADN à l’ARN, mais vu que le covid contient la fonction transcriptase inverse, leur théorie bidon que les vaccins à ARN ne peuvent pas modifier le génome ne fonctionnera pas
la preuve les fabricants de vaccins sont obligés d’englober leur précieux virus RNA (the mRNA) modifié de nanoparticules lipidiques (lipid nanoparticles), car sinon les enzymes secrétés par les mucus du nez, la salive, les muqueuses de l’estomac, et autres émetteurs d’enzymes présents partout dans le corps, anticorps tueraient leur précieux RNA virus modifié
citations:
« lipid nanoparticles can be synthesized with relative ease in a scalable manner, protect the mRNA against degradation, facilitate endosomal escape, can be targeted to the desired cell type by surface decoration with ligands, and as needed, can be codelivered with adjuvants.
https://pubmed.ncbi.nlm.nih.gov/27075952/

As mRNA molecules are vulnerable to ribonuclease enzymes that widely exist in the biological systems and highly negatively charged, which compromise their internalization through cell membranes, suitable in vivo mRNA delivery systems are urgently needed (4). To protect and deliver mRNA, extensive efforts have been devoted to construct biocompatible carriers, such as LNPs, polymeric nanoparticles, peptides/protein-mRNA complexes, and other types of biomaterials (9, 22, 23). Among these reported platforms, lipid-like nanoparticles (LLNs) are one of the representative materials that have been extensively used for mRNAs delivery

https://advances.sciencemag.org/content/6/34/eabc2315.full

 

RNA molecules are also fragile molecules, easily degraded in the body https://www.pharmaceutical-journal.com/news-and-analysis/features/rna-interference-therapies-could-be-on-the-cusp-of-success/20204853.article?firstPass=false

le virus est composé d’un ARN, donc est facile à dégrader par le corps

il ne peut être protégé de la destruction du corps que si il est protégé et encapsulé à l’intérieur de nanoparticules biocompatibles dans le corps humain via le vaccin

Nanoparticle-based delivery systems protect RNA molecules from enzymatic degradation and immune system attacks https://www.biosyn.com/tew/Nanocarriers-for-RNA-delivery.aspx#!

la famine programmée par le gouvernement par les confinements meurtriers (morts de la faim à cause du chômage à cause de la fermeture des commerces non essentiels pour permettre à Amazon qui fraude sur la TVA de se remplir les pocheshttp://www.cielvoile.fr/2020/12/fraude-massive-a-la-tva-sur-les-places-de-marche-des-acteurs-du-e-commerce.html )http://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html,  future loi finance 2021https://strategika.fr/2020/12/04/appel-aux-francais-faites-pression-sur-vos-elus-afin-quils-sopposent-au-vote-de-la-prochaine-loi-de-finances-pour-2021/ et les compteurs linkyhttps://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/   en revanche fait réduire la production d’enzymes pouvant détruire les virus d’où le fait que dans l’histoire de l’humanité, les épidémies n’ont lieu uniquement que dans les périodes de famines, et disparaissent automatiquement avec la fin de celles ci
https://fr.wikipedia.org/wiki/Liste_de_famines

 

d’où le fait qu’ils font tout pour accroitre la crise économique avec les confinementshttp://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/  , fermeture des commerces non essentiels mettant en chomage des millions de personnes
les masques assèchent la bouche, donc réduction de la salive qui contient des enzymes tuant les virus

le Ribonucléase Rnase ennemi mortel du covid (RNA) et présent naturellement dans tout le corps humain
https://en.wikipedia.org/wiki/Ribonuclease

les vaccinateurs veulent nous imposer le covid à travers le vaccin obligatoire, en protégeant leur précieux virus à l’intérieur de nanoparticules lipidiques pour l’empêcher d’être détruits par nos méchants enzymes et méchants anticorps

La stérilité causé par les vaccinés sera-t-elle imputée au Covid19 ? Regardez ces liens ou faites votre propre recherche.

