Archive pour coronavirus manipulation génétique

Les virus mutent… les confinements sont prévus pour durer ad vitam aeternam… Si nous les laissons faire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 19 janvier 2021 by Résistance 71

 

 


Le Pinocchiorona-21…22…23…24…25…26…27…x+1

 

« Des chercheurs qui cherchent on en trouve, mais des chercheurs qui trouvent, on en cherche ! »
~ Coluche ~

 

Les histoires de “mutations” de la COVID19 montrent que les confinements sont prévus pour durer éternellement

 

Brandon Smith

 

Décembre 2020

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-histoires-de-mutations-de-la-covid-19-montrent-que-les-confinements-sont-concus-pour-durer-eternellement

 

Depuis de nombreux mois maintenant, j’avertis que la conception des mesures de confinement de la pandémie est perpétuelle, ce qui signifie que les mesures de confinement sont censées durer éternellement. Nous pouvons le constater dans les commentaires des élites de l’establishment qui font pression pour obtenir ces contraintes ; leur argument le plus fréquent étant que les restrictions liées à la pandémie sont la « nouvelle normalité ». Cette affirmation est soulignée par des globalistes comme Gideon Lichfield du MIT dans son article « On ne va pas revenir à la normale« .

Dans cet article, il déclare :

En fin de compte, cependant, je prédis que nous allons rétablir la capacité de socialiser en toute sécurité en développant des moyens plus sophistiqués pour identifier qui est à risque de maladie et qui ne l’est pas, et en discriminant – légalement – ceux qui le sont.

… on peut imaginer un monde dans lequel, pour prendre un vol, il faudra peut-être être inscrit à un service qui suit vos déplacements via votre téléphone. La compagnie aérienne ne pourrait pas voir où vous êtes allé, mais elle recevrait une alerte si vous avez été à proximité de personnes infectées connues ou de points chauds de la maladie. Les mêmes exigences s’appliquent à l’entrée des grandes salles de spectacles, des bâtiments gouvernementaux ou des centres de transport public. Il y aurait des scanners de température partout, et votre lieu de travail pourrait exiger que vous portiez un moniteur qui surveille votre température ou d’autres signes vitaux. Si les boîtes de nuit demandent une preuve d’âge, elles pourraient à l’avenir exiger une preuve d’immunité – une carte d’identité ou une sorte de vérification numérique via votre téléphone, montrant que vous vous êtes déjà remis ou que vous avez été vacciné contre les dernières souches de virus.

Dans mon article « Vagues de mutilation : La tyrannie médicale et la société sans cash« , j’ai démantelé les arguments de Lichfield et expliqué pourquoi les contrôles que l’establishment tente de mettre en place ont été planifiés longtemps à l’avance. Le « grand reset » et la « quatrième révolution industrielle » sont en cours de développement depuis au moins 2014, date à laquelle ces termes ont été injectés pour la première fois dans les principaux médias économiques. Les idées de société sans cash, d’« économie de partage », de surveillance biométrique des masses, de scores de crédit social, etc. font toutes partie du programme globaliste depuis des décennies. Le coronavirus n’est pour eux qu’une crise utile à exploiter pour justifier les mesures draconiennes qu’ils ont toujours voulues.

Le plan était si prévisible que j’ai même souligné, au début de l’épidémie de coronavirus, que les confinements ne prendraient pas fin même si une vaccination efficace était mise au point, car il leur suffirait de déclarer qu’une « nouvelle mutation » du virus résistante aux traitements existants a été trouvée. Ou bien, ils pourraient concevoir un tout nouveau virus et le diffuser dans la population afin de maintenir la machine à reset en marche.

Il n’est pas surprenant qu’au moment où la nouvelle a été diffusée que les vaccins Pfizer et Moderna, à peine testés et très suspects, étaient mis à la disposition du public, des rapports ont commencé à faire état de mutations du coronavirus, « plus infectieuses« , trouvées dans des endroits comme le Royaume-Uni, l’Inde et l’Afrique du Sud.

Je ne suis pas sûr que les élites puissent être plus transparentes.

Prenez le vaccin Pfizer maintenant et vous pourriez recevoir un passeport d’immunité pendant quelques mois, puis il sera annulé à chaque nouvelle mutation du virus. Vous devez donc vous soumettre à des vaccinations sans fin, dont beaucoup n’ont pas encore été testées et sont potentiellement dangereuses. Comme l’ancien vice-président de Pfizer et d’autres professionnels de la santé l’ont mis en garde, ces vaccins sont comme la roulette russe et pourraient provoquer une réaction auto-immune qui conduirait à la stérilité ou à d’autres réactions nocives.

Les vaccins eux-mêmes sont une solution à court terme, même s’ils sont efficaces. Ils nécessitent plusieurs doses au cours d’un mois, et les vaccinations doivent être renouvelées éventuellement tous les quelques mois. Fondamentalement, cela ne s’arrête jamais. Avec les mutations et les anticorps limités des vaccins, les élites pourraient maintenir les confinements et les contraintes en place pendant de nombreuses années.

L’Organisation Mondiale de la Santé indique clairement que la vaccination ne sera pas nécessairement considérée comme une solution à la propagation du virus. Cela signifie que même si vous êtes vacciné, vous serez toujours considéré comme un porteur et un transmetteur potentiel de la Covid-19, ce qui signifie que les mesures de confinement et les obligations de port de masques ne cesseront pas. Cela soulève la question suivante : quel est l’intérêt du vaccin ?

Le responsable scientifique de l’OMS cite le fait qu’il n’y a pas suffisamment de preuves pour établir que les vaccins empêchent la transmission. Selon cette logique, nous pourrions également soutenir qu’il n’y a pas de preuve que les vaccins sont efficaces à 95%, ou qu’ils sont sûrs à tout le moins.

En attendant, l’OMS et notre sympathique voisin fasciste, le Dr Anthony Fauci, répandent constamment l’histoire selon laquelle la « pire épidémie«  est encore à venir. Il faut que ce train de la peur continue à avancer sur la voie du « Grand Reset », n’est-ce pas ?

Pour les personnes qui croient réellement que la crise de la pandémie de Covid-19 prendra fin après les vaccinations de masse, je suis désolé de le dire, mais vous avez été dupés. Chaque élément de la réponse de l’establishment et chaque déclaration publique qu’ils font indique qu’ils prévoient de violer vos libertés civiles pendant longtemps. Ces promesses d’aide au coin de la rue ? Des mensonges. L’affirmation selon laquelle si vous suivez leur programme, tout reviendra à la normale ? C’est une arnaque. C’est une rhétorique creuse conçue pour vous faire taire et vous soumettre à la tyrannie médicale juste assez longtemps pour que cela devienne irréversible.

Je soupçonne qu’ils espèrent pouvoir conditionner le public au cours des prochaines années à s’adapter simplement aux contrôles jusqu’à ce que nous oubliions ce qu’était la vie avant la pandémie et le reset. Il semble cependant que le plan de reset des globalistes ne se déroule pas très bien.

Les vaccins et les nouvelles sur les mutations semblent précipités, c’est le moins qu’on puisse dire. Au départ, l’establishment a déclaré qu’il faudrait au moins 18 mois rien que pour mettre au point un vaccin à des fins d’essais et de tests, et que les confinements se poursuivraient bien au-delà de ce délai jusqu’à ce qu’une majorité de la population soit immunisée. Au lieu de cela, ils ont lancé plusieurs vaccins en six mois et le récit de la mutation fait déjà la une des journaux.

Je pense que cela est dû au fait que la résistance aux mesures de confinement face à la pandémie s’accroît et que le nombre de personnes refusant de se faire vacciner semble élevé. Comme on le dit, la révolution ne sera pas télévisée, mais il est encore impossible de la cacher complètement.

En Europe, un pourcentage énorme de la population (environ 50 % ou plus selon les pays) hésite à se faire vacciner. Aux États-Unis, les sondages montrent qu’au moins 30 % de la population refusera catégoriquement, tandis que 60 % des gens hésiteront selon l’efficacité du vaccin.

Même un grand nombre d’agents de santé refusent le vaccin, et ce sont ces personnes qui subissent le plus de pression pour se soumettre ou faire face aux conséquences.

Hilarant, les médias affirment que bien qu’il y ait eu « quelques réactions allergiques » au vaccin, il n’y a « aucune preuve d’effets secondaires graves à long terme ». Peut-être est-ce parce qu’il n’y a aucune étude des effets à long terme et qu’il y a eu un minimum d’essais avant que les vaccins ne soient mis sur le marché ? N’est-ce pas là une logique de base ? Pensent-ils vraiment que nous sommes aussi stupides ?

Jusqu’à présent, il semble que des centaines de millions de personnes ne soient pas aussi bêtes. Étonnamment, même des shérifs et des policiers dans tout le pays refusent ouvertement d’appliquer les mandats et d’infliger des sanctions au nom de la loi aux citoyens qui ne se soumettent pas. C’est vraiment un énorme obstacle pour les globalistes et leur reset.

Le virus a produit un IFR (Taux de létalité) de 0,26% chez toute personne ne se trouvant pas dans une maison de retraite avec des conditions préexistantes. Plus de 40 % des décès dus au Covid sont attribués à des personnes âgées qui souffraient déjà de nombreuses affections. Seulement 10 % environ des personnes qui finissent par être hospitalisées à cause de la Covid-19 souffrent de problèmes de santé à long terme (plus de trois mois). De plus, seuls 15 % environ des lits de soins intensifs sont utilisés aux États-Unis, ce qui signifie que les allégations de surcapacité et d’hôpitaux pleins n’étaient rien de plus que de la peur pour susciter des craintes, depuis le début.

Considérez le fait que des centaines de milliers de personnes meurent déjà chaque année de maladies infectieuses comme la grippe et la pneumonie et la Covid-19 commence à sembler beaucoup moins menaçant. Ce n’est certainement pas une excuse pour les confinements médicaux et les mesures orwelliennes de recherche des contacts.

En outre, de nombreuses études révèlent que les mesures de confinement et les masques sont totalement inefficaces pour arrêter la propagation du virus. Les États et les pays dont les contraintes sont parmi les plus strictement appliqués ont également tendance à être les endroits où les pics d’infection sont les plus élevés.

C’est pourquoi il est logique que de nombreuses personnes refusent de se conformer à ces contraintes. Les médias prétendent que nous sommes des théoriciens de la conspiration qui croient que le virus « n’existe pas » ; ce n’est pas le cas. En fait, je soupçonne depuis longtemps que le récit selon lequel le virus « n’existe pas » était une psy-op ou un homme de paille qui serait utilisé contre le mouvement de la liberté plus tard pour discréditer notre résistance aux confinements médicaux.

La plupart d’entre nous sont bien conscients de l’existence du virus. Certains d’entre nous l’ont déjà combattu et s’en sont remis. Ce que nous disons, c’est que le CDC, l’OMS et les propres statistiques de la communauté médicale montrent que la Covid-19 n’est pas une menace pour plus de 99% de la population. Si nous devons accepter leurs statistiques comme étant même très peu précises, alors la Covid-19 devient un non-problème pour la plupart des gens.

Une fois de plus, je poserai la question que les médias dominant refusent de poser :

Pourquoi dit-on à 99 % de la population qu’elle doit sacrifier son emploi, ses entreprises et ses libertés au nom de la sécurité de moins de 1 % de la population ? Pourquoi ne pas demander aux 0,26% de personnes menacées par le virus de se porter volontaires pour rester chez elles afin que le reste d’entre nous puisse reprendre une vie normale ? Pourquoi faisons-nous le contraire de ce qui est le plus logique ?

La réponse est que la réponse à la pandémie est une question de domination, et non de santé publique. Les gens commencent à s’en rendre compte et ils sont sur le point de se révolter.

Donc, la prochaine étape logique pour l’establishment, s’il veut vraiment mettre en place son programme de reset, est d’introduire une nouvelle menace. Cela signifie qu’ils ont besoin d’une « mutation » du virus ou d’un tout nouveau virus afin de créer le genre de peur nécessaire pour manipuler le public et l’amener à accepter un contrôle plus poussé.

Un nouveau virus plus mortel sera-t-il découvert ? Peut-être. Dans la plupart des cas, les virus ont tendance à évoluer vers des souches moins mortelles que l’original. Ils ont également tendance à équilibrer leur taux de propagation et leur taux de mortalité. En d’autres termes, comme toute autre créature, les virus évoluent pour survivre, et un virus ne peut pas survivre s’il tue la majorité de ses hôtes potentiels. Ainsi, ils mutent pour devenir plus infectieux, mais invariablement moins mortels.

Si une « mutation » plus mortelle que la forme actuelle de la Covid-19 apparaît sur la scène, je serais très méfiant quant à ses origines. Le plus probable est que les élites sont en panique et qu’elles utilisent le récit de la mutation comme un outil de propagande pour semer la terreur et le conformisme dans le public. Il se peut qu’il n’y ait pas de mutation du tout, ou que les mutations n’aient aucune incidence significative sur le taux de mortalité.

Ironiquement, en lançant à la hâte les vaccins et les histoires de mutation, les élites se sont sabotées elles-mêmes. Elles ont voulu faire un blitzkrieg du public avec les confinements et elles ont rencontré une résistance plus forte que prévu. Ils ont donc mis le programme de vaccination sur un train fou et maintenant le public se méfie de se faire injecter un modèle de vaccin à peine testé. Maintenant, ils font la promotion du croque-mitaine de la mutation et cela ne fait que faire se demander pourquoi les gens devraient prendre n’importe quel vaccin ? Si le virus va continuellement muter, alors pourquoi prendre un vaccin douteux qui pourrait être inutile en quelques mois ?

Le récit de la mutation ne fait qu’exposer davantage ce qui est vraiment à l’ordre du jour : ce que les élites veulent, c’est un enfermement sans fin. Il n’y a pas de programme pour sauver des vies ou aplatir la courbe. Tout l’argument de la santé est une absurdité totale. Rien de ce qui a été fait jusqu’à présent ne soutient l’idée que la santé publique est la priorité. Au lieu de cela, nous assistons à une course folle vers le totalitarisme en utilisant la Covid-19 comme excuse, et l’effort échoue.

= = =

Voir notre page « Coronavirus, guerre contre l’humanité »

 

Un an… Ce que l’on sait du SRAS-CoV2 et de la « pandémie » COVID-19 associée : une mise à jour des données récentes (Denis Rancourt)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , on 12 janvier 2021 by Résistance 71

 

Une remarquable synthèse de Denis Rancourt sur ce qu’on sait aujourd’hui SCIENTIFIQUEMENT sur le SRAS-CoV-2 et la « pandémie » COVID-19 associée. A lire et diffuser au plus grand large et sans aucune modération.
Nous devons stopper cette imposture avant qu’elle ne nous enferme dans sa dictature technotronique eugéniste programmée.
~ Résistance 71 ~

 

 

Mise à jour des données récentes concernant la politique COVID-19

Les mesures de confinement n’empêchent pas les décès, la transmission ne se fait pas par contact, les masques n’apportent aucun bénéfice, les vaccins sont intrinsèquement dangereux.

 

Denis Rancourt

 

28 décembre 2020

 

Source Research Gate

 

url de l’article en français :
https://lesakerfrancophone.fr/mise-a-jour-des-donnees-scientifiques-recentes-concernant-la-politique-covid-19#fn-98503-18

Le texte en PDF :
Denis_Rancourt_Mise_a_jour_des_donnees_de_ce_quon_sait_sur_le_SRAS-CoV-2

Les mesures sans précédent de confinement universel, de confinement institutionnel strict des maisons de soins, de masquage universel de la population, d’obsession hygiénique des surfaces et des mains et de déploiement accéléré des vaccins sont contraires à la science connue et aux récentes études de référence. Le gouvernement a fait preuve d’imprudence par action et de négligence par omission. Des mesures institutionnelles sont nécessaires depuis longtemps pour endiguer la corruption dans le domaine de la médecine et de la politique de santé publique.

Introduction – Pandémie iatrogène de panique

Le contexte politico-sanitaire est un contexte dans lequel, jusqu’en 2019, le consensus scientifique et politique passé en revue était que les mesures globales généralement et universellement appliquées en 2020 étaient 1 2 :

  • non recommandées sans être justifiées par des preuves quantitatives suffisantes des circonstances épidémiologiques locales (juridictionnelles) (transmissibilité, gravité de la maladie, impact), et sans être mises en balance avec les préjudices économiques, sanitaires et sociaux locaux qui en résultent
  • pour de nombreuses mesures (recherche des contacts, mise en quarantaine des personnes exposées, contrôle des entrées et des sorties, fermeture des frontières), « non recommandé en aucune circonstance », quelle que soit la gravité de la maladie respiratoire virale pandémique (modérée, élevée ou extraordinaire)

Le contexte politico-sanitaire est également un contexte dans lequel il existe une histoire récente documentée de « paniques répétées de pandémie de santé » dans laquelle « les experts en maladies souhaitent attirer l’attention du public et faire pencher les décisions d’allocation de ressources en faveur de la maladie qui les intéresse ». 3. Bonneux et Van Damme, en 2011, l’ont exprimé ainsi 4 :

“Les paniques répétées de pandémie de santé causées par un virus aviaire H5N1 et un nouveau virus de grippe humaine A(H1N1) font partie de la culture de la peur [réf.] Le pire des scénarios a remplacé l’évaluation équilibrée des risques. Le pire des scénarios est motivé par la conviction que le danger auquel nous sommes confrontés est tellement catastrophique que nous devons agir immédiatement. Plutôt que d’attendre des informations, nous avons besoin d’une frappe préventive. Mais si les ressources achètent des vies, le gaspillage des ressources gaspille des vies. Le stockage préventif d’antiviraux largement inutiles et les politiques irrationnelles de vaccination contre un virus H1N1 exceptionnellement bénin ont gaspillé plusieurs milliards d’euros et érodé la confiance du public dans les responsables de la santé. [réf.] La politique de lutte contre la pandémie n’a jamais été guidée par des preuves, mais par la crainte des pires scénarios.”

En outre, un important scandale de conflit d’intérêts concernant les recommandations de l’OMS en matière de pandémie de grippe a été exposé en détail en 2010, où les enquêteurs Cohen et Carter ont conclu : « Parmi les principaux scientifiques qui conseillent l’Organisation mondiale de la santé sur la planification d’une pandémie de grippe, certains ont fait un travail rémunéré pour les entreprises pharmaceutiques qui ont tout à gagner des conseils qu’ils ont rédigés. Ces conflits d’intérêts n’ont jamais été rendus publics par l’OMS ». 5

En 2020, rien de tout cela n’avait d’importance. Nous sommes entrés dans un monde de propagande, avec des institutions captives. Le principe de précaution (le gouvernement doit prouver l’absence probable de dommages avant d’imposer des politiques dangereuses) a été renversé, et la charge de la preuve a été imposée à la science pour justifier a posteriori des mesures sans précédent, rapidement imposées en l’absence de science ou même en s’opposant à elle. Malheureusement, une grande partie ou la plupart de l’establishment scientifique s’est conformé au nouveau programme.

Récemment, il y a eu à la fois des événements dramatiques (lancement du vaccin) et des communications scientifiques importantes, depuis que j’ai publié mes deux premiers articles scientifiques concernant la politique autour de la COVID-19, le 11 avril 2020 6 et le 3 août 2020 7, ainsi que des articles sur les préjudices mortels des réponses gouvernementales, déduits des données sur la mortalité toutes causes confondues, dépendantes du temps et de la juridiction 8 9.

Mes deux premières analyses ont porté sur la science et la politique des masques 10 11. La présente mise à jour des développements récents porte à nouveau sur les masques, et comprend en outre des points clés sur les mesures de confinement et les vaccins.

La rigueur des mesures n’a aucun effet sur le nombre total de décès attribués à la COVID-19

Deux grandes études récentes ont été menées à l’échelle mondiale.

Dans leur article du 21 juillet 2020 intitulé « Une analyse au niveau national mesurant l’impact des actions gouvernementales, de l’état de préparation du pays et des facteurs socio-économiques sur la mortalité de la COVID-19 et les résultats sanitaires associés » (50 pays), Chaudhry et al. ont indiqué 12 :

“La fermeture rapide des frontières, le confinement total et les tests à grande échelle n’ont pas été associés à la mortalité de la COVID-19 par million de personnes. (Résumé / Résultats)

Lorsque la mortalité de la COVID-19 a été évaluée, les variables significativement associées à une augmentation du taux de mortalité par million étaient la prévalence de l’obésité dans la population et le PIB par habitant. En revanche, les variables qui étaient négativement associées à une augmentation de la mortalité de la COVID-19 étaient la réduction de la dispersion des revenus au sein de la nation, la prévalence du tabagisme et le nombre d’infirmières par million d’habitants. En effet, un plus grand nombre d’infirmières dans un système de soins de santé donné était associé à une réduction de la mortalité. Les taux de mortalité étaient également plus élevés dans les comtés dont la population était plus âgée […]. Enfin, les mesures gouvernementales telles que la fermeture des frontières, le confinement total et un taux élevé de tests COVID-19 n’ont pas été associées à des réductions statistiquement significatives du nombre de cas critiques ou de la mortalité globale. (Section 3.4)”

Dans leur article du 19 novembre 2020 « Mortalité du fait de la COVID-19 : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées » (160 pays), De Larochelambert et al. ont trouvé 13 :

“Résultats : Des taux de mortalité plus élevés sont observés dans les zones de latitude [25/65°] et de longitude [-35/-125°]. Les critères nationaux les plus associés au taux de mortalité sont l’espérance de vie et son ralentissement, le contexte de santé publique (fardeau des maladies métaboliques et non transmissibles (MNT) par rapport à la prévalence des maladies infectieuses), l’économie (produit national de croissance, soutien financier) et l’environnement (température, indice ultra-violet). La rigueur des mesures mises en place pour lutter contre la pandémie, y compris le confinement, ne semble pas être liée au taux de mortalité.