https://www.nationalheraldindia.com/health/coronavirus-can-cause-male-infertility-study

https://www.thailandmedical.news/news/breaking-male-infertility-research-shows-that-sars-cov-2-coronavirus-may-indirectly-cause-testicular-damage-in-male-covid-19-patients-and-also-orchiti

https://www.forbes.com/sites/victoriaforster/2020/11/15/covid-19-compromises-sperm-count-and-quality-in-recovering-patients/

https://www.urotoday.com/recent-abstracts/men-s-health/male-infertility/124144-male-fertility-and-the-covid-19-pandemic-systematic-review-of-the-literature-beyond-the-abstract.html

https://journals.physiology.org/doi/full/10.1152/ajpendo.00183.2020

https://www.bionews.org.uk/page_152485

https://healthandmoneynews.wordpress.com/2020/12/03/oxford-designer-of-covid-vaccine-admits-vaccine-will-only-sterilize-70-per-cent-of-the-population/

Les tests PCR sont bidons et à 90% d’asymptomatiques, leur objectif c’est de stériliser la jeunesse fertile via la vaccination

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

Autre preuve que le covid est bidon:
en l’année 2020 du covid 2019, la population mondiale augmente, donc aucun risque qu’un virus puisse faire que l’espèce humaine disparaisse, la vie continue normalement comme des millénaires avant
https://www.worldometers.info/fr/

Evidemment le gouvernement enrage que le virus covid n’arrive pas à dépeupler les gueux et ne les stérilise pas et ne leur fait aucun symptôme du tout, donc il a fait pondre la loi pour avorter les bébés à 9 mois dans le ventre et une autre loi pour euthanasier les vieux, et une autre loi pour baillonner tout le monde pour empêcher tout le monde de respirer, et une loi pour autoriser le glyphosate de Monsanto

https://www.ouest-france.fr/environnement/glyphosate/glyphosate-l-assemblee-refuse-d-inscrire-l-interdiction-de-l-herbicide-dans-la-loi-5789451

alors qu’on sait que les pesticides tout comme les autres polluants chimiques abiment les poumons donc entravent la respiration

https://observatoire-des-aliments.fr/sante/pesticides-et-problemes-respiratoires-chez-les-enfants
https://www.lefigaro.fr/vox/societe/img-jusqu-au-9e-mois-pour-detresse-psychosociale-le-danger-d-un-motif-imprecis-20200812

preuve que le covid n’a aucun impact sur la fertilité et n’empêche pas la naissance de bébés en excellente santé

https://indianexpress.com/article/cities/chandigarh/covid-positive-woman-delivers-healthy-baby-6552509/

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

En plus vu que la population mondiale augmente, on voit que le covid n’a aucun impact sur la fertilité des hommes et des femmes, que s’il y a une épidémie de gens stériles après, ce sera bien causé par la vaccination…

Mais ils feront croire que la stérilisation est causé par le covid pour pousser les gens à se vacciner, et bien sur, ils feront passer leurs exemples d’individus stériles à cause de la vaccination comme des gens qui n’ont jamais été vaccinés pour faire croire à leurs mensonges

Alors ne vous vaccinez pas, tant que les labos n’ont pas fait de garanties écrites et sont prêts à être responsables judiciairement si leurs vaccins causent un impact sur la fertilité et toute autre déraillement de la santé par effets secondaires mortifères !

Tests PCR sinon bidons du moins bien peu fiable en contexte clinique et dépistage thérapeutique

https://resistance71.wordpress.com/2020/12/10/cov19-test-pcr-et-falsification-des-chiffres-le-test-rt-pcr-ne-devrait-pas-etre-utilise-a-fins-therapeutiques-il-nest-quun-outil-de-fabrique-comme-concu-par-son-inventeur-kary-mullis/

https://resistance71.wordpress.com/2020/10/16/voix-de-la-raison-cov19-et-tests-rt-pcr-comprendre-le-comment-de-lenfumage-general-permettant-de-maintenir-un-etat-de-terreur-accepte-du-plus-grand-nombre-et-de-dire-non-a-la-dictature-sanitair/

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

= = =

A lire notre page « Coronavirus, guerre biologique contre l’humanité »