Conclusion : Les pays qui ont déjà connu une stagnation ou une régression de l’espérance de vie, avec des revenus et des taux de mortalité élevés, ont eu le plus lourd tribut à payer. Ce fardeau n’a pas été allégé par des décisions publiques plus strictes. Des facteurs inhérents ont prédéterminé la mortalité de la Covid-19 : leur compréhension peut améliorer les stratégies de prévention en augmentant la résilience de la population grâce à une meilleure condition physique et une meilleure immunité. (Résumé)”

L’American Institute for Economic Research (AIER Staff) a passé en revue ces études et 22 autres études qui aboutissent à des conclusions similaires, dans son rapport du 19 décembre 2020 intitulé « Les confinements ne contrôlent pas le coronavirus : Les preuves » 14.

Par conséquent, dans l’ensemble, le nombre total de cas critiques et le nombre total de décès étaient associés à l’état de santé préexistant et à l’état sociétal de la population, et cela n’a pas été amélioré par les mesures gouvernementales visant à ralentir la transmission.

Il est important de noter qu’en plus des études sur les associations avec la mortalité totale, la dépendance temporelle et la granularité (dépendance juridictionnelle) de la mortalité toutes causes confondues montrent que la déclaration de pandémie de l’OMS du 11 mars 2020 et la recommandation universelle de « préparer vos hôpitaux » ont été suivies d’un grand nombre de décès, probablement induits par les infections et le confinement strict des maisons de soins non ventilées pour les personnes malades et âgées 15 16.

La pandémie iatrogène de propagande en terme de psychologie de masse et la sociologie autour de la COVID-19 de 2020 commencent à être étudiées par des méthodes quantitatives 17.

La corruption de la science est mise à nue – Masques et PCR

Un aspect positif de ce que l’on peut appeler la « pandémie de propagande » actuelle est que la corruption systémique généralisée de l’establishment scientifique est exposée, non seulement par des rétractations très médiatisées d’articles publiés dans des revues de premier plan, mais aussi par des éditoriaux critiques. Par exemple, le 13 novembre 2020, le rédacteur exécutif Kamran Abbasi l’a exprimé en termes très clairs dans les pages de l’éminent BMJ 18 :

“La science est supprimée pour des raisons politiques et financières. La Covid-19 a déclenché une corruption de l’État à grande échelle, et elle est nuisible à la santé publique. [réf] Les politiciens et l’industrie sont responsables de ce détournement opportuniste. Les scientifiques et les experts de la santé le sont également. La pandémie a révélé comment le complexe politico-médical peut être manipulé en cas d’urgence, à un moment où il est encore plus important de sauvegarder la science.”

J’en donne trois exemples.

Premièrement, le biais systémique est palpable dans une mini-saga récente sur les masques, publiée dans les pages du New England Journal of Medicine 19 20 21.

Gandhi et Rutherford ont écrit un article intitulé « Perspective », publié le 29 octobre 2020 22. Les auteurs avancent l’idée extraordinaire que se masquer réduit la gravité de la maladie chez les personnes infectées. Ils commencent par l’affirmation propagandiste selon laquelle le masquage facial universel est « l’un des piliers de la lutte contre la pandémie de Covid-19 ». Ils poursuivent en avançant l’argument fantastique suivant : les masques peuvent réduire l’inoculum viral et donc provoquer des infections asymptomatiques dans lesquelles le sujet développe une immunité. Cela a alarmé les répondants car le mécanisme proposé est ce que l’on pourrait appeler « l’immunité acquise naturellement grâce aux masques ». Admettre tout type d’immunité naturelle, qui est une dure réalité de la biologie de l’évolution, est devenu sacrilège.

Deux groupes de chercheurs ont publié des réfutations contre Gandhi et Rutherford, dans la même revue.

Rasmussen et al. ont écrit 23 :

“Il n’y a pas suffisamment de preuves pour soutenir l’affirmation selon laquelle les masques réduisent la dose infectieuse du SRAS-CoV-2 et la gravité de la Covid-19, et encore moins que leur utilisation peut induire une immunité protectrice. […] La suggestion que les masques offrent une alternative à la vaccination sans preuve que les bénéfices l’emportent sur les grands risques encourage implicitement les comportements irresponsables.”

Brosseau et al. ont, pour leur part, réajusté diplomatiquement les vues exposées par Gandhi et Rutherford en ramenant les lecteurs à la science et à la réalité établies 24 :

“La réplication virale est liée à la dose, mais la gravité de la maladie ne l’est pas. L’épidémiologie indique que l’apparition de formes graves de Covid-19 est associée à des conditions préexistantes et à d’autres facteurs de risque, tels que l’âge, le sexe et la grossesse [réf].

Bien qu’elle n’ait pas encore été démontrée dans des modèles expérimentaux, la dose infectieuse du SRAS-CoV-2 est probablement similaire à celle du SRAS-CoV – environ 300 virions [réf]. Quelle que soit la gravité de la maladie, les gens présentent des charges virales élevées et un virus infectieux pendant au moins 8 jours après l’apparition des symptômes. La parole normale peut générer jusqu’à 3000 particules de 1 micron par minute dans l’air expiré, [ref] et chaque particule pourrait contenir plus de 250 virions, ce qui signifie qu’une seule minute de parole génère potentiellement plus de 750 000 virions. Les revêtements de visage en tissu ont une efficacité très variable en fonction de la capacité de filtrage et de l’ajustement. Le port d’un couvre-visage en tissu à proximité d’une personne infectée pendant plusieurs minutes peut ne pas empêcher la réception d’une dose infectieuse, qui, comme indiqué ci-dessus, n’est pas corrélée à une maladie moins grave.”

Les auteurs de l’article original n’ont pas été dissuadés et ont répondu :

« Plus de preuves s’accumulent pour supporter cette idée » et « il y a de plus en plus de preuves à la fois physiques et d’enquêtes épidémiologiques que les masques en tissu (s’ils sont portés correctement) réduisent à la fois la transmission et l’acquisition » 25 L’examen de leurs sources montre que les auteurs ont une vision généreuse de ce qui peut constituer une « preuve » à l’appui. Voir également 26, concernant la tournure que prend l’« accumulation de preuves » dans le contexte politique des masques faciaux.

Deuxièmement, un exemple étonnant, toujours à propos des masques, est fourni dans les pages de Nature Medicine. Ici, l’équipe de prévision de la COVID-19 de l’IHME, le 23 octobre 2020 (« étude de l’IHME »), a déclaré que le port universel de masque serait d’une grande utilité aux États-Unis 27 :

“L’utilisation du port universel de masque pourrait sauver 129 574 (entre 85 284 – 170 867) vies supplémentaires entre le 22 septembre 2020 et la fin février 2021, ou 95 814 (entre 60 731 – 133 077) vies supplémentaires en supposant une adoption moindre du port du masque (85%), par rapport au scénario de référence. (Résumé)”

Si les masques offrent un avantage aussi important, il est impossible de comprendre comment aucun des nombreux grands essais contrôlés randomisés (ECR) dont les résultats sont vérifiés, n’a détecté cet avantage. Il est impossible d’obtenir les résultats négatifs souvent répétés dans les études ECR de qualité suffisante pour informer la politique sanitaire, si les prémisses et les conclusions de l’étude IHME sont correctes. L’étude de l’IHME a été réfutée avant même sa publication.

L’étude de l’IHME est fatalement défectueuse sur au moins deux points :

  1. La méta-régression utilisée pour estimer (« suggérer », selon leurs termes) que le port universel du masque permet une réduction de 40% et plus de la transmission est sans valeur, et est le fruit d’un biais constructif ;
  2. Ils ont utilisé des données incorrectes pour évaluer la conformité du masquage de la population américaine pour la période concernée.

Cette dernière faille fatale a été exposée par Magness, dans son rapport publié dans le Wall Street Journal, intitulé « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées » 28 :

“Malheureusement, les conclusions des modélisateurs de l’IHME contenaient une erreur que même un examen minimal aurait dû permettre de détecter. Le nombre prévu de vies sauvées et le cas implicite d’une obligation de port de masques sont basés sur une statistique erronée. En utilisant une enquête datant de plusieurs mois, les modélisateurs de l’IHME ont supposé à tort que le taux d’adoption de masques aux États-Unis ne s’élevait qu’à 49% à la fin du mois de septembre, et qu’il y avait donc une grande marge de manœuvre pour passer à une « adoption universelle », définie comme 95%, ou à un taux plus plausible de 85%. Cependant, selon les résultats d’une enquête plus récente, le taux d’adoption de masques aux États-Unis tourne autour de 80 % depuis l’été.”

Magness ne fait aucune mention de la prémisse fictive de l’étude de l’IHME selon laquelle le port universel de masques réduit la transmission de 40 % et plus.

Troisièmement, dans l’un des plus grands scandales de l’épisode COVID-19, un test d’amplification en chaîne par polymérase par transcription inverse (RT-PCR) a été mis au point à la hâte, dans des circonstances douteuses, qui n’est ni un diagnostic de la présence de virus infectieux, ni spécifique du SRAS-CoV-2, et déployé par les États pour la confirmation de l’infection chez les individus symptomatiques, et pour les tests de masse de la population générale asymptomatique.

Le dit test RT-PCR a été présenté ainsi par Corman et al. 29, et leur propre article indique :

“Nous avions pour objectif de développer et de déployer une méthodologie de diagnostic robuste à utiliser dans les laboratoires de santé publique sans disposer de matériel viral. […]

Dans toutes ces situations [toutes les applications passées de la RT-PCR pour « détecter les virus responsables des sécrétions respiratoires »], les isolats de virus étaient disponibles comme substrat principal pour établir et contrôler les tests et les performances des tests.

Dans le cas présent du 2019-nCoV, les isolats de virus ou les échantillons provenant de patients infectés ne sont pas encore disponibles pour la communauté internationale de la santé publique. Nous faisons ici rapport sur l’établissement et la validation d’un flux de diagnostics pour le dépistage et la confirmation spécifique du 2019-nCoV, conçu en l’absence d’isolats de virus disponibles ou d’échantillons originaux de patients. La conception et la validation ont été rendues possibles par l’étroite parenté génétique avec le CoV-SARS de 2003, et facilitées par l’utilisation de la technologie des acides nucléiques synthétiques. […]

Le présent rapport décrit la mise en place d’un processus de diagnostic pour la détection d’un virus émergent en l’absence de sources physiques d’acide nucléique génomique viral. La rapidité et l’efficacité de l’effort actuel de déploiement et d’évaluation ont été rendues possibles par les réseaux de recherche nationaux et européens mis en place en réponse aux crises sanitaires internationales de ces dernières années, ce qui démontre l’énorme capacité de réaction qui peut être dégagée par l’action coordonnée des laboratoires universitaires et publics [réf]. Cette capacité des laboratoires ne soutient pas seulement les interventions immédiates de santé publique, mais permet aux sites d’enrôler des patients lors de réponses rapides de recherche clinique.”

Un consortium international de scientifiques des sciences de la vie estime que l’article de Corman et al. présente des lacunes technologiques et méthodologiques fatales : Voir le rapport de Borger et al qui concluent, parmi plusieurs critiques, que 30 :

Il s’agit là de graves erreurs de conception, puisque le test ne peut pas faire la distinction entre le virus entier et les fragments de virus. Le test ne peut pas être utilisé comme un diagnostic pour les virus du SRAS.

En outre, l’absence du gène HE dans le CoV-1 et le CoV-2 du SRAS fait de ce gène le témoin négatif idéal pour exclure d’autres coronavirus. Le document de Corman-Drosten ne contient pas ce contrôle négatif, ni aucun autre contrôle négatif. Le test PCR du papier Corman-Drosten ne contient donc ni témoin positif unique ni témoin négatif permettant d’exclure la présence d’autres coronavirus. Il s’agit là d’un autre défaut de conception majeur qui classe le test comme inadapté au diagnostic.

Nous constatons de graves conflits d’intérêts pour au moins quatre auteurs, outre le fait que deux des auteurs de l’article de Corman-Drosten (Christian Drosten et Chantal Reusken) sont membres du comité de rédaction d’Eurosurveillance. Un conflit d’intérêt a été ajouté le 29 juillet 2020 (Olfert Landt est PDG de TIB-Molbiol ; Marco Kaiser est chercheur senior au GenExpress et est conseiller scientifique de TIB-Molbiol), qui n’était pas déclaré dans la version originale (et qui manque toujours dans la version PubMed) ; TIB-Molbiol est la société qui a été « la première » à produire des kits PCR (Light Mix) basés sur le protocole publié dans le manuscrit de Corman-Drosten, et selon leurs propres termes, ils ont distribué ces kits de test PCR avant même que la publication ne soit soumise à relecture [réf] ; de plus, Victor Corman & Christian Drosten ont omis de mentionner leur deuxième affiliation : le laboratoire de test commercial « Labor Berlin ». Tous deux sont responsables du diagnostic des virus dans ce laboratoire [réf.] et la société opère dans le domaine des tests PCR en temps réel.

À la lumière de notre réexamen du protocole de test pour identifier le CoV-2 du SRAS décrit dans le document de Corman-Drosten, nous avons identifié des erreurs et des failles inhérentes qui rendent le test PCR du SRAS-CoV-2 inutile.”

Bon nombre des critiques de Borger et al ont déjà été prouvées par des vérifications détaillées en laboratoire, comme le remarquable article de Singanayagam et al 31, qui utilise la RT-PCR avec le gène cible RdRp, qui montre (en particulier leur figure 3 A) :

  • L’importance du nombre de cycles de PCR (Ct), à la fois dans le compte rendu clinique et dans l’interprétation clinique
  • Qu’à l’exception des cas d’hospitalisation extrême (qui n’ont pas été étudiés), tous les cas positifs détectés avec la RT-PCR plus de 10 jours après l’apparition des symptômes ou l’exposition correspondaient à des virus non infectieux (fragments de virus morts) (aucun virus n’a pu être cultivé dans des cultures cellulaires optimales)
  • Qu’aucun délai n’a été observé pour la détection de ces virus non infectieux (fragments de virus morts), car ceux-ci ont été obtenus, avec une Ct=28-39, jusqu’à 60 jours après l’apparition des symptômes ou l’exposition.
  • Qu’à moins de 10 jours, avec un Ct=18-40, près de la moitié des « positifs » étaient des virus non infectieux (fragments de virus morts)
  • Un seuil opérationnel de Ct=30, au-delà duquel les « positifs » ont moins de 40% de probabilité (<8% à Ct>35) de correspondre à un virus viable, indépendamment du temps relatif à l’apparition des symptômes ou à l’exposition (leur figure 2)

De tels résultats concernant la fausse détection de virus présumés viables ont également été obtenus dans la grande étude plus récente de Jaafar et al. 32 qui ont utilisé l’amplification par RT-PCR du gène E que l’on pense être un peu moins spécifique du SRAS-CoV-2.

Il est clair que le test RT-PCR utilisé dans le monde entier est en soi sans valeur. Il produit de grandes quantités de « positifs » qui ne correspondent à aucun virus infectieux viable, qu’il s’agisse du SRAS-CoV-2 ou d’un autre. On n’y remédie que partiellement si les laboratoires se limitent à des Ct<30, sans parler du grand potentiel d’autres mauvaises pratiques de laboratoire sur le terrain.

Ajoutez à cela la malhonnêteté de la santé publique qui consiste à fabriquer une nouvelle définition de ce qui constitue un « cas ». Un « cas » est défini en médecine comme une infection active, symptomatique et diagnostiquée. Ce n’est plus le cas. Tout cas « positif » dans le « test » RT-PCR défectueux est désormais considéré comme un « cas ». La campagne massive de tests RT-PCR de la population générale asymptomatique, qui n’a aucune utilité clinique ou épidémiologique, alimente ainsi la propagande médiatique de la peur, avec des conséquences désastreuses : Tests RT-PCR non pertinent → signifie « cas » → propagande → mesures arbitraires / plus grand mal → popularité des dirigeants 33

La transmission ne se fait pas par contact

Le 17 septembre 2020, une étude approfondie a été publiée par Meyerowitz et al 34 dans l’une des principales revues médicales du monde, Annals of Internal Medicine, qui a conclu ce qui aurait dû être évident dès le départ, même pour l’OMS : La transmission par contact des maladies respiratoires virales, y compris le SRAS-CoV-2, est hors sujet.

Selon les termes de Meyerowitz et al :

“Des preuves solides provenant de rapports de cas et de groupes de cas indiquent que la transmission respiratoire est dominante, la proximité et la ventilation étant les principaux déterminants du risque de transmission. Dans les quelques cas où un contact direct ou une transmission fomitive est présumé, la transmission respiratoire n’a pas été complètement exclue. L’infectiosité atteint son maximum environ un jour avant l’apparition des symptômes et diminue dans la semaine qui suit, et aucune transmission liée tardivement (après qu’un patient a eu des symptômes pendant environ une semaine) n’a été documentée. Le virus présente une dynamique de transmission hétérogène : La plupart des personnes ne transmettent pas le virus, tandis que certaines provoquent de nombreux cas secondaires dans des groupes de transmission appelés « super-dispersion ». (Résumé)

[…] Il n’existe actuellement aucune preuve concluante de la transmission par fomite ou par contact direct du SRAS-CoV-2 chez l’homme.”

Cette conclusion a des implications de grande portée :

  • Elle signifie que la « recherche des contacts » est une absurdité pour les maladies respiratoires virales. Il n’est donc pas étonnant que l’OMS ait recommandé en 2019 que la recherche des contacts soit « déconseillée en toutes circonstances » (voir ci-dessus). Pourquoi l’OMS a-t-elle rejeté la transmission par aérosol pour la COVID-19 ? C’est de l’anti-science arbitraire. 35
  • Cela signifie que le lavage compulsif des mains et le nettoyage des surfaces sont des absurdités épidémiologiques, avec des conséquences négatives évidentes, comme les rappels massifs de désinfectants toxiques 36.
  • Cela signifie que les gouvernements et l’OMS ont été négligents pendant plus d’une décennie en n’étudiant pas, en ne recommandant pas et en ne mettant pas en œuvre des politiques de ventilation axées sur la transmission pour l’environnement bâti. En fait, l’OMS a enterré son propre rapport d’experts sur le sujet de 2009, sous la rubrique « eau / assainissement / santé » sur son site web 37, et un article de synthèse exhaustif du domaine public a été publié en 2007 38.
  • Cela signifie que le verrouillage des portes et des fenêtres des maisons de soins pour personnes âgées constitue le pire scénario possible pour prévenir les épidémies dans les maisons de soins 39 40.

Li et al 41 ont conclu (leur étude a été citée plus de 600 fois) :

“Dix des 40 études examinées ont été considérées comme concluantes en ce qui concerne l’association entre la ventilation des bâtiments et la transmission d’infections aéroportées. Il existe des preuves solides et suffisantes pour démontrer l’association entre la ventilation, les mouvements d’air dans les bâtiments et la transmission / propagation de maladies infectieuses telles que la rougeole, la tuberculose, la varicelle, la grippe, la variole et le SRAS. (Résumé)”

J’ai fait valoir que c’est précisément parce que la principale voie de transmission est constituée de fines particules d’aérosol que les masques ne peuvent pas réduire la transmission 42 43.

Face à la preuve irréfutable que les masques ne réduisent pas le risque d’infection de leur porteur 44 45, l’OMS et le complexe de santé publique ont inventé le « masque magique à sens unique », qui empêche la transmission par le porteur, tout en ne le protégeant pas. Les médias ont été ravis de propager ce fantasme, contraire aux lois de la physique, concernant la circulation de l’air porteur d’aérosols par les voies de moindre impédance à travers et autour des masques faciaux. Ce fantasme est ce qu’on appelle le « contrôle à la source », que de nombreux scientifiques qualifiés ont également répété.

En fait, même une stricte quarantaine de niveau militaire des jeunes adultes en bonne santé ne peut empêcher la transmission 46.

Les infirmières le savent. En Ontario, deux décisions importantes de tribunaux administratifs, en 2015 et en 2018, avec de longues audiences d’experts de tous bords, ont conclu que les infirmières de plusieurs grands hôpitaux ne pouvaient pas être obligées de porter des masques, qu’elles soient vaccinées ou non, car cela ne protégerait pas les patients 47 :

« Je pense qu’il y a maintenant un consensus qui se développe dans la communauté arbitrale selon lequel il ne fait aucun doute que ces politiques ne protègent pas vraiment les patients. L’arbitre a été assez ferme en décrivant les preuves apportées par l’hôpital comme insuffisantes, inadéquates et totalement non convaincantes », a dit Sharan Basran, avocate des infirmières.

Le port du masque dans la population générale n’apporte aucun bénéfice détectable

Depuis le 11 avril 2020, j’ai fait valoir en détail que les masques ne fonctionnent pas, et j’ai disséqué et exposé la fausse idée du contraire48 49. À cette époque, il n’y avait pas encore eu d’étude de qualité suffisante pour informer la politique sanitaire sur le port du masque dans la population générale.

Le 18 novembre 2020, Bundgaard et al ont publié leur vaste essai contrôlé randomisé (ECR) sur des participants sélectionnés dans la population générale danoise. Selon leurs propres termes 50 :

“Un total de 3030 participants ont été assignés au hasard à la recommandation de porter des masques, et 2994 ont été assignés au contrôle ; 4862 ont terminé l’étude. L’infection par le SRAS-CoV-2 s’est produite chez 42 participants à qui l’on avait recommandé de porter un masque (1,8%) et chez 53 participants du groupe témoin (2,1%). La différence entre les groupes était de -0,3 point de pourcentage (IC à 95%, -1,2 à 0,4 point de pourcentage ; P = 0,38) (rapport de cotes, 0,82 [IC, 0,54 à 1,23] ; P = 0,33). L’imputation multiple tenant compte de la perte au suivi a donné des résultats similaires. Bien que la différence observée ne soit pas statistiquement significative, les IC de 95% sont compatibles d’une réduction de 46% jusqu’à une augmentation de 23% de l’infection. (Résumé / Résultats)

[…] la recommandation de porter un masque chirurgical en dehors de la maison, entre autres, n’a pas réduit, à des niveaux conventionnels de signification statistique, l’incidence de l’infection par le SRAS-CoV-2 par rapport à l’absence de recommandation de port de masque. […] Les masques faciaux fournis aux participants étaient des masques chirurgicaux de haute qualité avec un taux de filtration de 98% [réf]. (Discussion)”

Pour être clair, « 95% d’IC sont compatibles avec une réduction de 46% jusqu’à une augmentation de 23% de l’infection » signifie que, dans les limites de l’incertitude, le port d’un masque pourrait avoir augmenté la probabilité d’être infecté de 23%. Telle est la nature de l’évaluation du risque relatif, lorsque l’impact comparatif sur le risque absolu est trop minime pour être détecté.

Les auteurs semblent avoir été contraints par le processus d’« examen par les pairs » de souligner que leur étude n’a pas été conçue pour tester l’hypothèse que j’ai évoquée plus haut, à savoir le masque magique à sens unique : « … et aucune évaluation de la capacité des masques à diminuer la transmission de maladies de leurs porteurs à d’autres personnes. »

À ce stade, quelque quinze (15) ECR de niveau politique plus tard, avec des résultats vérifiés, il faut se demander ce qu’il faudrait pour que le complexe de santé publique abandonne son nouvel enthousiasme pour le port de masque forcé de la population générale, ou au moins pour financer la recherche sur les préjudices répartis et les coûts sociétaux de cette politique draconienne.

Des études sur les préjudices quantifiables et potentiels du port de masque universel commencent à être publiées, tant dans des revues médicales régulières que dans des revues alternatives. Si le « principe de précaution » était plus qu’un simple effet de mode, de telles études auraient été nécessaires avant l’adoption de lois et d’obligations en matière de port de masque universel.

Le 6 juillet 2020, par exemple, Fikenzer et al ont publié une étude rigoureuse sur l’effet physiologique des masques sur 12 hommes en bonne santé (âgés de 38 ± 6 ans). Ils ont conclu 51 :

Les masques médicaux ont un impact négatif marqué sur la capacité cardio-pulmonaire, ce qui entrave considérablement les activités physiques et professionnelles pénibles. De plus, les masques médicaux nuisent considérablement à la qualité de vie de leur porteur. Ces effets doivent être considérés par rapport aux effets protecteurs potentiels des masques faciaux sur les transmissions virales. Les données quantitatives de cette étude peuvent donc éclairer les recommandations médicales et les décideurs politiques.”

En novembre 2020, Borovoy et al. 52 ont publié une étude approfondie des connaissances biologiques et médicales qui leur permet de déduire un potentiel important de dommages significatifs liés au port de masque. Ils soulignent à juste titre le rôle connu mais sous-estimé des bactéries dans les pandémies virales, et passent également en revue les maladies respiratoires dues aux bactéries buccales.

Les vaccins sont intrinsèquement dangereux

Le 13 juillet 2020, Arvin et al. ont publié dans les pages de la revue scientifique de premier plan Nature un important rappel à la réalité sous la forme d’une vaste « Perspective » (revue). L’article, à lire attentivement, est un exposé détaillé sur l’ignorance de l’homme concernant l’interférence artificielle avec le système immunitaire humain. Tout étudiant en sciences devrait conclure que « surtout, nous ne savons rien ». Les auteurs l’affirment sous une forme enjolivée 53 :

“L’augmentation de la maladie dépendante des anticorps (ADE) est une préoccupation générale pour le développement de vaccins et de thérapies par anticorps car les mécanismes qui sous-tendent la protection par anticorps contre tout virus ont un potentiel théorique d’amplifier l’infection ou de déclencher une immunopathologie nocive. Cette possibilité doit être examinée attentivement à ce stade critique de la pandémie de coronavirus 2019 (COVID-19), qui est causée par le coronavirus 2 du syndrome respiratoire aigu sévère (SRAS-CoV-2).

Nous passons ici en revue les observations relatives aux risques d’ADE de la maladie, et leurs implications potentielles pour l’infection par le SRAS-CoV-2. À l’heure actuelle, il n’existe pas de résultats cliniques, d’essais immunologiques ou de biomarqueurs connus qui permettent de différencier une infection virale grave d’une maladie à immunité renforcée, que ce soit par la mesure des anticorps, des cellules T ou des réponses intrinsèques de l’hôte. Les systèmes in vitro et les modèles animaux ne permettent pas de prédire le risque d’ADE de la maladie, en partie parce que les mécanismes de protection et les mécanismes potentiellement nuisibles médiés par les anticorps sont les mêmes et que la conception de modèles à base d’animaux dépend de la compréhension de la manière dont les réponses antivirales de l’hôte peuvent devenir nuisibles chez l’homme.

Les implications de notre manque de connaissances sont doubles. Premièrement, des études complètes sont nécessaires de toute urgence pour définir les corrélats cliniques de l’immunité protectrice contre le SRAS-CoV-2. Deuxièmement, étant donné qu’il est impossible de prévoir de manière fiable l’apparition de la maladie après une vaccination ou un traitement par anticorps – quel que soit le virus responsable – il sera essentiel de s’appuyer sur une analyse minutieuse de la sécurité chez l’homme à mesure que les interventions immunitaires contre la COVID-19 progressent. (Résumé)”

Compte tenu du déploiement qui a suivi, cela signifie que nous nous sommes lancés aveuglément dans une expérience à grande échelle sur des sujets humains, sans essais sur des animaux, sans transparence scientifique, sans possibilité de consentement éclairé, sous l’impulsion de sociétés pharmaceutiques qui ne veulent que le bien de l’humanité.

Le 1er octobre 2020, Wehenkel 54 a publié un article dans lequel il a étudié 39 pays et a constaté une forte association entre le taux national de vaccination contre la grippe (IVR) des personnes âgées de 65 ans et plus et le nombre de décès dus à la COVID-19 par million d’habitants. Les résultats sont préliminaires mais peuvent constituer un exemple documenté de « renforcement de la maladie dépendant des anticorps (ADE) » impliquant la COVID-19. Tous les taux de décès par COVID-19 les plus élevés ont été enregistrés dans les pays où l’IVR est supérieure à 50 % (voir ses figures 1 et 3). Je sens une opportunité de financement de la recherche pour défaire cette découverte.

Denis G. Rancourt

Chercheur, Association des libertés civiles de l’Ontario

L’auteur présente ci dessous ses compétences pour examiner les données scientifiques sur la COVID-19

Je suis retraité et ancien professeur titulaire de physique à l’université d’Ottawa. Le poste de professeur titulaire est le plus haut grade universitaire. Au cours de mes 23 ans de carrière en tant que professeur d’université, j’ai développé de nouveaux cours et j’ai enseigné à plus de 2000 étudiants universitaires, à tous les niveaux, et dans trois facultés différentes (sciences, ingénierie, arts). J’ai supervisé plus de 80 stages de recherche ou diplômes à tous les niveaux, du post-doctorant aux étudiants de troisième cycle en passant par les chercheurs de premier cycle du CRSNG. J’ai dirigé un laboratoire de recherche interdisciplinaire de renommée internationale, et j’ai attiré d’importants fonds de recherche pendant deux décennies.

J’ai été invité une quarantaine de fois à participer à des conférences scientifiques majeures, que ce soit en séance plénière, en tant que conférencier principal ou en session spéciale. J’ai publié plus de 100 articles de recherche dans des revues scientifiques de premier plan évaluées par des pairs, dans les domaines de la physique, de la chimie, de la géologie, de la bio-géochimie, de la science des mesures, de la science du sol et de la science environnementale.

Mon facteur d’impact de l’indice H scientifique est de 40, et mes articles ont été cités plus de 5 000 fois dans des revues scientifiques à comité de lecture (profil sur Google Scholar).

Mes connaissances personnelles et ma capacité à évaluer les faits présentés dans cet article sont fondées sur mon éducation, ma recherche, ma formation et mon expérience, comme suit :

  1. En ce qui concerne les nanoparticules environnementales. Les maladies respiratoires virales sont transmises par la plus petite fraction de taille des particules d’aérosols chargées de virions, qui sont des nanoparticules environnementales réactives. Par conséquent, les stabilités chimiques et physiques et les propriétés de transport de ces particules d’aérosol sont à la base du mécanisme dominant de contagion par l’air. Mes travaux approfondis sur les nanoparticules environnementales réactives sont reconnus au niveau international et portent sur les aspects suivants : précipitation et croissance, réactivité de surface, agglomération, charge de surface, transformation de phase, décantation et sédimentation, et dissolution réactive. En outre, j’ai enseigné la dynamique des fluides (l’air est un fluide compressible) et la sédimentation gravitationnelle au niveau universitaire, et j’ai effectué des recherches sur les applications industrielles de la technologie de filtration (les masques faciaux sont des filtres).
  2. En ce qui concerne la science moléculaire, la dynamique moléculaire et la complexation de surface. Je suis un expert en structures, réactions et dynamiques moléculaires, y compris la complexation moléculaire des surfaces biotiques et abiotiques. Ces processus sont à la base de la fixation des virus, de la fixation des antigènes, de la réplication moléculaire, de la fixation aux fibres des masques, de la charge des particules, de la perte et de la croissance des particules d’aérosol, et de tous ces phénomènes impliqués dans la transmission et l’infection virale, et dans les mesures de protection. J’ai enseigné pendant de nombreuses années la mécanique quantique au niveau universitaire avancé, qui est la théorie fondamentale des atomes, des molécules et des substances ; et dans mes recherches publiées, j’ai développé la théorie et la méthodologie de la diffraction des rayons X pour la caractérisation des petites particules de matériaux.
  3. En ce qui concerne les méthodes d’analyse statistique. L’analyse statistique des études scientifiques, y compris l’analyse robuste de la propagation des erreurs et les estimations robustes des biais, fixe la limite de ce qui peut être déduit de manière fiable de toute étude d’observation, y compris les essais contrôlés randomisés en médecine, et y compris les mesures sur le terrain pendant les épidémies. Je suis un expert en analyse d’erreurs et en analyse statistique de données complexes, au niveau de la recherche dans de nombreux domaines scientifiques. Les méthodes d’analyse statistique sont à la base de la recherche médicale.
  4. En ce qui concerne la modélisation mathématique. Une grande partie de l’épidémiologie est basée sur des modèles mathématiques de transmission et d’évolution des maladies dans la population. J’ai des connaissances et une expérience au niveau de la recherche en matière de modèles mathématiques prédictifs et exploratoires et de méthodes de simulation. J’ai des connaissances d’expert liées aux incertitudes des paramètres et aux dépendances des paramètres dans ces modèles. J’ai réalisé des simulations approfondies de la dynamique épidémiologique, en utilisant des modèles compartimentaux standard (SIR, MSIR) et de nouveaux modèles.
  5. En ce qui concerne les méthodes de mesure. En science, il existe cinq grandes catégories de méthodes de mesure : (1) la spectroscopie (y compris la spectroscopie nucléaire, électronique et vibratoire), (2) l’imagerie (y compris la microscopie optique et électronique, et l’imagerie par résonance), (3) la diffraction (y compris la diffraction des rayons X et des neutrons, utilisée pour élaborer des structures moléculaires, des défauts et des structures magnétiques), (4) les mesures de transport (y compris les taux de réaction, les transferts d’énergie et les conductivités), et (5) les mesures des propriétés physiques (y compris la densité spécifique, les capacités thermiques, la réponse aux contraintes, la fatigue des matériaux…). J’ai enseigné ces méthodes de mesure dans un cours interdisciplinaire de troisième cycle que j’ai développé et donné à des étudiants de troisième cycle (M.Sc. et Ph.D.) en physique, biologie, chimie, géologie et ingénierie pendant de nombreuses années. J’ai fait des découvertes et des progrès fondamentaux dans les domaines de la spectroscopie, de la diffraction, de la magnétométrie et de la microscopie, qui ont été publiés dans des revues scientifiques de premier plan et présentés lors de conférences internationales. Je connais la science des mesures, la base de toutes les sciences, au plus haut niveau.

Traduit par Hervé pour le Saker Francophone

Notes

  1. 2019–OMS : « Mesures de santé publique non pharmaceutiques pour atténuer le risque et l’impact de la grippe épidémique et pandémique », avec annexe, Organisation mondiale de la santé, octobre 2019 : OMS . Rapport, ISBN : 978-92-4-151683-9, pp 91, « Annexe : Rapport des revues systématiques de la littérature », WHO/WHE/IHM/GIP/2019.1, pp 125
  2. 2017–OMS : « Évaluation de la gravité de la grippe pandémique (PISA) : Un guide de l’OMS pour évaluer la gravité de la grippe dans les épidémies et pandémies saisonnières », Organisation mondiale de la santé, mai 2017, WHO/WHE/IHM/GIP/2017.2
  3. 2011–Bonneux : Luc Bonneux & Wim Van Damme. « La santé, c’est plus que la grippe ». Bulletin de l’Organisation mondiale de la santé 2011;89:539-540. doi : 10.2471/BLT.11.089086
  4. Ibid note 3
  5. 2010–Cohen : Cohen, D. et Carter, P. « L’OMS et les « conspirations » de la grippe pandémique ». BMJ 2010 ; 340:c2912. doi. (Publié le 04 juin 2010)
  6. 2020–Rancourt : « Les masques ne fonctionnent pas : un examen de la science en rapport avec la politique sociale de Covid-19 ». Rancourt, DG (11 avril 2020) ResearchGate, a obtenu 400 000 lectures, puis a été retiré de la plate-forme, selon ce rapport. Maintenant sur vixra.org , et sur rcreader.com. Et voir les Digi-Debates sur les critiques de l’article : « Digi-Debates. The Face Mask Debate », Digi Debates YouTube Channel, 25 juillet 2020, et à l’adresse suivante
  7. 2020–Rancourt : « Masques faciaux, mensonges, foutus mensonges, et fonctionnaires de la santé publique : « Un ensemble croissant de preuves ». ResearchGate (3 août 2020). DOI : 10.13140/RG.2.2.25042.58569
  8. 2020–Rancourt : « Mortalité toutes causes confondues lors de la COVID-19 : Pas de fléau et une signature probable d’homicide de masse par la réponse du gouvernement », par Rancourt, DG (2 juin 2020) ResearchGate. DOI: 10.13140/RG.2.2.24350.77125
  9. 2020–Rancourt : D. G. Rancourt, Marine Baudin, Jérémie Mercier. « Évaluation de la virulence du SRAS-CoV-2 en France, à partir de la mortalité toutes causes confondues 1946-2020 ». ResearchGate (20 août 2020). DOI: 10.13140/RG.2.2.16836.65920/1  (Version en français)
  10. Ibid note 6
  11. Ibid note 7
  12. 2020–Chaudhry : Chaudhry, Rabail et autres (2020) « Une analyse au niveau national mesurant l’impact des actions du gouvernement, de la préparation du pays et des facteurs socio-économiques sur la mortalité COVID-19 et les résultats sanitaires associés ». EClinicalMedicine, Volume 25, 100464 (21 juillet 2020 – The Lancet)
  13. 2020–De Larochelambert : De Larochelambert Q, Marc A, Antero J, Le Bourg E et Toussaint J-F (2020). « Covid-19 Mortalité : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées ». Frontiers in Public Health 8:604339. doi : 10.3389/fpubh.2020.604339 (19 novembre 2020 – frontiersin.org)
  14. 2020–AIER : « Les confinements ne contrôlent pas le coronavirus : Les preuves ». AIER Staff. Institut américain de recherche économique. 19 décembre 2020
  15. Ibid note 8
  16. Ibid note 9
  17. 2020–Yam : Kai Chi Yam, Joshua Conrad Jackson, Christopher M. Barnes, Jenson Lau, Xin Qin, Hin Yeung Lee. « L’augmentation des cas de COVID-19 est associée au soutien des dirigeants mondiaux ». Actes de l’Académie nationale des sciences. Oct 2020, 117 (41) 25429-25433 ; DOI : 10.1073/pnas.2009252117
  18. 2020–Abbasi : Abbasi, Kamran (rédacteur en chef). « Covid-19 : politisation, « corruption » et suppression de la science ». Journal médical britannique. BMJ 2020 ; 371 :m4425.
  19. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 – Potentiel de « variolation » dans l’attente d’un vaccin ». 29 octobre 2020. N Engl J Med 2020 ; 383:e101. DOI : 10.1056/NEJMp2026913
  20. 2020–Rasmussen : Angela L. Rasmussen et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.
  21. 2020–Brosseau : Lisa M. Brosseau et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.)
  22. Ibid note 19
  23. Ibid note 20
  24. Ibid note 21
  25. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (réponse de Gandhi et al.)
  26. Ibid note 7
  27. 2020–IHME : IHME COVID-19 Forecasting Team, Reiner, R.C., Barber, R.M. et al. « Modélisation des scénarios COVID-19 pour les États-Unis ». Nature Medicine (2020). doi
  28. 2020 — Magness : Phillip W. Magness. « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées ». Wall Street Journal (11 novembre 2020)
  29. 2020 : Corman Victor M, Landt Olfert, Kaiser Marco, Molenkamp Richard, Meijer Adam, Chu Daniel KW, Bleicker Tobias, Brünink Sebastian, Schneider Julia, Schmidt Marie Luisa, Mulders Daphne GJC, Haagmans Bart L, van der Veer Bas, van den Brink Sharon, Wijsman Lisa, Goderski Gabriel, Romette Jean-Louis, Ellis Joanna, Zambon Maria, Peiris Malik, Goossens Herman, Reusken Chantal, Koopmans Marion PG, Drosten Christian. « Détection de nouveaux coronavirus en 2019 (2019-nCoV) par RT-PCR en temps réel ». Euro Surveill. 2020;25(3):pii=2000045. doi
  30. 2020–Borger : Borger, Pieter et al « Rapport d’examen Corman-Drosten et al Eurosurveillance 2020 – L’examen externe par les pairs du test RT-PCR pour détecter le SRAS-CoV-2 révèle 10 failles scientifiques majeures au niveau moléculaire et méthodologique : conséquences pour les résultats faussement positifs ». Consortium international des scientifiques en sciences de la vie (ICSLS). 27 novembre 2020
  31. 2020–Singanayagam : Singanayagam Anika, Patel Monika, Charlett Andre, Lopez Bernal Jamie, Saliba Vanessa, Ellis Joanna, Ladhani Shamez, Zambon Maria, Gopal Robin. « Durée de l’infectiosité et corrélation avec les valeurs seuils du cycle RT-PCR dans les cas de COVID-19, Angleterre, janvier à mai 2020 ». Euro Surveill. 2020;25(32):pii=2001483. doi
  32. 2020–Jaafar : Jaafar R, Aherfi S, Wurtz N, Grimaldier C, Hoang VT, Colson P, Raoult D, La Scola B. « Corrélation entre 3790 échantillons positifs au qPCR et des cultures cellulaires positives, y compris 1941 isolats de SRAS-CoV-2 ». Clin Infect Dis. 2020 Sep 28:ciaa1491. doi : 10.1093/cid/ciaa1491. Epub avant impression. PMID : 32986798 ; PMCID : PMC7543373 – academic.oup.com
  33. Ibid note 17
  34. 2020–Meyerowitz : Eric A. Meyerowitz, Aaron Richterman, Rajesh T. Gandhi, et al « Transmission du SRAS-CoV-2 : Un examen des facteurs viraux, des hôtes et de l’environnement ». Ann Intern Med. – Epub avant impression 17 septembre 2020. doi:10.7326/M20-5008 – acpjournal.org
  35. Ibid note 7
  36. 2020–CBC : La presse canadienne : « Santé Canada rappelle plus de 50 désinfectants pour les mains dans une liste évolutive ». (5 août 2020) – cbc.ca
  37. 2009–OMS : « Ventilation naturelle pour la lutte contre les infections dans les établissements de santé – Lignes directrices de l’OMS 2009 ». Éditeurs : James Atkinson, Yves Chartier, Carmen Lúcia Pessoa-Silva, Paul Jensen, Yuguo Li et Wing-Hong Seto, pp 106, 2009, ISBN : 978 92 4 154785 7 – OMS
  38. 2007–Li : Li Y, Leung GM, Tang JW, Yang X, Chao CY, Lin JZ, Lu JW, Nielsen PV, Niu J, Qian H, Sleigh AC, Su HJ, Sundell J, Wong TW, Yuen PL. « Rôle de la ventilation dans la transmission aérienne d’agents infectieux dans l’environnement bâti – une étude systématique multidisciplinaire ». Air intérieur. 2007 Feb;17(1):2-18. doi : 10.1111/j.1600-0668.2006.00445.x. PMID : 17257148
  39. Ibid note 8
  40. Ibid note 9
  41. Ibid note 38
  42. Ibid note 6
  43. Ibid note 7
  44. Ibid note 6
  45. Ibid note  7
  46. 2020–Letizia : Letizia AG, Ramos I, Obla A, Goforth C, Weir DL, Ge Y, Bamman MM, Dutta J, Ellis E, Estrella L, George MC, Gonzalez-Reiche AS, Graham WD, van de Guchte A, Gutierrez R, Jones F, Kalomoiri A, Lizewski R, Lizewski S, Marayag J, Marjanovic N, Millar EV, Nair VD, Nudelman G, Nunez E, Pike BL, Porter C, Regeimbal J, Rirak S, Santa Ana E, Sealfon RSG, Sebra R, Simons MP, Soares-Schanoski A, Sugiharto V, Termini M, Vangeti S, Williams C, Troyanskaya OG, van Bakel H, Sealfon SC. « Transmission du SRAS-CoV-2 parmi les recrues dans la Marine pendant la quarantaine ». N Engl J Med. 2020 Dec 17;383(25):2407-2416. doi : 10.1056/NEJMoa2029717. Epub 2020 11 nov. PMID : 33176093 ; PMCID : PMC7675690. (11 novembre 2020) – nejm.org
  47. 2018–Brown : « L’ONA remporte un deuxième arbitrage contre les hôpitaux sur la politique des vaccins ou des masques » (13 septembre 2018), Canadian Lawyer Magazine – canadianlawyermag.com
  48. Ibid note 6
  49. Ibid note 7
  50. 2020–Bundgaard : Bundgaard H, Bundgaard JS, Raaschou-Pedersen DET, von Buchwald C, Todsen T, Norsk JB, Pries-Heje MM, Vissing CR, Nielsen PB, Winsløw UC, Fogh K, Hasselbalch R, Kristensen JH, Ringgaard A, Porsborg Andersen M, Goecke NB, Trebbien R, Skovgaard K, Benfield T, Ullum H, Torp-Pedersen C, Iversen K. « Efficacité de l’ajout d’une recommandation sur les masques à d’autres mesures de santé publique pour prévenir l’infection par le SRAS-CoV-2 chez les porteurs de masques danois : un essai contrôlé randomisé ». Ann Intern Med. 2020 Nov 18:M20-6817. doi : 10.7326/M20-6817. Epub avant impression. PMID : 33205991 ; PMCID : PMC7707213. – acpjournals.org
  51. 2020–Fikenzer : Fikenzer S, Uhe T, Lavall D, Rudolph U, Falz R, Busse M, Hepp P, Laufs U. « Effets des masques chirurgicaux et des masques FFP2/N95 sur la capacité d’exercice cardio-pulmonaire ». Clin Res Cardiol. 2020 Dec;109(12):1522-1530. doi : 10.1007/s00392-020-01704-y. Epub 2020, 6 juillet. PMID : 32632523 ; PMCID : PMC7338098 – springer.com
  52. 2020–Borovoy : Boris Borovoy, Colleen Huber, Maria Crisler. « Masques, fausse sécurité et dangers réels, Partie 2 : Défis microbiens des masques ». Primary Doctor Medical Journal. Novembre 2020 – pdmj.org
  53. 2020–Arvin : Arvin AM, Fink K, Schmid MA, Cathcart A, Spreafico R, Havenar-Daughton C, Lanzavecchia A, Corti D, Virgin HW. « Une perspective sur le renforcement potentiel du SRAS-CoV-2 dépendant des anticorps ». Nature. 2020 Aug;584(7821):353-363. doi : 10.1038/s41586-020-2538-8. Epub 2020 13 juillet. PMID : 32659783 – nature.com
  54. 2020–Wehenkel : Wehenkel C. 2020. « Association positive entre les décès dus au COVID-19 et les taux de vaccination contre la grippe chez les personnes âgées dans le monde ». PeerJ 8:e10112  – doi 

= = =

Lecture complémentaire:

Notre page « Coronavirus, guerre contre l’humanité »

 


Faites-leurs confiance… Ils ne vous veulent que du bien !

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Déclaration de responsabilité civile et pénale pour l’administration du vaccin Pfizer / BioNTech ou Moderna dans le cadre de la COVID-19 (Association Réaction19, format PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 26 décembre 2020 by Résistance 71


Mais que diable vont-ils nous injecter ?…

POUR DIFFUSION IMMEDIATE

Résistance 71

26 décembre 2020

Devant la menace sanitaire de ces vaccins OGM à ARNm dont personne ne peut savoir ce qu’ils génèreront sur le long terme sur le génome humain et le manque de transparence total les concernant, ainsi que l’ineptie totale pour les gouvernements et surtout l’UE d’avoir totalement exonéré de toute responsabilité légale les labos pharmaceutiques Pfizer / BioNTech, Moderna, voici un document de responsabilité civile ayant valeur légale que ceux qui désirent se faire vacciner peuvent faire signer au médecin et chargé de mission sanitaire les injectant.
Le document est réalisé par l’association REACTON19, Paris 8ème, rue de la Boétie, « pour toute personne concernée par le « vaccin » Pfizer/BioNTech ou Moderna ».

Ne faites confiance à aucune des instances promouvant cette saloperie, elles sont noyées ainsi que les individus qui les dirigent, dans le conflit d’intérêt le plus grossier et ce à tous les niveaux, que ce soit financier ou politique.

Voici le document à faire signer, diffusez, imprimez, distribuez… (PDF)
Déclaration-de-responsabilité-civile-et-pénale-du-médecin-1

Vaccin CoV19 et stérilisation des populations ?…Des éléments plus que troublants

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 12 décembre 2020 by Résistance 71

 

 

Un vaccin covid qui stérilise la population pour un virus moins mortel que la grippe ?

 

Anonyme (reçu par courriel)

 

12 décembre 2020

 

La protéine d’origine virale du placenta et la protéine d’origine virale du sperme ressemblent à la protéine d’origine covid

vaccination covid= stérilisation des femmes et des hommes ?

8% de l’ADN humain est d’origine virale, les virus participent au système de reproduction humaine, si le covid ressemble au virus participant à la reproduction humaine, le vaccin covid s’attaquera à la fertilité humaine

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

La protéine d’origine virale chargé de la création du  placenta ressemble à la protéine créé par le covid,  donc il y a un risque que le vaccin covid  va causer l’infertilité tant des femmes que des hommes, car la syncytine 1 est présent aussi dans le sperme

https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

La syncytine 1 est une protéine d’origine virale joue un rôle essentiel lors de la formation du placenta au moment de la grossesse

La syncytine est une glycoprotéine d’enveloppe rétrovirale possédant des capacités fusogéniques induisant la formation de syncytium (cellules polynucléées découlant de fusion cellulaire). Elle est abondamment exprimée au niveau du placenta durant la grossesse. Chez l’humain les cytotrophoblastes jouent un rôle crucial dans le développement fœtal et placentaire. https://fr.wikipedia.org/wiki/Syncytine_1

« Qu’y a-t-il, dans ces protéines syncytines créés par les virus de l’ADN humain https://fr.wikipedia.org/wiki/Syncytine_1, de si nécessaire à la formation du placenta ? « Pour qu’ils puissent pénétrer dans la cellule hôte, les rétrovirus ont la faculté de faire fusionner la membrane de leur enveloppe avec la paroi cellulaire, explique M. Heidmann. Cette fusion de deux membranes est rendue possible par les syncytines puisque ce sont elles qui interagissent avec la surface de la cellule qui va être infectée. » Or ce mécanisme de fusion membranaire permet la formation de structures géantes appelées « syncytia » et constituées par la réunion de cellules individuelles… Une structure que l’on retrouve dans le placenta, à l’interface entre le foetus et la mère. »

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

là une preuve que le covid 19 est en partie similaire au virus du placenta qui permet la création des bébés: 

« les protéines de pointe du COVID 19 contiennent également des protéines homologues à la syncytine protéine d’origine virale chargé de la formation du placenta »

.http://www.francesoir.fr/societe-sante/vaccination-sars-cov-2-le-dr-wodarg-et-le-dr-yeadon-disent-stop

Pfizer admet que son vaccin peut causer la stérilisation des femmes

« Responsable de la recherche chez Pfizer : Le vaccin Covid entrainera la stérilisation des femmes

Le vaccin contient une protéine de pointe (voir image) appelée syncytine-1, vitale pour la formation du placenta humain chez la femme. 

Si le vaccin fonctionne de telle sorte que nous formons une réponse immunitaire CONTRE la protéine de pointe, nous entraînons également le corps féminin à attaquer la syncytine-1, ce qui pourrait entraîner une stérilité chez les femmes pour une durée indéterminée.

Après quelques recherches, il s’avère que la syncytine 1 est également présente dans le sperme, de sorte que ce ne sont pas seulement les femmes qui seront stérilisées, mais aussi les hommes

https://www.researchgate.net/publication/261257414_Syncytin-1_and_its_receptor_is_present_in_human_gametes

https://healthandmoneynews.wordpress.com/2020/12/02/head-of-pfizer-research-covid-vaccine-is-female-sterilization/

Contrairement aux trolls qui prétendent que l’ARN ne peut pas modifier notre génome car est dans le cytoplasme de la cellule, ils oublient que certains virus possèdent une enzyme appelés transcriptase inverse qui permet de transcrire de l’ARN à l’ADN, et donc de modifier l’ADN à partir de l’ARN
https://fr.wikipedia.org/wiki/Transcriptase_inverse

 

or le covid qui est un virus manipulé en laboratoire https://fort-russ.com/2020/05/major-researchers-uncover-new-evidence-showing-covid-19-was-lab-created/, possède des fragments du VIH selon Le prof luc Montaigner qui l’a étudié
https://youtu.be/Vx91DZTjNTI

 

or le VIH possède dans son génome l’enzyme transcriptase inverse
https://en.wikipedia.org/wiki/Reverse-transcriptase_inhibitor#Non-nucleoside_reverse-transcriptase_inhibitor

 

ainsi donc les vaccins à ARN pourront modifier notre génome mais rassurez vous, les virus à ARN seuls sans vaccins ne peuvent pas modifier votre génome
la raison est que les enzymes de nos corps ainsi que nos anticorps détruisent tout ARN étranger venant de l’extérieur
c’est la raison pour laquelle pour protéger leur ARN de virus, ils l’engloberont de nanoparticules lipides, afin que le corps l’identifie comme lui appartenant et ne l’attaque pas, et le laisse entrer dans ses cellules pour faire de la modification génétique à partir de la transcription inverse une fois que l’ARN sera dans le cytoplasme de la cellule, donc le vaccin à ARN modifiera le génome à partir de la transcriptase inverse (de l’ARN à l’ADN)
la transcriptase normal tout court dont parlent les trolls c’est de l’ADN à l’ARN, mais vu que le covid contient la fonction transcriptase inverse, leur théorie bidon que les vaccins à ARN ne peuvent pas modifier le génome ne fonctionnera pas
la preuve les fabricants de vaccins sont obligés d’englober leur précieux virus RNA (the mRNA) modifié de nanoparticules lipidiques (lipid nanoparticles), car sinon les enzymes secrétés par les mucus du nez, la salive, les muqueuses de l’estomac, et autres émetteurs d’enzymes présents partout dans le corps, anticorps tueraient leur précieux RNA virus modifié
citations:
« lipid nanoparticles can be synthesized with relative ease in a scalable manner, protect the mRNA against degradation, facilitate endosomal escape, can be targeted to the desired cell type by surface decoration with ligands, and as needed, can be codelivered with adjuvants.
https://pubmed.ncbi.nlm.nih.gov/27075952/

As mRNA molecules are vulnerable to ribonuclease enzymes that widely exist in the biological systems and highly negatively charged, which compromise their internalization through cell membranes, suitable in vivo mRNA delivery systems are urgently needed (4). To protect and deliver mRNA, extensive efforts have been devoted to construct biocompatible carriers, such as LNPs, polymeric nanoparticles, peptides/protein-mRNA complexes, and other types of biomaterials (9, 22, 23). Among these reported platforms, lipid-like nanoparticles (LLNs) are one of the representative materials that have been extensively used for mRNAs delivery

https://advances.sciencemag.org/content/6/34/eabc2315.full

 

RNA molecules are also fragile molecules, easily degraded in the body https://www.pharmaceutical-journal.com/news-and-analysis/features/rna-interference-therapies-could-be-on-the-cusp-of-success/20204853.article?firstPass=false

le virus est composé d’un ARN, donc est facile à dégrader par le corps

il ne peut être protégé de la destruction du corps que si il est protégé et encapsulé à l’intérieur de nanoparticules biocompatibles dans le corps humain via le vaccin

Nanoparticle-based delivery systems protect RNA molecules from enzymatic degradation and immune system attacks https://www.biosyn.com/tew/Nanocarriers-for-RNA-delivery.aspx#!

la famine programmée par le gouvernement par les confinements meurtriers (morts de la faim à cause du chômage à cause de la fermeture des commerces non essentiels pour permettre à Amazon qui fraude sur la TVA de se remplir les pocheshttp://www.cielvoile.fr/2020/12/fraude-massive-a-la-tva-sur-les-places-de-marche-des-acteurs-du-e-commerce.html )http://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html,  future loi finance 2021https://strategika.fr/2020/12/04/appel-aux-francais-faites-pression-sur-vos-elus-afin-quils-sopposent-au-vote-de-la-prochaine-loi-de-finances-pour-2021/ et les compteurs linkyhttps://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/   en revanche fait réduire la production d’enzymes pouvant détruire les virus d’où le fait que dans l’histoire de l’humanité, les épidémies n’ont lieu uniquement que dans les périodes de famines, et disparaissent automatiquement avec la fin de celles ci
https://fr.wikipedia.org/wiki/Liste_de_famines

 

d’où le fait qu’ils font tout pour accroitre la crise économique avec les confinementshttp://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/  , fermeture des commerces non essentiels mettant en chomage des millions de personnes
les masques assèchent la bouche, donc réduction de la salive qui contient des enzymes tuant les virus

le Ribonucléase Rnase ennemi mortel du covid (RNA) et présent naturellement dans tout le corps humain
https://en.wikipedia.org/wiki/Ribonuclease

les vaccinateurs veulent nous imposer le covid à travers le vaccin obligatoire, en protégeant leur précieux virus à l’intérieur de nanoparticules lipidiques pour l’empêcher d’être détruits par nos méchants enzymes et méchants anticorps

La stérilité causé par les vaccinés sera-t-elle imputée au Covid19 ? Regardez ces liens ou faites votre propre recherche.

https://www.nationalheraldindia.com/health/coronavirus-can-cause-male-infertility-study

https://www.thailandmedical.news/news/breaking-male-infertility-research-shows-that-sars-cov-2-coronavirus-may-indirectly-cause-testicular-damage-in-male-covid-19-patients-and-also-orchiti

https://www.forbes.com/sites/victoriaforster/2020/11/15/covid-19-compromises-sperm-count-and-quality-in-recovering-patients/

https://www.urotoday.com/recent-abstracts/men-s-health/male-infertility/124144-male-fertility-and-the-covid-19-pandemic-systematic-review-of-the-literature-beyond-the-abstract.html

https://journals.physiology.org/doi/full/10.1152/ajpendo.00183.2020

https://www.bionews.org.uk/page_152485

https://healthandmoneynews.wordpress.com/2020/12/03/oxford-designer-of-covid-vaccine-admits-vaccine-will-only-sterilize-70-per-cent-of-the-population/

Les tests PCR sont bidons et à 90% d’asymptomatiques, leur objectif c’est de stériliser la jeunesse fertile via la vaccination

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

Autre preuve que le covid est bidon:
en l’année 2020 du covid 2019, la population mondiale augmente, donc aucun risque qu’un virus puisse faire que l’espèce humaine disparaisse, la vie continue normalement comme des millénaires avant
https://www.worldometers.info/fr/

Evidemment le gouvernement enrage que le virus covid n’arrive pas à dépeupler les gueux et ne les stérilise pas et ne leur fait aucun symptôme du tout, donc il a fait pondre la loi pour avorter les bébés à 9 mois dans le ventre et une autre loi pour euthanasier les vieux, et une autre loi pour baillonner tout le monde pour empêcher tout le monde de respirer, et une loi pour autoriser le glyphosate de Monsanto

https://www.ouest-france.fr/environnement/glyphosate/glyphosate-l-assemblee-refuse-d-inscrire-l-interdiction-de-l-herbicide-dans-la-loi-5789451

alors qu’on sait que les pesticides tout comme les autres polluants chimiques abiment les poumons donc entravent la respiration

https://observatoire-des-aliments.fr/sante/pesticides-et-problemes-respiratoires-chez-les-enfants
https://www.lefigaro.fr/vox/societe/img-jusqu-au-9e-mois-pour-detresse-psychosociale-le-danger-d-un-motif-imprecis-20200812

preuve que le covid n’a aucun impact sur la fertilité et n’empêche pas la naissance de bébés en excellente santé

https://indianexpress.com/article/cities/chandigarh/covid-positive-woman-delivers-healthy-baby-6552509/

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

En plus vu que la population mondiale augmente, on voit que le covid n’a aucun impact sur la fertilité des hommes et des femmes, que s’il y a une épidémie de gens stériles après, ce sera bien causé par la vaccination…

Mais ils feront croire que la stérilisation est causé par le covid pour pousser les gens à se vacciner, et bien sur, ils feront passer leurs exemples d’individus stériles à cause de la vaccination comme des gens qui n’ont jamais été vaccinés pour faire croire à leurs mensonges

Alors ne vous vaccinez pas, tant que les labos n’ont pas fait de garanties écrites et sont prêts à être responsables judiciairement si leurs vaccins causent un impact sur la fertilité et toute autre déraillement de la santé par effets secondaires mortifères !

Tests PCR sinon bidons du moins bien peu fiable en contexte clinique et dépistage thérapeutique

https://resistance71.wordpress.com/2020/12/10/cov19-test-pcr-et-falsification-des-chiffres-le-test-rt-pcr-ne-devrait-pas-etre-utilise-a-fins-therapeutiques-il-nest-quun-outil-de-fabrique-comme-concu-par-son-inventeur-kary-mullis/

https://resistance71.wordpress.com/2020/10/16/voix-de-la-raison-cov19-et-tests-rt-pcr-comprendre-le-comment-de-lenfumage-general-permettant-de-maintenir-un-etat-de-terreur-accepte-du-plus-grand-nombre-et-de-dire-non-a-la-dictature-sanitair/

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

= = =

A lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

 

Dictature technotronique en marche : Vaccin COVID ARNm, hydrogel, enzyme luciférase, cocktail modificateur génétique ?

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , on 9 octobre 2020 by Résistance 71


Big Pharma et ses marionnettes aux commandes


Le vaccin biopuce COVID19 de Moderna (OGM, ARNm + technologie Hydrogel + enzyme luciferase) modificateur génétique


Anonyme


7 octobre 2020


Cet article fait suite à notre publication:
“Vaccin COVID19, nocivité et contrôle de la population mondiale… Petits précis sur le vaccin COVID19”

Le comble c’est que les victimes des vaccins qui auront les symptômes du covid à cause du vaccin et non à cause du covid ne seront jamais indemnisés mais enfermés dans les camps de concentration sous prétexte de covid car même si les gens se vaccinent, ils seront toujours soumis aux masques, aux tests, à l’isolement forcé dans les camps de concentration, car le vaccin est inutile et ne sert qu’à affaiblir votre système immunitaire et vous modifier génétiquement

https://fort-russ.com/2020/07/report-us-virus-experts-claim-even-with-vaccine-we-will-be-dealing-with-this-forever/

Covid-19 : Les Suisses se laisseront-ils imposer le vaccin Moderna à modification génétique ?

https://olivierdemeulenaere.wordpress.com/2020/09/29/covid-19-les-suisses-se-laisseront-ils-imposer-le-vaccin-moderna-a-modification-genetique/

« Sachez que dans la phase 2 de Moderna, lls n’utilisent que 30 ou 45 humains , dans l’étude test de Moderna, il y avait 45 humains, avec le groupe de vaccins à forte dose, 100% des personnes ont développé des effets secondaires systémiques à court terme.

Et pour le vaccin à faible dose, 80% des personnes ont développé des effets secondaires systémiques à court terme.

Et nous ne connaissons pas les effets secondaires à long terme du vaccin , il nous faudra plus de temps, peut être des années. Mais nous savons d’après des études sur des animaux que si vous utilisez cette technologie, vous allez constater une augmentation du taux de cancer , des mutations génétiques, de la mutagénèse et des réactions auto-immunes .

Par exemple, dans certaines études sur les furets qui ont été vaccinés par Moderna , on a constaté qu’en contact avec le virus dont on essayait de les protéger par les vaccins, la réponse immunitaire était exagérée. Les furets souffraient.

Ils avaient plus d’inflammation pulmonaire , de liquide pulmonaire, des problèmes hépatiques.

Le vaccin leur a fait du mal, la réponse immunitaire était moins bonne : ce sont des effets secondaires à plus long terme et ça pourrait être observé avec ce vaccin dont nous ne connaissons pas encore les données et qui n’est pas sans risque. »

https://resistance71.wordpress.com/2020/08/30/vaccin-cov19-et-passage-a-lhumain-2-0-un-avertissement-du-dr-carrie-madej-video/

https://fort-russ.com/2020/04/the-gates-of-hell-proven-coronavirus-vaccines-caused-lung-inflammation-and-death/

Même Fauci le pantin de Bill Gates a avoué que le vaccin covid pourra causer une maladie auto immune

https://youtu.be/a7el_zNfq4A

Dr Fauci avoue qu’il ne se vaccine pas, qu’il utilise la vitamine C et D pour se prémunir du covid https://www.businessinsider.in/science/health/news/dr-fauci-says-he-takes-vitamin-d-and-c-supplements-and-that-they-can-lessen-your-susceptibility-to-infection/articleshow/78069353.cms (source censuré), mais cela ne l’empêche pas de cet hypocrite de faire une loi pour imposer le vaccin aux américains et une autre loi pour indemniser les labos de toute responsabilité sur les effets secondaires des vaccins https://www.phe.gov/Preparedness/legal/prepact/Pages/COVID19.aspx

Ils ont même censuré une vidéo où Bill Gates réclamait d’être exonéré de responsabilités sur les vaccins covid

https://childrenshealthdefense.org/news/heres-why-bill-gates-wants-indemnity-are-you-willing-to-take-the-risk/

Alliance Canada (scientifique canadien) +USA ( DARPA financé par le gouvernement des USA, Pentagone) pour créer un vaccin OGM transhumaniste (biopuce par la technologie Hydrogel) connecté à la 5G créant des effets secondaires qui ne seront jamais compensés par les labos, qui contient la technologie Hydrogel de DARPA, Hydrogel sera connecté à la 5G, donc le vaccin contenant l’hydrogel sera connecté à la 5G, l’Hydrogel permettra de modifier la biologie de votre corps à distance, donc aggraver les effets secondaires des vaccins, et permettra également de tout savoir sur l’état de votre corps, dès que qu’ils utiliseront la 5G pour activer l’hydrogel du vaccin dans votre corps et que vous vous sentirez mal, les infos de votre mal être iront dans leur serveur connecté à la 5G, vous aurez alors la brigade qui vous raflera dans les camps d’extermination nazi en disant qu’ils ont reçu la notice que vous avez eu le covid (ils feront croire que les effets causés par le vaccin ne viennent jamais du vaccin mais du covid, c’est un moyen pour eux d’enfermer toutes les victimes des vaccins dans les camps nazis sans avoir à subir une révolution massive des peuples contre eux, créer des victimes et ensuite les enfermer dans les camps nazis voilà pourquoi un article canadien https://o.canada.com/health/covid-19-vaccine-efforts-provide-hope-but-no-silver-bullet-to-stop-pandemic-tam/wcm/f9c77d43-0719-4057-ba0a-dfc14c4bdf1a  a avoué que les vaccins ne stopperont pas le covd, et que les vaccinés contineront à subir les isolements dans les camps d’extermination nazis)

Facebook soutient le vaccin Moderna et critique de désinformateurs ceux qui critiquent le vaccin Moderna

https://www.facebook.com/nonauvaccin/videos/2347279492234587/

La luciférase dans le patch quantique de Bill Gates

On a parlé le mois dernier, du  nouvel implant invisible appelé « tatouage à points quantiques» (un patch de micro-aiguilles) conçu par Microsoft pour suivre qui sera vacciné contre le coronavirus et qui ne le sera pas, sous le numéro du brevet WO/2020/060606.

Quand on commence à lire des informations à ce sujet on se croirait en plein « fake », en pleine contrefaçon complotiste, et pourtant qui peut invalider celle-ci ? Ce dispositif breveté qui se présente comme un « passeport immunitaire » (immunity passport) repose sur l’introduction sous votre peau d’une enzyme, la luciférase, qui est nécessaire pour qu’une machine puisse lire l’information inscrite dans votre tatouage. C’est une enzyme dont la bioluminescence est proche de l’infrarouge.

Le nom, qui renvoie à Lucifer, si l’on se penche sur l’inventeur des mots « luciférine » et « luciférase », on découvre qu’il s’agit d’un certain Dr Raphaël Dubois. Dubois, professeur de physiologie générale et comparée à l’Université de Lyon, spécialiste des photobactéries, 

Bill Gates  aurait au sein d’une société secrète planifié d’introduire une enzyme au nom satanique dans son patch quantique. De quoi encore renforcer la méfiance.

Au fait : a-t-on la moindre idée des effets secondaires de la présence de cette enzyme dans un organisme humain ?

http://delorca.over-blog.com/2020/05/la-luciferase-dans-le-patch-quantique-de-bill-gates.html

les vaccins covid de Canada créent de l’hépatite et détruisent le foie

https://www.cidrap.umn.edu/news-perspective/2004/12/sars-vaccine-linked-liver-damage-ferret-study

un homme en très bonne santé s’est présenté comme cobaye chez Moderna qui ne prend que des sujets en très bonne santé (parce que s’il prenait des gens malades, lls créveraient tout de suite, et cela ferait 100% de morts directs, et ironiquement les vaccins moderna ne seront adressés en priorité qu’aux malades)  a testé le vaccin Moderna 2 doses: résultat 103.2 degrés de fièvres, nausées, douleurs musculaires, s’est évanoui, il a été envoyé aux urgences, il a survécu puis on lui a donné un gros pot de vin d’argent pour l’obliger à dire qu’il ne ressent plus rien et soutenir le vaccin Moderna

https://www.statnews.com/2020/05/26/moderna-vaccine-candidate-trial-participant-severe-reaction/

.https://fort-russ.com/2020/05/catastrophe-modernas-corona-vacc-test-subject-ian-haydon-suffers-major-illness/

: 20% des sujets humains testés (qui étaient avant le vaccin en très bonne santé)  sont gravement blessés par le vaccin contre le coronavirus de Moderna soutenu par Gates-Fauci

https://fort-russ.com/2020/05/catastrophe-20-of-human-test-subjects-severely-injured-from-gates-fauci-coronavirus-vaccine-by-moderna/

Voilà ce qu’il se passe pour des gens en très bonne santé , hors les vaccins vont être donnés en priorité aux plus fragiles, à ceux qui ont des dossiers médicaux, alors imaginez l’hétacombe des morts causés par les vaccins covid dans une population déjà affaibli par les masqueshttp://stoplinky28.blogg.org/alerte-au-toluene-et-au-formaldehyde-a202482682 

http://stoplinkyvarest.canalblog.com/archives/2020/09/04/38516126.html, le confinement rempli d’ondes cancérigènes 5G https://resistance71.wordpress.com/2020/10/03/grille-de-controle-totalitaire-planetaire-stoppons-les-delires-technotroniques-pdf/ qui sera imposé par Bill Gates de décembre 2020 jusqu’à l’annonce du vaccin de Bill Gates de mai 2020http://stoplinky28.blogg.org/info-importante-a-relayer-a202359170!

https://www.globalresearch.ca/5g-danger-13-reasons-5g-wireless-technology-will-be-a-catastrophe-for-humanity/5680503

http://stoplinky28.blogg.org/fake-news-des-lasers-pour-traquer-les-gens-non-masques-a202244456

https://resistance71.wordpress.com/2020/04/23/5g-sante-carence-en-oxygene-une-piste-a-suivre/

http://stoplinky28.blogg.org/linky-l-oxygene-et-le-masque-a201768338

c’est un scientifique canadien  Derrick Rossi qui a fondé Moderna

https://en.wikipedia.org/wiki/Derrick_Rossi qui a fait un contrat avec l’UE et la France

https://www.laprovence.com/actu/en-direct/6086466/coronavirus-lue-reserve-des-vaccins-aupres-du-laboratoire-moderna.html donc pour nous imposer un vaccin ogm pour modifier notre ADN

https://resistance71.wordpress.com/2020/08/30/vaccin-cov19-et-passage-a-lhumain-2-0-un-avertissement-du-dr-carrie-madej-video/ : « La percée révolutionnaire est arrivée à un scientifique canadien nommé Derek Rossi en 2010 par pur hasard. Ce professeur de Harvard, aujourd’hui à la retraite, a affirmé dans une interview au National Post qu’il avait trouvé un moyen de « reprogrammer » les molécules qui portent les instructions génétiques pour le développement des cellules dans le corps humain, sans parler de toutes les formes de vie biologiques.

Ces molécules sont appelées « acide ribonucléique messager » ou ARNm et la nouvelle capacité à réécrire ces instructions pour produire n’importe quel type de cellule dans un organisme biologique a radicalement changé le cours de la médecine et de la science occidentales, même si personne ne l’a encore vraiment remarqué.

Comme Rossi le dit lui-même : « La découverte la plus importante était que vous pouviez maintenant utiliser l’ARNm, et si vous l’introduisiez dans les cellules, alors vous pouviez faire en sorte que l’ARNm exprime n’importe quelle protéine dans les cellules, et c’était ça le plus important ».

https://www.zerohedge.com/technology/microchipd-darpa-biochip-save-us-covid-can-control-human-dna

un docteur parle du vaccin ‘ARNm, OGM de Rossie qui peut modifier l’ADN humain https://resistance71.wordpress.com/2020/08/30/vaccin-cov19-et-passage-a-lhumain-2-0-un-avertissement-du-dr-carrie-madej-video/

Voici ce que la technologie Hydrogel peut faire (Rossie utisera la technologie Hydrogel pour introduire le vaccin ARN m modifié, l’ARN m modifié ne peut qu’être introduit par Hydrogel, elle est contenue dans l’hydrogel, et l’hydrogel est connecté à la 5G) la moitié de l’article https://www.zerohedge.com/technology/microchipd-darpa-biochip-save-us-covid-can-control-human-dna ci-dessous prouve que le vaccin sera connecté à la 5G avec la technologie hydrogel

Cette nouvelle technologie équivaut au contrôle à distance des processus biologiques. Diego continue : Dès 2006, la DARPA cherchait déjà à identifier les agents pathogènes viraux des voies respiratoires supérieures dans le cadre de son programme Predicting Health and Disease (PHD), qui a conduit à la création du Bureau des technologies biologiques (BTO) de l’agence, comme l’a rapporté Whitney Webb dans un article de mai pour The Last American Vagabond (donc en 2006, la Darpa créait et brevetait déjà les virus pour les mettre dans le vaccin).

En 2014, le BTO du DARPA a lancé son programme « In Vivo Nanoplatforms » (IVN), qui recherche les nanotechnologies implantables, conduisant au développement de l' »hydrogel ».

L’hydrogel est une nanotechnologie dont l’inventeur s’est très tôt vanté que « si cela fonctionne, avec l’approbation de la FDA, les consommateurs pourraient alors se faire implanter des capteurs dans leur cœur pour mesurer leurs niveaux de glucose, d’oxygène et de lactate ».

Ce matériau semblable à une lentille de contact nécessite l’introduction d’un injecteur spécial sous la peau où il peut transmettre des signaux numériques lumineux par un réseau sans fil comme la 5G.

Une fois fermement implantées dans l’organisme, les cellules humaines sont à la merci de tout programme d’ARNm délivré par ce substrat, ce qui ouvre un cauchemar de possibilités.

C’est peut-être la première véritable étape vers une transhumanisation totale. (Source) Patrick Tucker, de Defense One, explique plus en détail le fonctionnement de la biopuce.

Il la décrit comme suit : Le capteur est composé de deux parties. L’une est un cordon d’hydrogel de 3 mm, un matériau dont le réseau de chaînes de polymères est utilisé dans certaines lentilles de contact et autres implants.

Insérée sous la peau à l’aide d’une seringue, la ficelle comprend une molécule spécialement conçue qui envoie un signal fluorescent à l’extérieur du corps lorsque celui-ci commence à combattre une infection.

L’autre partie est un composant électronique fixé à la peau. Il envoie de la lumière à travers la peau, détecte le signal fluorescent et génère un autre signal que le porteur peut envoyer à un médecin, un site web, etc.

C’est comme un laboratoire de sang sur la peau qui peut capter la réaction du corps à la maladie avant la présence d’autres symptômes, comme la toux.

( donc le vaccin n’est pas là pour lutter contre le covid, il est là pour vous modifier génétiquement et envoyer des infos de votre corps au smartphone ou ordinateur du médecin qui aussitôt ordonnera votre quarantaine dans les camps de concentration nazi dès que vous serez victimes des effets secondaires des vaccins.

Les labos n’ont pas peur que les victimes des vaccins les attaquent en justice, car les labos les enfermeront dans les camps de concentration nazi, dès que la biopuce dans le vaccin signalera que la personne subit les effets secondaires des vaccins au médecin collabo des labos ou aux hôpitaux collabos des labos, ou aux labos eux mêmes , les labos ordonneront de se débarrasser de la victime des effets secondaires des vaccins et diront qu’elle est victime du covid au lieu du vaccin

c’est la raison pour laquelle ils ont admis dans ces articles

https://o.canada.com/health/covid-19-vaccine-efforts-provide-hope-but-no-silver-bullet-to-stop-pandemic-tam/wcm/f9c77d43-0719-4057-ba0a-dfc14c4bdf1a

https://thetyee.ca/Analysis/2020/06/03/Vaccine-Will-Not-Erase-Pandemic/ 

que les vaccinés continueront à subir les tests et les quarantaines et les masques, car le but du vaccin n’a jamas été de lutter contre le covid, mais de rendre malade les gens exprès et de donner ainsi un prétexte à plus de mises en isolements dans les camps d’exterminations nazis)

Vous ne serez pas surpris de savoir qui soutient cette initiative. Il est clair que ce projet est soutenu dans les couloirs du monde des affaires et par le gouvernement américain.

La société privée Moderna créée pour commercialiser cette technologie Hydrogel, qui permet de contrôler à distance les processus biologiques et ouvre la porte à la manipulation potentielle de nos réponses biologiques et, en fin de compte, de notre existence tout entière, s’appelle Profusa Inc et ses opérations sont financées à hauteur de millions par le NIH et la DARPA.

( donc non seulement les vaccins Moderna peuvent rendre malades avec les effets secondaires, mais ils peuvent également empirer vos effets secondaires à distance en ordonnant la destruction d’un de vos organes qu’ils ont choisi en se connectant à l’hydrogel du vaccin contenu dans votre corps et qui sera connecté à la 5G via l’hydrogel contenant l’ARNm modifié pouvant remodifier le génome à tout moment après l’avoir déjà modifié préalablement donnant les premiers effets secondaires lors de la première injecton des 2 doseshttp://www.cielvoile.fr/2020/10/les-participants-a-l-essai-de-la-phase-3-du-vaccin-covid-19-font-etat-de-migraines-et-de-fievre-d-une-journee.html, car oui, Bill Gates veut 2 doses pour donner plus d’effets secondaires pour chaque vaccin https://www.futura-sciences.com/sante/breves/coronavirus-selon-bill-gates-il-faudra-moins-deux-doses-vaccin-personne-coronavirus-2950/et il veut que tout le monde prenne un nouveau vaccin covid de 2 doses chacune chaque année

https://www.vox.com/2020/6/3/21258841/coronavirus-vaccine-covid-19-testing-usa-china-moderna https://jbl1960blog.files.wordpress.com/2020/08/vaccins-methode_du_cataplasme.pdf

Bill Gates patron de l’OMS https://www.asso-malades-thyroide.fr/wordpress/index.php/2019/04/09/organisation-mondiale-de-la-sante-la-fondation-gates-est-maintenant-le-deuxieme-plus-grand-bailleur-de-fonds-apres-le-gouvernement-americain/veut avoir ses 500 millions d’habitants le plus vite possible )

En mars, la société s’est discrètement insérée dans le bazar bondé de COVID-19 en mars 2020, lorsqu’elle a annoncé une biopuce injectable pour la détection des maladies respiratoires virales, dont COVID-19.

(Source) Diego écrit, Le seul obstacle est un système d’administration, qui, bien que Moderna affirme le développer séparément, n’obtiendra probablement pas l’approbation de la FDA avant que la technologie d’hydrogel développée par le gouvernement fédéral lui-même, en tandem avec la technologie de capteurs de lumière de Profusa financée par la DARPA, ne reçoive une autorisation rapide de la Food and Drug Administration d’ici le début de 2021 et, plus que probablement, ne soit utilisée pour déployer un vaccin contre les coronavirus ayant la capacité de changer littéralement notre ADN.

En outre, le ministère de la santé et des services sociaux (HHS), enquête actuellement sur les dépôts de brevet de Moderna, affirmant qu’il a omis de divulguer le « soutien du gouvernement fédéral » dans ses demandes de brevet pour le vaccin COVID, comme l’exige la loi. ( Moderna a déjà signé le contrat avec l’UE, cela montre que le vaccin Moderna contenant la technologie Hydrogel de DARPA a déjà été approuvé, ils font semblant de dire qu’ils sont encore en train de vérifier qu’ils n’ont pas encore accepté, pour faire croire qu’ils sont sérieux et démocratiques, hypocrites )

Cette technicalité pourrait faire en sorte que le gouvernement fédéral détienne une participation de 100 % dans l’ARNm-1273. (Source)( donc ils ont ralenti, juste parce que les USA veulent avoir leur part dans le pognon des vaccins de Moderna, combien de pourcentage les USA vont gagner sur chaque vaccin Moderna modifiant génétiquement chaque génome d’humain sur terre, et altérant la santé de chaque humain sur Terre? Et envoyant chaque humain sur terre dans les camps de concentration en altérant leur santé à distance va la 5G connecté à l’hydrogel de DARPA des USA dans le vaccin de Moderna?)

Prenez une micropuce ou faites face aux conséquences. Les militants et les citoyens concernés doivent cesser de parler de la « future micropuce » et de la façon dont ils refuseront d’être pucés le moment venu.

Ce moment est venu. Bientôt, les gens du monde entier auront une décision très difficile à prendre : prendre une micropuce ou faire face aux conséquences judiciaires.

À en juger par le nombre de personnes qui se promènent avec un masque lors de mes voyages au supermarché, je dirais que les chances ne sont pas en faveur de l’humanité libre.

La plupart des gens feront la queue de leur plein gré.

Note : Écoutez le chercheur Alan Watt de CuttingThroughTheMatrix.com parler de la biopuce et de bien d’autres choses encore dans un contexte historique et analytique ici

https://youtu.be/yJ29q05WJRw

https://www.zerohedge.com/technology/microchipd-darpa-biochip-save-us-covid-can-control-human-dna

voilà donc pourquoi ils se sont dépêchés d’installer la 5G durant le confinement, en étape préalable avant le vaccin hydrogel connecté à la 5G et contenant l’ARN m pour modifier le génome humain

ils osent dire qu’ils compenseront généreusement les victimes des vaccins avec l’argent public en haussant les impôts des français, alors que les labos, eux qui sont les créateurs de ces vaccins tueurs ne débourseront pas un centime? Ils se fichent de la gueule du monde ou quoi, ces gouvernements lobbyfiés aux labos, protégeant à 100% l’intérêt des labos

n’oublions pas que ce sont les mêmes labos qui font les tests et les vaccins
donc ils veulent mettre le plus de tests positifs possibles pour imposer leurs vaccins toxiques non assurés à plus de monde possible

Les labos ont des kits de faux positifs en stock
http://www.cielvoile.fr/2020/05/kits-de-tests-contamines-aux-etats-unis.
html
http://www.cielvoile.fr/2020/04/des-kits-de-test-destines-au-royaume-uni-contamines-au-covid-19.html http://www.cielvoile.fr/2020/05/kits-de-tests-contamines-au-canada.html,
https://www.ouest-france.fr/sante/virus/coronavirus/coronavirus-des-tests-de-depistage-commandes-par-le-royaume-uni-contamines-par-le-covid-19-6798277
https://ici.radio-canada.ca/nouvelle/1696091/test-depistage-ecouvillons-covid-19-contamines-chine-quebec
http://www.rfi.fr/fr/afrique/20200516-coronavirus-institut-pasteur-reconna%C3%AEt-dysfonctionnements-tests-analyse

le labo institut pasteur a des kits neufs de tests déjà positifs avant usage
http://www.rfi.fr/fr/afrique/20200516-coronavirus-institut-pasteur-reconna%C3%AEt-dysfonctionnements-tests-analyse

le français Sanofi Pasteur et le britannique Astranezeca et d’autres labos ont demandé à l’UE d’être exonérés de toute responsabilité en cas d’effets secondaires du vaccin covid, ce qui prouve que leur vaccin covid sera toxique
https://www.insurancejournal.com/news/international/2020/09/22/583555.htm

Donc les labos donneront de faux tests positifs à ceux qu’ils veulent éliminer pour leur imposer leur vaccin toxique non assuré

Dr Fauci avoue qu’il ne se vaccine pas, qu’il utilise la vitamine C et D pour se prémunir du covid https://www.businessinsider.in/science/health/news/dr-fauci-says-he-takes-vitamin-d-and-c-supplements-and-that-they-can-lessen-your-susceptibility-to-infection/articleshow/78069353.cms (source censuré), mais cela ne l’empêche pas de cet hypocrite de faire une loi pour imposer le vaccin aux américains et une autre loi pour indemniser les labos de toute responsabilité sur les effets secondaires des vaccins https://www.phe.gov/Preparedness/legal/prepact/Pages/COVID19.aspx

Ils ont même censuré une vidéo où Bill Gates réclamait d’être exonéré de responsabilités sur les vaccins covid
https://childrenshealthdefense.org/news/heres-why-bill-gates-wants-indemnity-are-you-willing-to-take-the-risk/

Aucun labo veut prendre responsabilité sur les effets secondaires des vaccins
donc tous les vaccins sont toxiques par définition, vu qu’aucun labo ne veut prendre la responsabilité des effets secondaires,
donc même si les vaccins entrainent un décès, les labos ne seront pas responsables donc les labos ont le permis légal de tuer tout individu sur Terre sans aller en prison (montre que notre société enferme les bonnes gens mais laisse les criminels diriger le monde)
https://www.capital.fr/entreprises-marches/vaccins-contre-la-covid-lue-indemnisera-les-laboratoires-en-cas-deffets-secondaires-inattendus-1379072

Tedros Adhanom Ghebreyesus directeur de l’OMS  a été membre du bureau politique Tigray People’s Liberation Front (TPFL), une organisation inscrite dans la liste des organisations terroristes du US Homeland Security.https://lesobservateurs.ch/2020/04/25/bill-gates-a-installe-un-terroriste-genocidaire-a-la-tete-de-loms/

L’OMS DECLINE (…) TOUTE RESPONSABILITE OU RESPONSABILITE DE QUELQUE NATURE QUE CE SOIT EN CAS DE DECES, D’INVALIDITE, DE BLESSURE, DE SOUFFRANCE, DE PERTE, DE DOMMAGE OU DE TOUT AUTRE PREJUDICE DE QUELQUE NATURE QUE CE SOIT POUVANT RESULTER DE OU EN RELATION AVEC L’ACHAT, LA DISTRIBUTION OU L’UTILISATION DE TOUT PRODUIT INCLUS DANS L’UN DES CES DOCUMENTS DE VACCIN CONTRE LE COVID

https://www.who.int/publications/m/item/draft-landscape-of-covid-19-candidate-vaccines

voici des infos qui montrent que les nanorobots dans le vaccin dont elle parle https://resistance71.wordpress.com/2020/08/30/vaccin-cov19-et-passage-a-lhumain-2-0-un-avertissement-du-dr-carrie-madej-video/et qui transmettra des infos sur votre corps à votre smartphone est fort possible, vu qu’en 2017, ils avaient déjà créé les médicaments intelligents qui envoient des infos de votre corps au smartphone une fois avalée dans l’estomac

En 2017, Les industries pharmaceutiques ont commencé à implanter des micro-puces RFID (dispositif d’identification par radiofréquence) dans les médicaments brevetée par Proteus Biomedical à Redwood City, Californie. Une fois activée par l’acide de l’estomac, la micro-puce ingérée commence à détecter son environnement et à émettre des données à un récepteur utilisé par le patient. Ce récepteur est également un émetteur qui peut envoyer les données par Internet à un médecin.

L’idée derrière tout cela est de créer des ″pilules intelligentes″ qui peuvent détecter ce qu’il se passe dans le corps et délivrer cette information au médecin du patient. Novartis a commencé à micro-pucer ses médicaments anti rejet de transplantation d’organe et applique aujourd’hui ce procédé à d’autres produits de sa gamme pharmaceutique, dont notamment le Diovan, utilisé pour réguler la pression artérielle. Cette même technologie se retrouve également dans des pilules fabriquées par d’autres sociétés pharmaceutiques.

http://www.brujitafr.fr/2017/03/les-medicaments-intelligents-qui-vous-surveillent.html


Bill « la piquouze » engrange le flouze

Médicament intelligent : bientôt des batteries comestibles

On peut imaginer que ces appareils pourront alors surveiller l’évolution d’une blessure et/ou d’une maladie (remarque la malade ou la blessure est causé par les batteries elles mêmes, causer eux même les maladies avec leurs inventions) et libérer des médicaments (donc peuvent empoisonner le corps à distance en déclenchant les batteries à distance) . Ces batteries pourraient aussi faciliter la pose de détecteurs et de stimulateurs cardiaques (donc peuvent causer une crise cardiaque à distance), poursuit le MIT technology review. (MIT= Bill Gates) https://www.topsante.com/medecine/medicaments/grandes-familles-de-medicaments/medicamentintelligent-bientot-des-batteries-comestibles-52069

2017, Le premier médicament intelligent qui vous surveille

L’agence sanitaire américaine vient de donner son feu vert à l’utilisation d’un médicament « intelligent » qui permet de vérifier le suivi d’un traitement par les patients

Une pilule intelligente, la première de ce type, contenant un capteur qui envoie un signal radio au patch porté par le patient. Le capteur, de la taille d’un grain de sel, est libéré une fois la pilule dissoute dans l’estomac, explique Sciences et avenir. https://www.ledauphine.com/france-monde/2017/11/16/le-premier-medicament-intelligent-qui-vous-surveille

http://www.brujitafr.fr/2017/03/les-medicaments-intelligents-qui-vous-surveillent.html

Moderna et l’institut pasteur ont signé un accord pour créer des vaccins avec de l’ARN modifié synthétique

https://www.pasteur.fr/fr/moderna-institut-pasteur-signent-accord-recherche-collaborative-strategique-0

L’institut Pasteur collabore aussi avec Bill Gates

https://www.pasteur.fr/en/press-area/press-documents/bill-melinda-gates-medical-research-institute-and-institut-pasteur-develop-novel-vaccine-against

Astranezeca a 7,7% d’actions sur Moderna

https://www.marketwatch.com/story/astrazeneca-made-a-bet-on-moderna-back-in-2013-heres-what-its-worth-now-2020-05-20

https://www.thetimes.co.uk/article/astrazeneca-investment-in-moderna-hits-2bn-as-vaccine-hopes-soar-pjt3x3lpl

La France et l’UE a promis à Astranezeca que l’entreprise ne paiera aucun dommage en cas d’effets secondaires de son vaccin

https://www.reuters.com/article/us-astrazeneca-results-vaccine-liability-idUSKCN24V2EN

https://www.commondreams.org/news/2020/08/27/astrazeneca-signs-deal-eu-critics-warn-big-pharma-push-covid-vaccine-liability

Astranezeca est financée par Bill Gates

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

Le Dr Slaoui est un ancien directeur du labo de vaccin GlaxoSmithKline et il vient d’être nommé par Trump être chef de l’opération « Warp Speed » pour créer des vaccins à grande échelle

https://en.wikipedia.org/wiki/Moncef_Slaoui

Le Dr Slaoui était aussi un ancien membre du conseil d’administration de Moderna, Inc. comme on le voit ici :

Si Moderna n’est pas une société pharmaceutique « du bout de la langue », Washington la connaît en fait très bien.  Voici une annonce de Moderna datée du 16 avril 2020 :

Grâce aux contribuables américains, la société a bénéficié d’un « don » de 483 millions de dollars de la Biomedical Advanced Research and Development Authority ou BARDA, qui fait partie du ministère de la santé et des services sociaux, comme le montre cette photo :

Non seulement Moderna a bénéficié de la générosité des contribuables américains, mais elle a aussi bénéficié de celle de la Fondation Bill & Melinda Gates, comme le montre cette photo.

Comme si ces liens ne suffisaient pas, le Dr Slaoui est également lié à la Fondation Gates par sa position au sein du conseil d’administration de l’Initiative internationale pour un vaccin contre le sida (IAVI), comme le montre cette photo.

Je parie que vous ne pouvez pas deviner qui finance l’IAVI ?  C’est exact, la Fondation Bill & Melinda Gates, comme vous pouvez le voir ici.

Le calendrier de Moderna pour le développement de son vaccin à ARNm-1273 toxique tueur (le labo refuse d’être responsable en cas des effets secondaires, il créé le vaccin tueur en utilisant les fonds publics américains, et les effets secondaires seront également payés sur les fonds publics des citoyens du monde)

https://fort-russ.com/2020/05/exposed-bill-gates-funding-partnerships-and-moderna-americas-tangled-vaccine-web/

Pour le Docteur Thomas Borody, le covid est plus facile à traiter que la grippe Sur la base des recherches existantes et selon sa propre analyse des résultats thérapeutiques utilisant l’Ivermectine en combinaison avec 2 autres molécules largement disponibles – la Doxycycline et le zinc -, il affirme que le COVID-19 est désormais soignable et encore plus facile à traiter que la grippe. http://resistance-verte.over-blog.com/2020/08/une-tritherapie-pour-guerir-a-100-du-covid.html

Une chinoise de 98 ans de Wuhan guérit du coronavirus, cela montre que les traitements marchent même pour les vieux de près de 100 ans

https://nypost.com/2020/03/02/98-year-old-chinese-woman-cured-of-coronavirus-in-wuhan/

Mais ils font croire que les traitements n’existent pas, pour imposer leurs faux vaccins tueurs dont les labos refusent d’être responsables en cas d’effets secondaires https://www.capital.fr/entreprises-marches/vaccins-contre-la-covid-lue-indemnisera-les-laboratoires-en-cas-deffets-secondaires-inattendus-1379072

Les milliardaires ont plus d’argent que 60% de la population de la planète, selon Oxfam

https://www.capital.fr/entreprises-marches/les-milliardaires-ont-plus-dargent-que-60-de-la-population-de-la-planete-selon-oxfam-1360077

le Canada, le Royaume-Uni, l’UE soutiennent l’ONU dans son accaparemment des 30% de la planète au profit des millardaires qui contrôlent Canada, Royaume-uni, union européenne en donnant les fonds publics de leurs citoyens respectifs à l’ONU pour qu’il chasse les indigènes et donne les 30% de la planète aux milliardaires de l’ONU à la place

https://www.fr24news.com/fr/a/2020/09/le-canada-la-grande-bretagne-et-lue-sengagent-a-proteger-30-des-terres-et-des-mers-dici-2030-pour-mettre-fin-a-la-perte-de-biodiversite-catastrophique.html

l’ONU veut s’accaparer 30% de la planète pour son agenda 2030 qui sera décidé en mai 2021 (au même moment que les vaccins tueurs car un vaccin non assuré et dont les labos ont même demandé à être exonérés de toutes responsabilités, cela revient à avouer qu’ils ne croient pas que leurs vaccins soient sûrs, et si les vaccins ne sont pas sûrs, cela veut dire qu’ils peuvent tout faire comme effets secondaires, y compris tuer) lors de la COP15, en Chine à Kenming

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

et parmi les membres de l’ONU, il y a Sanofi Pasteur, qui possède le global Compact de l’ONU et également Astranezeca , Pfizer (dont l’ancien directeur a reconnu que Pfizer faisait aussi des faux positifshttps://reseauinternational.net/lancien-directeur-scientifique-de-pfizer-declare-que-la-deuxieme-vague-a-ete-truquee-lors-de-tests-covid-faussement-positifs/)

https://www.unglobalcompact.org/what-is-gc/participants/8189-Sanofi

https://www.unglobalcompact.org/what-is-gc/participants/10494

https://www.unglobalcompact.org/what-is-gc/participants/7375-Pfizer-Inc-

Astranezeca est financée par Bill Gates

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

L’institut Pasteur collabore aussi avec Bill Gates

https://www.pasteur.fr/en/press-area/press-documents/bill-melinda-gates-medical-research-institute-and-institut-pasteur-develop-novel-vaccine-against

https://resistance71.wordpress.com/2020/08/30/vaccin-cov19-et-passage-a-lhumain-2-0-un-avertissement-du-dr-carrie-madej-video/#comments

Pfizer financé par Bill Gates

https://thenextweb.com/hardfork/2020/07/20/bill-gates-coronavirus-vaccine-pfizer-biontech-stock-first-secure-agreement-uk/

Pfizer et Bill Gates collaborent pour stériliser les femmes

https://www.reuters.com/article/us-pfizer-gates-contraception-idUSKCN0IX1WF20141113

Suffit de taper le nom d’un labo de vaccin avec global compact ONU dans le moteur de recherche, vous verrez que tous les labos de vaccins sont officiellement des membres de l’ONU, donc tout ce que l’ONU s’accapare sur Terre, ils en récolteront une partie, voilà pourquoi ils sont pour la dépopulation mondiale

plus il y a de tests positifs, plus il y aura de vaccinés, pas étonnant que les labos qui créent à la fois les tests et les vaccins, en profitent pour faire un maximum de faux positifs, c’est pour pouvoir vendre leurs vaccins toxiques

aucun labo ne peut être tenu pour responsable de quoi que ce soit des effets secondaires des vaccins, y compris pour les décès…

Elle est pas belle la vie côté oligarchie ?… Peuvent faire tout et n’importe quoi en toute impunité !

Posons la n-ième fois la question : combien de temps allons-nous encore les laisser faire ?

Lutter contre la 5G, car ils ont besoin d’installer la 5G avant les vaccins

Voici 6 moyens de lutte contre la 5G dans cet article

https://resistance71.wordpress.com/2020/09/29/dictature-technotronique-le-passage-4g-5g-sera-extremement-energivore-et-plombera-les-budgets-en-plus-de-detruire-notre-peu-de-liberte-et-de-sante-restant/

= = =

Lectures complémentaires :

Dossier-coronavirus-cov19-experience-ingenierie-sociale

Affaire CoV19 OGM

Masque_Non-au-muselage-sanitaire

Bill-la-piquouze-Gates-et-son-empire-mondial-de-la-sante

Illegalite_Amendes_non-port_masque

COVID 19_version finale 2020_08_25

stoppons-les-delires-technotroniques-sept20

HistoriqueCartelPharmaceutique

SARS-CoV_UCN

Reprise 10 : Coronavirus : Une analyse sur l’organisation minutieuse d’un massacre…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, guerres imperialistes, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , on 10 septembre 2020 by Résistance 71

 

 

Coronavirus : Une organisation minutieuse du massacre ?

 

Jean-Yves Jézéquel

 

30 août 2020

 

url de l’article original :

https://www.mondialisation.ca/coronavirus-une-organisation-minutieuse-du-massacre/5648789

 

On peut tourner dans tous les sens la question de savoir, à qui peut donc profiter cette hystérie collective d’un COVID-19 menaçant nos vies alors que tous les indicateurs commentés par des épidémiologistes de renom nous disent que rien ne justifie ces « mesures » délirantes prises par les « gouvernants » !

A première vue, dans ce jeu stupide que le monde entier est en train de jouer, tout le monde est perdant ! Si tout le monde est perdant, qui donc peut être gagnant, puisque l’hystérie est entretenue à dessein et les « autorités » persistent et signent ! C’est quoi l’objectif au-delà des apparences selon lesquelles tout le monde serait perdant ?

Reprenons un à un les éléments de cette hystérie collective.

1 – La « distanciation sociale » !

Le sens de la « distanciation » dite « sociale », n’est explicable que si l’on comprend l’importance pour les prédateurs de l’aristocratie stato-financière – à l’origine de ces mesures qu’ils se permettaient ouvertement de ne pas respecter eux-mêmes sachant parfaitement que cette opération de grande envergure n’avait rien à voir avec un souci sanitaire – de creuser davantage le fossé entre les classes « favorisées » et la masse du peuple des « défavorisés ». Cette « distanciation » toujours en vigueur a pour effet immédiat et efficace, la division, l’opposition, la confrontation et l’ensauvagement qui s’en suit. 

« L’autre » se transforme alors en porteur sain mais coupable a priori. « L’autre », c’est celui-là qui ne respecte pas les règles. « L’autre », c’est celui-là qui n’est pas patriote et qui se permet donc de remettre en cause la version officielle de la vérité, puisque le pouvoir est obligatoirement « innocent ». « L’autre » c’est celui qui est moins propre que « moi », le discipliné, le bon citoyen, le « responsable ». « L’autre » c’est celui qui est dans la dissidence, dans la révolte, dans la contestation, dans la rébellion ou la délinquance et qui est incapable de se montrer respectueux des règles, adulte discipliné. « L’autre » c’est celui qui est irresponsable. « L’autre » ne se soucie guère de la bonne santé de tous, c’est un « égocentrique ». « L’autre » est donc un ennemi qu’il faudra dénoncer, chasser, harceler, poursuivre, persécuter et abattre. 

« La distanciation sociale » crée un comportement qui oblige chacun à considérer « l’autre » comme son ennemi ! Chacun peut donc devenir le tueur de l’autre. Chacun est placé d’office dans cette posture d’abord « inconsciente », mais qui ne peut que se transformer en folie furieuse dès que le coup de sifflet du maître chanteur aura été donné…

2 – Le masque par précaution sanitaire !

Chacun de nous peut se demander, pourquoi dois-je porter un masque quasi en permanence dans la vie réelle de tous les jours, alors que je ne suis pas malade !?

Réponse officielle : parce que, étant discipliné et responsable je me soucie de la santé des autres, tout en me protégeant moi-même.

Mais si chacun se sait non malade, comment peut-il contaminer l’autre sans être d’abord malade et comment tous les autres qui ne sont pas plus malades que moi pourraient-ils me contaminer sans être eux-mêmes malades au préalable ? Je suis donc invité à penser que tous ces gens qui portent le masque sont forcément malades et donc menaçants !

Le masque est clairement une absurdité sur le plan sanitaire, car de plus, il n’est plus à démontrer que le masque, porté dans les conditions quotidiennes qui sont les nôtres, ne protège ni soi-même ni les autres de quoi que ce soit : le motif sanitaire est parfaitement bidon.

Non seulement le masque est inutile sur le plan sanitaire, mais il est même tout le contraire : il est nuisible, il constitue en soi une menace sanitaire pour celui qui le porte.

Puisque les « autorités » l’ont elles-mêmes répété à foison « que le masque ne servait à rien, qu’il était inutile d’en porter, puis qu’il était interdit d’en porter », jusqu’à infliger des amendes et de la prison à ceux qui en portaient, à l’époque où commençait cette hystérie nommée par une étude du ministère de l’Intérieur allemand, « une fausse alerte de pandémie », il faut donc bien comprendre que le but du port du masque obligatoire n’est pas du tout une mesure sanitaire, mais une mesure politique destinée à placer chacun dans la position d’être l’ennemi de l’autre : tout est prêt pour s’entretuer… J’ai moi-même déjà été insulté et menacé dans la rue par des gens ordinaires, « non assermentés » et faisant pourtant le travail de la police, parce que je ne portais pas le masque. La délation est déjà en route et cette mentalité détestable est toujours vivante chez un nombre incroyable de demeurés.

3 –  Le « confinement » dit sanitaire !

On se souvient, je l’espère, de l’insurrection des Gilets Jaunes et de tous les autres mouvements sociaux engagés partout dans le monde face à une oligarchie aux abois, se sentant menacée par la montée de la rébellion des peuples.

Face à une telle détermination des populations les plus défavorisées, il allait de soi que la répression violente des Etats, (les violences policières et judiciaires, toutes les horreurs des injustices administratives, la perte de toutes les libertés publiques, cet ensemble de violences gratuites que nous avons dénoncées depuis 2018), ne pourrait pas éviter à un moment donné, l’escalade de cette violence, encouragée d’ailleurs par des privilégiés du « camp » des préfet Lallement, des Cohn Bendit, des Luc Ferry, des BHL et d’un certain nombre de journalistes Kapos, jusqu’à la nécessité d’une organisation d’un massacre, parfaitement logique et inévitable pour un pouvoir contesté et menacé à ce point.

Ce moment crucial du « massacre » était venu : il fallait faire quelque chose pour briser cette révolte coûte que coûte.

Les maîtres du monde avaient vu venir ce moment et déjà depuis l’expérience du H1N1, ils en avaient tiré les leçons, sachant désormais ce qu’il fallait faire et ce qu’il ne fallait pas faire. 

Dans cette organisation du dressage, l’idée d’une pandémie bien préparée était géniale, machiavélique, car elle pouvait légitimer une « assignation à résidence » appelée « confinement », imposée d’office à toutes les populations du globe. En un quart de tour, toutes les révoltes, manifestations, insurrections ont été bâillonnées ; nous avons tous été considérés comme des criminels placés sous les verrous (cela s’est fortement ressenti davantage pour les citadins sans jardin ni terrasse, comme cela a été le cas de beaucoup d’Espagnols en particulier, l’Espagne ayant été le pays qui a expérimenté le confinement le plus radical) en nous persuadant de nous enfermer nous-mêmes et en culpabilisant tout « irresponsable » qui ne se plierait pas à cette consigne, elle aussi absolument absurde, puisque l’on sait scientifiquement aujourd’hui que ce sont ceux qui ont le moins « confiné » qui ont été les moins affectés par ce délire hystérique sur le coronavirus orchestré par les prédateurs au pouvoir… (Cf.,  Intervention de la Généticienne Alexandra Henrion-Caude, chercheur à l’INSERM, sur TVL du 31 juillet 2020 ; Cf., l’intervention radiodiffusée (SUD-RADIO) du professeur de médecine J-F Toussaint de l’Université de Paris, qui ose dénoncer l’activité louche de l’Organisation Mondiale de la Santé (OMS). Il a pointé précisément la manipulation occulte des grandes puissances économiques dans l’affaire de l’hystérie populiste pandémique et il y qualifie le confinement « d’arme de destruction massive ».

Le Professeur Jean-François Toussaint récidivait sur le plateau de CNEWS le 18 août 2020 en disant que « Nous sommes actuellement dans l’instrumentalisation, l’utilisation des indicateurs qui vont influencer les membres du Conseil Scientifique en charge d’adapter les comportements de la société, mais plus en relation avec la réalité, avec le risque réel de pandémie, mais en relation avec une volonté explicite d’imposer aux gens d’autres schémas de pensée ».

Il faut également dire et redire, répéter en insistant sur les chiffres qui sont aujourd’hui à notre disposition, que la courbe de la pandémie a été exactement la même dans les pays qui n’ont pas confiné que dans les pays qui ont confiné. Le confinement a été une arme de destruction massive un point c’est tout, et tous ceux qui persistent à dire que le confinement a limité le nombre de morts, sont parfaitement malhonnêtes ou idiots, puisque nous pouvons consulter les chiffres aujourd’hui à notre disposition, disait encore le Professeur J-F Toussaint qui renvoyait les auditeurs aux publications à travers le site de la Santé Publique Française.

On se demande qui sont ces gens qui mettent si longtemps à ouvrir les yeux et quels sont leurs problèmes personnels pour qu’ils puissent encore croire aveuglément à l’innocence du pouvoir et se fier à sa parole sans aucun esprit critique ! Je pensais ces temps révolus, mais ce n’est pas le cas. Des millions de personnes à travers le monde attendent comme le « messie » le vaccin salvateur qui va les délivrer de ce cauchemar ! Même des docteurs en médecine, universitaires, sont capables d’un tel comportement en étant « sincèrement » persuadés que le système ne peut ni se tromper ni les tromper ! Un troupeau de moutons peut marcher silencieusement vers l’abattoir sans chercher à s’échapper !

La seule explication que je trouve à ce mystère de la défaillance de l’intelligence, c’est la question de la croyance. Lorsque la croyance est en cause, la raison n’a plus rien à dire, même si les gens qui affirment sincèrement leur « croyance » restent persuadés d’être dans une pensée rationnelle ! Toucher à une croyance entraîne aussitôt une intolérance, un jugement, une condamnation prononcée contre l’incroyant et son exécution est aussitôt organisée considérant que la fin justifie tous les moyens : le discrédit, la raillerie, le lynchage, les accusations arbitraires de « délire », de « complotisme » ou de « populisme », le discours moralisateur, donneur de leçons, les menaces de répression, bref, des accusations traditionnelles de l’inquisition qui permettent de ne rien remettre en cause sur sa croyance. La croyance maintient toujours le croyant dans une forme ou l’autre de l’arriération mentale puisque toute croyance exclut d’emblée la place essentielle de la raison critique : c’est la raison pour laquelle on l’appelle « croyance ».


Avec Bill « la piquouze »
Big Pharma engrange le flouze

 4 – La vaccination but final de la « libération » des peuples maltraités !

Concernant la vaccination, c’est la cerise sur le gâteau !

Le Pr Toubiana chercheur à l’INSERM expliquait sur BFMTV le 26 août 2020 qu’il n’y avait pas d’épidémie infectieuse, à sa connaissance il n’avait observé qu’une épidémie d’angoisse généralisée à travers le monde, alimentée et entretenue par l’OMS. Il expliquait qu’une épidémie sans malades ne peut pas exister. Qu’il y ait eu confinement ou pas confinement la courbe épidémique était exactement la même concernant la période qui a vu venir cette nouvelle forme de grippe. La courbe de la Suède qui n’a pas confiné est exactement la même que celle de l’Espagne, de l’Italie ou de la France qui ont confiné.

Il rappelait également que aucun test actuellement existant n’est fiable en ajoutant que le SARS-COV-2, n’a jamais été identifié par aucun test. De plus les morts soi-disant « par coronavirus » n’ont jamais été autopsiés car l’autopsie a été interdite ! Par qui a-t-elle été interdite et pourquoi a-t-elle été réellement interdite ? Les spécialistes comme le Pr Toubiana, le Pr Perronne, le Pr Raoult, le Pr J-F Toussaint, en France ; le Pr Yoram Lass en Israël ; le Dr Luis de Benito de l’Hôpital El Escorial de Madrid dénonce à la télévision la manipulation honteuse qui est faite sur les chiffres des morts par « coronavirus » ; le Dr Nicole Delépine, en France ; le Dr Carrie Madej , aux Etats-Unis ; Le Dr Larry Palevsky à la Commission Européenne lors d’une audition publique, le 19 février 2020, expliquait déjà que le système immunitaire ne faisait plus la différence entre ce qu’il devait éliminer et ce qui lui appartenait, il était donc question d’une immunodéficience; le Dr Roberto Patrella, en Italie ; le physicien David Mendels dans une interview sur Le Média du 9 juin 2020… disent les uns et les autres dans les écrits ou commentaires, interviews sur les télévisions ou sur Youtube, que 90% des personnes testées seront forcément positives puisque c’est la normalité : nous sommes tous porteurs sains de plusieurs formes de coronavirus. Quelqu’un déclaré positif n’est pas automatiquement un malade, dans le cas contraire, nous serions au moins 90% de malades.

Le COVID-19 n’est pas le nom du virus c’est le nom du plan international de contrôle et de réduction des populations. L’objectif est un dépeuplement massif de 80% de la population mondiale. 


Avec Henry et Bill
le génocide facile…

Henry Kissinger dans une conférence sur l’eugénisme à l’OMS, le 25 février 2009 disait : « Une fois que le troupeau a accepté la vaccination obligatoire, la partie est gagnée ! Ils vont alors accepter n’importe quoi, ‘pour le plus grand bien’. On pourra modifier génétiquement les enfants ou les stériliser – ‘pour le plus grand bien’. Contrôler le mental du mouton et vous contrôlez le troupeau. Les fabricants de vaccins peuvent s’attendre à faire des milliards, et plusieurs d’entre vous, êtes dans cette salle des inventeurs. C’est un énorme jeu gagnant-gagnant ! On diminue le troupeau et le troupeau nous paie pour leur fournir des services d’extermination. » 

NdR71 : Cette citation de Kissinger est hautement controversée et serait une « légende urbaine ». Kissinger a dit un tas de saloperies, mais ça en public, est sans doute un peu poussé. De plus, il n’y a pas de « conférence sur l’eugénisme » à l’OMS, rappelons que depuis la seconde guerre mondiale, ce terme a été remplacé, le plus souvent par « génétique »… Il n’y a pas d’archive de cette déclaration, ceci dit, l’avait-il fait en privé, rien d’étonnant, mais improuvable. Ceci dit Kissinger et Bill Gates sont comme cul et chemise, donc…

Le 25 août 2020, sur fr.sott.net, le Dr Carrie Madej explique dans le détail le danger de la nanotechnologie utilisée dans le vaccin COVID-19. Chacun peut aller voir cette vidéo instructive, s’il a envie de savoir !

Pour finir, nous allons regarder ce que contiennent ces fameux vaccins qu’on nous prépare et qu’on voudrait rendre obligatoires !

Le Pr J.B. Fourtillan, le Dr Serge Rader, le Dr C. Tal Schaller se sont penchés sur la question. Dans une vidéo qui est diffusée sur www.verite-covid19.fr, on peut trouver les références de tout ce qui est détaillé dans cette analyse.

On découvre tout d’abord le Brevet W0 2020.060606A1 du 26 mars 2020 déposé par Microsoft dans quasi tous les pays du monde. Ce brevet concerne la « cryptocurrence ».

Ce sont des nanoparticules qui sont ajoutées dans le flacon des vaccins. Les nanoparticules sont donc injectées avec le vaccin et il est impossible de s’en débarrasser : elles habiteront le corps du vacciné jusqu’à sa mort.

N’importe quel téléphone portable pourra communiquer avec ces nanoparticules et chaque vacciné sera sous surveillance permanente grâce à son téléphone ou à n’importe quel téléphone passant à proximité.

On trouve donc dans ce vaccin : 4 fragments du VIH1 : ceux-ci entraînent une immunodéficience et ses conséquences…

On y trouve également des séquences d’ADN du germe de la Malaria ; 157 séquences ADN et des protéines sous le brevet US8,243,718B2 : ni leur présence ni leur rôle ne sont expliqués dans ce vaccin… Enfin, on y trouve donc des nanoparticules qui permettront comme on l’a dit une surveillance permanente des individus. 

Un autre vaccin : le ChAdOx1 n-CoV-19 contient lui le covid-19 porté par le vecteur du virus ChAdOx1.

Les nanoparticules décrites dans le brevet Microsoft PCT/US2019/038084, sont présentes dans ce vaccin à partir duquel un contrôle sera possible et permanent grâce à la technologie 5G.

On y trouve également des désinfectants : le Thimerosol ou Formaldehyde et des antibiotiques. La création forcée d’une immunodéficience entrainera l’impossibilité de se défendre naturellement contre toute maladie virale.

5 –  Les morts « par coronavirus »

Tous les chiffres sur les morts « par coronavirus » sont faux, partout dans le monde. Une falsification volontaire est réalisée partout dans le monde : un médecin généraliste de Lille, en France, Bruno Vermesse, écrivait au ministère de la santé et au responsable de la santé en demandant l’autorisation de faire les contrôles qui s’imposaient pour en avoir le cœur net sur le soi-disant virus mortel. On lui répondait que les procédures auxquelles il voulait avoir accès étaient interdites ! Pourquoi étaient-elles interdites ? Pas d’explication du ministère de la santé…

« Je demandais de pouvoir faire une sérologie chez tous patients avec PCR positif pour détecter les faux positifs… Pas le droit !!! En clair… les PCR positifs ne sont jamais symptomatiques et les symptomatiques n’ont jamais de PCR positif… Si on teste massivement, évidemment qu’on va trouver des PCR positifs chez les gens guéris…

Rappelons que, en revanche, avec tout cela ce sont des avalanches de dépressions, des suicides en masse et des prises en charge catastrophiquement retardées pour des maladies graves…

Cette épidémie a été dix fois moins grave que celle de la grippe de 2017/2018… »

Si une falsification explicite n’est pas faite délibérément, elle est réalisée en faisant une confusion volontaire entre « mort avec le covid-19 » et « mort à cause du covid-19 »… 

Le ministre de la santé en Grande-Bretagne a demandé aux services de santé de revoir intégralement leur manière de compter les morts par covid-19, car « de toute évidence, les calculs étaient largement inexacts », disait-il récemment.

Des milliers de kits de test ont été découverts déjà pré-contaminés au covid-19. (Cf., Dr Carrie Madej, sur Youtube du 27 juillet 2020)

Je recommande encore la lecture du dossier « coronavirus » publié par www.mondialisation.ca, car il est très fouillé, très complet et très documenté. Les meilleurs spécialistes s’y expriment et chacun peut se faire une idée précise sur une campagne dans laquelle la confusion a volontairement régné à tout moment pour maintenir les gens dans la pétrification de la peur, ennemi numéro un de la raison.


C’est notre projeeeeeeeet !…

CONCLUSION

La seule réponse possible à la question « à qui profite cette hystérie collective du covid-19 », c’est un programme de contrôle et de réduction des populations. Les gens de la classe stato-financière, les « élites » du monde qui font la pluie et le beau temps sur la planète vont-elles se faire vacciner avec ces vaccins ? Elles ont déjà déclaré ouvertement qu’il n’en était pas question. C’est le peuple des plus modestes et des plus défavorisés, ceux qui protestent, qui contestent, qui se révoltent, qui ne sont plus « utiles » pour le monde des profiteurs d’en haut. Ce sont eux qu’il faut « éliminer » ou contrôler. C’est pourquoi, cette campagne criminelle du massacre coronavirus est intolérable et il serait bien possible qu’elle puisse entraîner la fin de la vie humaine sur Terre. Nous allons au-devant de grandes violences…

= = =

Notre page « Coronavirus, guerre biologique contre l’humanité »

Dire NON ! à la dictature technotronique

Bill « La piquouze » Gates et som empire mondial de la santé

Masque : non au muselage sanitaire !

Le cas SRAS-CoV-2 comme OGM

 

Reprise 3 : Coronavirus et complotisme… Qui est qui dans cette affaire ? (Dr Pascal Sacré)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, N.O.M, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , on 1 septembre 2020 by Résistance 71

 

 

COVID-19 Qui est complotiste ?

 

Dr Pascal Sacré

 

13 août 2020

 

url de l’article original:

https://www.mondialisation.ca/covid-19-qui-est-complotiste/5648303

 

Afin de nous trouver sur la même longueur d’ondes, il me faut définir ce mot.

Complotiste : défenseur d’une théorie du complot. 

C’est comme de dire, raciste : défenseur d’une théorie du racisme.

Nous n’allons pas loin, avec ça.

Un synonyme est conspirationniste.

Qu’est-ce qu’une théorie du complot ou de la conspiration ?

Ce qui est sûr, c’est que ces mots sont péjoratifs, mauvais. 

Personne n’aime cette étiquette : « complotiste », « théoricien de la conspiration ».

Depuis le 11 septembre 2001, ce mot déjà ancien [1] est utilisé pour disqualifier toute personne qui tient des propos contraires aux versions officielles. 

Analysons cette phrase car chaque mot est important.

Par officielles, beaucoup veulent dire : gouvernementales. 

Ce n’est pas tout à fait ça.

Si vous dites que Donald Trump, pourtant président officiel et chef élu du gouvernement des USA, raconte des conneries, a utilisé les Russes pour être élu [2] ou veut annuler les prochaines élections américaines [3], toutes théories du complot contre lui, contre Trump, tous les journalistes occidentaux vous applaudiront. Ils ne vous traiteront pas de conspirationniste même si, selon la définition, c’est ce que vous êtes en diffamant ainsi.

Dans le cas du COVID-19 de 2020, si vous dites que tous les docteurs (et il n’y en a pas deux, dix ou cent, mais des milliers à travers le monde) qui disent que l’hydroxychloroquine soigne le COVID-19 sont des fous échappés d’un asile d’aliénés [4], une fois encore, les journalistes vous féliciteront. En tout cas, même sans preuve de ce que vous avancez, personne ne vous traitera de théoricien du complot.

Pourtant, c’est une théorie et c’est dirigé contre des docteurs diplômés, officiels. 

En faisant cela, vous accusez des médecins [5] dont certains travaillent à l’Université ou dans des

hôpitaux reconnus, depuis des dizaines d’années, tels que le professeur d’épidémiologie Harvey Risch [6] de la Yale School of Public Health, le professeur Didier Raoult,  directeur de l’Institut Hospitalo-Universitaire Méditerranée infection à Marseille, le docteur Christian Perronne [7], professeur des universités-praticien hospitalier français, spécialisé dans le domaine des pathologies tropicales et des maladies infectieuses émergentes et ancien président de la commission spécialisée « Maladies transmissibles » du Haut Conseil de la santé publique, en plus de nombreux médecins moins connus mais tout aussi fiables et sérieux, médecins de famille, de terrain, généralistes ou spécialistes [8 à 13].

Vous êtes un fameux « théoricien conspirationniste » si vous pensez que tous ces docteurs diplômés mentent ou veulent vous manipuler, Dieu saurait pourquoi.

Pourtant, personne ne vous traitera de ça.

La vérité, c’est que vous serez étiqueté « complotiste » si et seulement si vous tenez des propos contraires aux versions officielles des personnes, institutions, gouvernements adoubés, reconnus.

Adoubés, reconnus par qui ?

  1. Par les institutions internationales (Organisation Mondiale du Commerce, Organisation Mondiale de la Santé, Fond Monétaire International, Forum économique mondial, Organisation des Nations-Unies, Commission Européenne, Agence européenne du Médicament…). 
  2. Par des relais nationaux qui rendent compte à ces institutions internationales et ce, dans tous les domaines importants, sanitaires, médicaux, éducatifs, médiatiques, économiques… [14]

Tout cela forme un système cohérent, transnational, supranational, animé de buts communs et utilisant un langage précis et étudié.

Il faut bien saisir que ce système est indépendant des hommes politiques et survit aux changements électoraux. Il se perpétue, quoi qu’il arrive, non pas au travers d’un président, d’une personne en particulier, mais au travers de ces institutions qui traversent tous les scandales [15 à 18] et toutes les attaques sans prendre une égratignure.

Qui dirige ce système ? 

Je ne vous répondrai pas ici d’abord parce que c’est un autre travail qui mériterait un article à part entière et ensuite, parce que de nombreux chercheurs ont déjà brillamment cerné ce sujet [19 à 22].

Donc, être président, chef de gouvernement, médecin diplômé et représenter une autorité valable et sérieuse ne suffisent pas pour vous protéger de toute contestation en arguant que le contestataire serait un complotiste.

Non.

Pour cela, pour bénéficier de cette protection, il faut appartenir à ce système, parler son langage et poursuive ses buts.

Ainsi, Anthony Fauci aux propos pourtant critiquables et contradictoires [23] ne sera jamais traité de complotiste. 

Le professeur Harvey Risch, oui.

Ainsi, les journaux qui affirment que le Remdesivir est efficace dans le COVID-19, contrairement à l’hydroxychloroquine, ne seront jamais qualifiés de complotistes.

Ceux qui disent le contraire, études et médecins à l’appui, oui. 

Le problème, c’est que Trump a dit qu’il était pour l’hydroxychloroquine aussi, et cela, c’est le discrédit à tous les coups.

On dit que le Remdesivir a prouvé son efficacité face au Covid-19, dans un journal belge du 11 août 2020 [24]. 

Les mots sont importants. 

Le mot « prouvé », en l’occurrence, est faux. 

Mais qui s’en apercevra, si vous n’êtes ni docteur, ni au fait des études en question ?

En attendant, un mensonge passe comme une évidence, une vérité.

Un seul traitement par le Remdesivir rapportera 2500 $ par patient à la firme Gilead [25].

L’hydroxychloroquine, rien ou quasi.

Les termes « complotisme » ou « théorie de la conspiration » n’ont rien à voir avec la vérité ou avec la crédibilité, cela a à voir avec le conformisme aux idées dominantes, dictées par le système qui poursuit implacablement ses buts.

Un autre mot important est le mot « théorie ». Théories de la conspiration. 

Cela sous-entend des divagations sans fondements, sans preuves.

Pourtant, de nombreuses affirmations étiquetées « théories de la conspiration » n’ont rien de théorique.

Il est rare d’avoir une preuve formelle au moment de son affirmation. Celle-ci peut découler de recherches, de réflexions, de présomptions.

En médecine légale ou en sciences criminelles, vous n’aurez pas toujours de preuves irréfutables mais un faisceau de présomptions solides (mobile, faits indirects et cohérents) qui suffit à condamner un accusé, selon la loi.

Prenons la « théorie conspirationniste » selon laquelle l’industrie pharmaceutique ferait pression pour discréditer l’hydroxychloroquine et privilégier ses produits coûteux, les antiviraux comme le Remdesivir ou les vaccins.

Ce serait bien d’avoir une preuve irréfutable de cela mais je vois mal un dirigeant de cette industrie écrire un tel aveu puis le laisser traîner afin qu’il tombe entre les mains d’un journaliste honnête. Ce serait vraiment suicidaire, vous ne trouvez pas ? Et de toute façon, on discréditerait ce dirigeant, ou ce journaliste, jusqu’à ce que leur parole soit sans valeur.

Par contre, comme on le ferait dans n’importe quelle enquête policière, y a-t-il un faisceau de présomptions solides ?

1) Cette industrie a-t-elle un mobile ?

Oui.

Cette industrie a un fameux mobile pour faire cela : l’argent.

Il ne s’agit pas de milliers ou de centaines de milliers d’euros qui pousseraient pas mal de gens à commettre des meurtres, mais de milliards d’euros [26-27].

2) Cette industrie a-t-elle les moyens de faire cela ?

Oui.

On le sait grâce au témoignage de personnes de l’intérieur, comme John Virapen ex-PDG d’Eli Lilly & Company en Suède [28], ou d’anciens rédacteurs en chef de grandes revues médicales comme Marcia Angell [29] (New England Journal of Medicine) ou Richard Horton [30] (Lancet).

3) Celle industrie l’a-t-elle déjà fait ?

Oui.

Il y a des cas avérés, prouvés qui illustrent la corruption de médecins par l’industrie pharmaceutique, comme celui de l’anesthésiste Scott Reuben ayant falsifié des données concernant l’efficacité de l’antidépresseur Effexor (venlafaxine), produit par la firme Wyeth (fusionnée avec Pfizer) dans les douleurs neuropathiques et postopératoires [31].

Et ce n’est qu’un exemple [32]. Plus récemment, vous avez le Lancet-Gate: « Mensonges scientifiques sur le coronavirus » et corruption des grandes sociétés pharmaceutiques.

Même lorsque les preuves sont là, avez-vous déjà vu un journaliste qui avait accusé quelqu’un de « théoricien du complot » faire son mea culpa, s’excuser de sa méprise et rétablir la réputation du « théoricien » en question ? Et surtout, rétablir la vérité ?

Pour seul exemple, je vais prendre l’histoire des bébés koweïtis arrachés à leur couveuse et jetés à terre par les soldats irakiens pour justifier l’intervention américaine en Irak en 1990. Le président Georges Bush senior s’en est servi à plusieurs reprises, dans plusieurs discours enflammés. 

C’était un mensonge [33]. 

Nous le savons. 

Pourtant, quiconque qui l’aurait su ou compris, et l’aurait dit à ce moment aurait été traité de « théoricien du complot » de connivence avec Saddam Hussein.

Pour la petite histoire et vous démontrer que ces techniques n’ont pas cessé en 1991 ou après la preuve de ce mensonge, la firme malhonnête derrière ce mythe est la même firme qui a aidé en 2020 l’Organisation Mondiale de la Santé (OMS) à faire croire à la pandémie COVID-19 et à faire respecter ses diktats : la firme Hill & Knowlton [34].

Alors, qu’est-ce que ça veut dire, complotiste, et qui l’est vraiment ?

On le voit, ça ne veut rien dire.

C’est une étiquette péjorative, mauvaise, qui ne vous sera pas donnée si vous mentez, ou si vous critiquez une personne ou un gouvernement qui justement dérange le système.

Elle vous sera donnée si ce que vous dites, même si c’est vrai, plausible, prouvé, va à l’encontre du discours autorisé du système.

Vérifiez par vous-même.

Critiquez les docteurs qui défendent l’usage de l’hydroxychloroquine dans le COVID-19, et vous ne serez pas accusés de complotisme. 

Vous serez écoutés, approuvés.

Critiquez Anthony Fauci ou les conseils de sécurité nationaux contre le COVID-19, alors oui, vous serez accusés de complotisme, et même de tous les maux.

Très souvent, cela n’a rien à voir avec des théories.

Les faits avancés sont parfois prouvés, très souvent étayés de nombreux arguments solides et plausibles.

Les mots sont très importants. Ne sous-estimez pas leur importance. Ce sont eux qui dirigent nos pensées.

Je le sais en tant que docteur, mais également en tant que passionné de communication à visée thérapeutique.

Comme les tous premiers médecins de l’Antiquité, je sais que les mots peuvent guérir.

Ils peuvent aussi rendre dociles ou malades.

« Complotiste », « conspirationniste », « théoricien du complot » ne servent qu’à couper court à tout débat.

Qu’à faire rejeter la personne que le système dominant veut discréditer, pour que cette personne ne soit plus écoutée.

C’est cela qui est dangereux ; pas les « théories du complot ».

Ce qui est vraiment dangereux est de ne même pas vouloir débattre et d’exclure des idées, des personnes et des opinions sous prétexte qu’elles dérangent.

C’est cela qui sème les graines d’une société totalitaire ; pas les théories du complot.

C’est en refusant tout débat, toute discussion et en brandissant ce genre d’expression disqualifiante, que le pire vient.

Notes :

[1] Théorie du complot, Wikipédia

[2] Ingérence : comment la Russie a biaisé la campagne de 2016 au profit de Trump

[3] Comment Trump pourrait saboter l’élection pour la remporter

[4] Hydroxychloroquine: Goliath contre David, acte I : les détracteurs

[5] Covid-19 – Hydroxychloroquine, David contre Goliath, acte II : les supporteurs

[6] L’hydroxychloroquine agit chez les patients à haut risque, et dire le contraire est dangereux, Harvey Risch M.D., Ph.D., professeur d’épidémiologie à la Yale School of Public Health.

[7] Christian Perronne : “À Garches, nous avons de bons résultats avec l’hydroxychloroquine”, 15 avril 2020, Fervent défenseur du traitement à l’hydroxychloroquine et à l’azithromycine, pour le Pr Christian Perronne la question de son efficacité ne se pose plus. Chef du service infectiologie de l’hôpital Raymond-Poincaré de Garches, il le constate tous les jours depuis le début de l’épidémie : le traitement du Pr Raoult soigne et réduit considérablement les passages en réanimation.

[8] Riposte à la covid-19 : la saine colère du Dr BELLATON, Source : page Facebook de Silviane Le Menn, 20 avril 2020.

[9] Coronavirus : le bilan très positif d’un praticien lorrain qui prescrit l’hydroxychloroquine, le Républicain Lorrain, Philippe Marque, 6 avril 2020. Le bilan est plus que positif : « J’ai utilisé ce protocole sur une dizaine de patients hospitalisés, qui ont donc un Covid-19 déjà relativement inquiétant, et je n’ai eu ni décès ni aucune évolution vers un stade grave nécessitant une réanimation. »

[10] Un médecin mosellan constate l’efficacité d’un protocole à base d’azithromycine, le Républicain Lorrain, Thierry Fedrigo, 11 avril 2020. Deux médecins mosellans et l’une de leurs consœurs belges semblent avoir mis au point une combinaison médicamenteuse efficace contre le coronavirus. Tablant sur l’azithromycine sans recourir à l’hydroxychloroquine prônée par l’infectiologue Didier Raoult, ils ont constaté une chute nette des hospitalisations de leurs patients traités.

[11] Un médecin néerlandais soigne les patients atteints de coronavirus, mais le gouvernement néerlandais n’est pas content, Amari Roos, 10 avril 2020

[12] Des médecins algériens attestent de l’«efficacité quasi totale» de l’hydroxychloroquine contre le Covid-19, 27 avril 2020. Les chefs de services de maladies infectieuses d’un hôpital à Blida et d’un autre à Alger affirment que le protocole à base d’hydroxychloroquine, suivi dans le traitement des patients atteints du coronavirus, donne un résultat positif « quasi-total »

[13] Après l’Algérie, le Maroc encense l’efficacité de l’hydroxychloroquine contre le Covid-19, 1 mai 2020. Le protocole thérapeutique à base d’hydroxychloroquine et d’azithromycine utilisé contre le Covid-19 « a donné des résultats positifs » au Maroc, a déclaré le ministre de la Santé, précisant que les « effets secondaires sont minimes ».

[14] Ordres nationaux tels que l’Ordre des Médecins, l’Ordre des Pharmaciens, Hautes Autorités de Santé, Sciensano en Belgique…

[15] Agence européenne du médicament : des experts sous influence ?, 12 décembre 2017.

[16] Covid-19: les conseillers du pouvoir face aux conflits d’intérêts, paru le 31mars 2020, écrit par Rozenn Le Saint et Annton Rouget.

[17] Coronavirus : des liens troubles entre labos et conseils scientifiques, Valeurs actuelles, 3 avril 2020.

[18] L’Assemblée parlementaire du Conseil de l’Europe va enquêter sur l’OMS et le scandale « pandémique », Mondialisation.ca,  F. William Engdahl, 6 janvier 2010

[19] Anthony C Sutton : économiste, historien et écrivain britannique. Sutton fut chercheur à Stanford au sein de la fondation Hoover de 1968 à 1973. Il enseigna l’économie à l’UCLA. Il étudia à Londres, Göttingen et UCLA et fut titulaire d’un doctorat en sciences de l’Université de Southampton, en Angleterre. En 1972, au sein de la Hoover Institution à Stanford : Wall Street et l’ascension de Hitler , Wall Street et la révolution bolchévique

[20] Carroll Quigley : historien américain et professeur d’histoire à l’Université de Georgetown de 1941 à 1976. Quigley est né à Boston où il étudie par la suite et où il décroche deux diplômes et un doctorat d’histoire de la proche et très réputée université Harvard. À l’Université de Georgetown  : Tragedy and Hope: A History of the World in Our Time

[21] Pierre Hillard :  essayiste français, docteur en science politique : La marche irrésistible du nouvel ordre mondial , Chroniques du mondialisme

[22] Michael Parenti, historien, politologue et critique culturel américain. Il a enseigné dans des universités américaines et étrangères. À lire absolument : L’Horreur impériale

[23] Lancet-Gate: « Mensonges scientifiques sur le coronavirus » et corruption des grandes sociétés pharmaceutiques., Mondialisation.ca, Prof Michel Chossudovsky, 15 juillet 2020. Le Dr Anthony Fauci, conseiller de Donald Trump, présenté comme « le meilleur expert américain en maladies infectieuses », a joué un rôle clé dans le salissage du remède HCQ qui avait été approuvé des années plus tôt par le CDC, ainsi que dans la légitimation du Remdesivir de Gilead.

[24] Le remdesivir, médicament qui a prouvé son efficacité face au Covid-19, 11 août 2020.

[25] Le traitement au remdesivir coûtera 2.340 dollars, selon Gilead, 29 juin 2020

[26] COVID-19 : au plus près de la vérité. Vaccins., Mondialisation.ca, Dr Pascal Sacré, 2 août 2020

[27] COVID-19: au plus près de la vérité – Hydroxychloroquine (HCQ), Mondialisation.ca, Dr Pascal Sacré, 29 juillet 2020

[28] Médicaments effets secondaires : la mort, les laboratoires nous trompent. John Virapen, le cherche midi éditions, 2014

[29] La vérité sur les compagnies pharmaceutiques, comment elles nous trompent, comment les contrecarrer, Marcia Angell, MD, ancienne rédactrice en chef du New England Journal of Medicine, traduction en français, les éditions le mieux-être, 2005.

[30] COVID-19 : le côté obscur de la science révélé, Mondialisation.ca, Dr Pascal Sacré, 26 mai 2020

[31] Top Pain Scientist Fabricated Data in Studies, Hospital Says, 11 Mars 2009

[32] Du Nujol au Tamiflu : la guerre menée par l’industrie pharmaceutique contre nos santés, Mondialisation.ca, Dr Pascal Sacré, 16 juin 2010

[33] l’affaire des Couveuses de la Mort et le début de la Guerre du Golfe

[34] COVID 19 – Contrat de l’OMS avec la société de relations publiques Hill & Knowlton

= = =

Notre page « Coronavirus : guerre biologique contre l’humanité »

 


Dictature sanitaire outil du N.O.M

Pandémie, dictature et répression… L’avertissement du discours de V (James McTeigue et Alan Moore)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, gilets jaunes, guerres hégémoniques, guerres imperialistes, militantisme alternatif, N.O.M, neoliberalisme et fascisme, pédagogie libération, police politique et totalitarisme, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 31 mai 2020 by Résistance 71

 

 

Résistance 71

 

31 mai 2020

 

« Derrière ce masque, il y a plus que de la chair, il y a une idée et les idées sont à l’épreuve des balles… »
~ V ~

 

Le monde occidental s’enferme pas à pas dans la dictature et la répression absolue. Le monde dystopique d’aujourd’hui qui s’avance fait certes de plus en plus penser au récit signal d’alarme de George Orwell « 1984 » (publié en 1948), à tel point que cela en devient tristement un cliché, mais il fait aussi penser à un autre récit futuriste, celui d’Alan Moore et de David Lloyd publié en GB en 1982 et 1983 sous forme de bande dessinée (roman graphique), reprise en 1988 par DC Comics aux Etats-Unis : « V for Vendetta ».
L’histoire fut portée à l’écran en 2005 par James McTeigue et est devenue depuis un de ces films « cultes ». Une des scènes les plus marquantes du film et qui fait référence et celle du piratage de la station de télévision par V le résistant et la diffusion de son allocution aux habitants de la ville de Londres et du Royaume-Uni, devenu une abominable dictature. Dans ce discours diffusé par piratage de la chaîne, V secoue les consciences et incite à la révolte.

Le discours de V mis à l’écran en 2005 a été adapté de l’original d’Alan Moore datant de 1982 sur toile de fond de GB thatchérienne et le rendant plus « moderne ». Ci-dessous la vidéo du discours de V dans le film de McTeigue et sous la vidéo les deux textes traduits par nos soins, le premier, transcription du discours filmé, le second du discours du livre.

Écoutez et lisez ce que dit V, où est la fiction et où est la réalité ? Il est aussi à rappeler que l’avènement, dans le récit, du haut chancelier Adam Sutler, a fait suite à une.. épidémie provoquée par la contamination volontaire au moyen d’un virus mortel, de la population de Londres et de la Grande-Bretagne, épidémie répandue et ayant fait plus de 100 000 morts…
Où va t’on ?…

A voir, lire et diffuser sans aucune modération.

 

Le discours de V * « V for Vendetta » (2005)

 

 

Transcription / traduction des discours du film et du livre:

 

Intervention télévisée de V

 

Traduit de l’anglais par Résistance 71

 

Juin 2020

 

Transcription du discours du film (2005) :

“Bonsoir Londres. Permettez-moi d’abord de présenter des excuses pour cette interruption. J’apprécie comme vous tous, les petits conforts de la vie routinière quotidienne, la sécurité du familier, la tranquillité de la répétition. Croyez-moi, je l’aime comme tout à chacun. Mais dans l’esprit de la commémoration, où ces évènements importants du passé habituellement associés avec la mort de quelqu’un ou la fin de quelque lutte horrible et sanguinaire, sont célébrés avec un bon jour férié. J’ai pensé que nous pouvions marquer ce 5 novembre, jour qui ne fait plus malheureusement partie du souvenir, en prenant un peu congé de nos vies quotidiennes afin de nous assoir ensemble et d’avoir une petite conversation. Il y a bien sûr ceux qui ne veulent pas que nous parlions. Je suspecte même que maintenant, des ordres ont été donnés, hurlés dans le téléphone et des hommes en armes seront bientôt en route. Pourquoi ?

Parce que bien la trique puisse être utilisée au lieu de la conversation, les mots vont toujours retenir un certain pouvoir, une certaine puissance. Les mots offrent les moyens de la signification et pour ceux qui écoutent, l’annonce de la vérité. Et la vérité est qu’il y a quelque chose de terriblement dérangé dans ce pays n’est-il pas ? Cruauté et injustice, intolérance et oppression ; et là où vous aviez la liberté de ne pas être d’accord, de penser et d’exprimer ce que vous pensiez, vous avez maintenant des censeurs et des systèmes de surveillance qui vous imposent une conformité et sollicite votre soumission. Comment cela s’est-il produit ? Qui est responsable ? Et bien certes, il y en a qui sont plus responsables que d’autres et ils seront mis devant leur responsabilité, mais une fois de plus, pour dire vrai, si vous voulez vraiment rechercher les coupables, vous n’avez qu’à regarder dans un miroir. Je sais pourquoi vous l’avez fait. Je sais que vous aviez peur. Qui n’aurait pas peur ? Guerre, terreur, maladie.

Il y a eu une myriade de problèmes qui ont conspiré pour corrompre votre raison et vous voler de votre bon sens commun. La peur a triomphé de vous et dans votre panique, vous vous êtes tournés vers le Haut Chancelier, Adam Sutler. Il vous a promis l’ordre, la paix et tout ce qu’il vous demandait en retour était votre silence, votre consentement asservi. La nuit dernière j’ai voulu mettre fin à ce silence. La nuit dernière j’ai détruit Old Bailey pour rappeler à ce pays ce qui est oublié. Il y a plus de 400 ans, un grand citoyen [Guy Fawkes] a voulu incruster à tout jamais le 5 novembre dans nos mémoires. Son espoir était de rappeler au monde que l’équité, la justice et la liberté sont au delà des mots, qu’elles sont des perspectives. Alors si vous n’avez rien vu, si les crimes de ce gouvernement vous demeurent inconnus, alors je vous suggère de laisser passer ce 5 novembre comme si de rien n’était. Mais si vous voyez ce que je vois, si vous ressentez ce que je ressens et si vous recherchez ce que je recherche, alors je vous demande de vous dresser à mes côtés dans un an  soirée pour soirée, juste devant le parlement et ensemble nous leur donnerons un 5 novembre qui jamais au grand jamais ne sera oublié.”

Du livre DC Comics USA (1990) première publication Vertigo GB (1982-83) :

Cette traduction provient de l’édition Vertigo (GB) dans une réédition datant de l’année du film en 2005, p.112-118 (traduction, Résistance 71 )

“Bonsoir Londres. J’ai pensé que nous devions avoir une petite discussion. Êtes-vous assis confortablement ? Très bien, je vais donc commencer… Je suppose que vous vous demandez pourquoi je vous ai convoqué ce soir. Et bien voyez-vous, je ne suis pas entièrement satisfait de votre performance récemment… et j’ai bien peur que nous ayons pensé à vous virer.

Oh, je sais, je sais, vous êtes avec l’entreprise depuis très très longtemps maintenant, presque… Attendez voir, oui, presque 10 000 ans ! Nom de nom que le temps passe !… Cela me semble être hier. Je me souviens quand vous avez commencé le boulot à l’entreprise, descendant de votre arbre, tout fringant et nerveux, un os agrippé dans votre poing velu… “Où est-ce que je commence monsieur ?” avez-vous demandé d’une voix lancinante. Je me rappelle de mes mots exacts de réponse : “Il y a une pile d’œufs de dinosaures là-bas gamin” dis-je en souriant paternellement… “Commencez à sucer”. Il y a un moment depuis ce temps n’est-ce pas ? et oui, oui, vous avez raison, de tout ce temps vous n’avez pas manqué une seule journée. Excellent, bon et fidèle serviteur.

Aussi s’il vous plaît, ne pensez pas que j’ai oublié les super choses que vous avez entreprises ou toutes ces inestimables contributions que vous avez faites à l’entreprise comme le feu, la roue, l’agriculture, liste impressionnante vieille branche, une superbe liste impressionnante, ne me faites pas dire ce que je n’ai pas dit, mais… bon, pour être parfaitement franc, nous avons eu nos problèmes également, impossible d’en sortir sans le mentionner. Savez-vous d’où je pense que tout cela provient ? Je vais vous le dire… C’est votre mauvaise volonté fondamentale de vous entendre au sein de l’entreprise, vous ne semblez pas vouloir prendre quelque vraie responsabilité que ce soit ou d’être votre propre patron. Pourtant, vous avez eu beaucoup d’opportunités. Nous vous avons offert une promotion encore et encore et à chaque fois vous l’avez refusée. “Je n’ai pas pu faire le boulot, gouverneur, je sais où est ma place..” avez-vous pathétiquement dit. Franchement, vous n’essayez même pas n’est-ce pas ?… Voyez-vous, vous êtes demeurés sur place bien trop longtemps, vous stagnez, et ça commence à vraiment se voir dans votre performance et ajouterai-je, dans votre attitude générale. Le pinaillage incessant dans l’usine ne m’a pas échappé, le désordre récent à la cantine du personnel et puis bien sûr il y a… je ne voulais vraiment pas aborder ce sujet, mais j’ai aussi entendu des rumeurs assez perturbantes sur votre vie personnelle. Non, non, pas de nom, je ne vous dirai pas qui m’a dit… Je comprends que vous êtes incapables de vous entendre avec votre époux(se), on me dit que vous vous disputez sans cesse, que vous hurlez votre violence. Je suis informé de manière fiable sur le fait que vous blessez toujours ceux que vous aimez, de fait, ceux à qui vous ne devriez jamais faire aucun mal… Et les enfants ? Ce sont toujours eux qui souffrent comme vous le savez sans nul doute. Pauvres chérubins, que vont ils faire et devenir ? Que vont-ils devenir après vos abus, votre désespoir, votre couardise et toutes vos bigoteries bien manigancées. Ce n’est pas assez n’est-ce pas ? Et rien ne sert non plus de blâmer la baisse des standards de travail sur la gérance non plus… Bien que, soyons persuadés que la gestion de l’affaire est particulièrement mauvaise. De fait, ne mâchons pas nos mots… La gestion est pathétique ! Nous avons eu toute une série de charlatans, de fraudeurs, de menteurs et de barjots psychos qui ont pris toute une série de décisions particulièrement catastrophiques, ceci est un fait établi et bien réel, mais qui les a élus ? qui les a amenés au pouvoir ? Vous ! C’est vous qui avez mis ces personnes au pouvoir, vous qui leur avez donné le pouvoir de prendre toute décision pour vous ! Alors, je veux bien admettre que tout le monde puisse faire une erreur une fois, mais continuer à répéter cette même erreur létale siècle après siècle, cela me semble en fait être quelque chose de parfaitement délibéré. Vous avez encouragé ces incompétents malfaisants qui ont réduit vos vies de tous les jours à la misère et au pathétisme actuel ; vous avez accepté sans questions leurs ordres insensés. Vous les avez autorisés à remplir votre espace de vie et de travail  de machines dangereuses et sans fondement réel. Vous auriez pu les arrêter. Tout ce que vous aviez à faire était de dire NON ! Vous  n’avez pas de couilles, pas de fierté, vous n’êtes plus un membre de valeur de cette entreprise. Mais je serais néanmoins généreux. Vous aurez deux ans pour me montrer une amélioration dans votre travail. Si à la fin de cette période vous n’êtes toujours pas capables ou vous ne voulez toujours pas allez de l’avant, vous serez virés. Ce sera tout, vous pouvez retourner à vos travaux. Le service régulier reprendra dès que possible…”

 

CoV19 verrouillage mondial de l’information et dictature technotronique…

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, désinformation, gilets jaunes, guerres hégémoniques, ingérence et etats-unis, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , , , , on 30 mai 2020 by Résistance 71

 


Temps pour un nCoV-GJ-20…

 

Les faits versus le fake… Un verrouillage mondial sur tout

 

Peter Koenig

 

27 mai 2020

 

source de l’article en français:

https://www.mondialisation.ca/les-faits-versus-le-fake-un-verrouillage-mondial-de-tout/5645909

 

Savez-vous qui a inventé la malédiction, la « théorie de la conspiration » ou l’accusation, « vous êtes un théoricien de la conspiration ! » ? Ce n’était rien de moins que la CIA dans les années 1950, pour faire taire ceux qui comprenaient le mensonge de la guerre froide contre l’Union soviétique. C’était un mensonge absolu des stratèges de guerre étasuniens, pour installer la peur dans la population en général et chez les Européens en particulier et ce pour renforcer le complexe militaro-industriel étasunien – et tout en présentant une menace constante à l’Union soviétique communiste.

Une expression similaire est apparue ces dernières années. Celle de « fausses nouvelles ». Les personnes qui disent des vérités bien fondées sont accusées de répandre de « fausses nouvelles » – et ce par les médias qui diffusent les vraies fausses nouvelles et les mensonges en tout premier lieu. C’est effectivement un monde dystopique, mais la majorité des gens ne le comprenne pas.

« Populiste » est un autre terme dénigrant qui a récemment fait son entrée dans le vocabulaire mainstream. Il fait référence à des personnes ou des idées de gauche, de centre ou de droite – du moment qu’elles ne s’en tiennent pas au discours en place. Selon la définition du dictionnaire Webster, un populiste est quelqu’un qui représente les points de vue du peuple, une opinion majoritaire, en fait, c’est un terme très démocratique, parce qu’un vrai leader devrait représenter les idées du peuple. Mais la manipulation des médias a fait du « populisme » quelque chose de « moins intellectuel » – et, bien sûr, personne ne veut être « moins intellectuel », c’est pourquoi ce terme est devenu péjoratif. C’est ainsi que les médias et la propagande, la guerre psychologique, peuvent modifier ce que les gens appellent « mon bon sens ».

Le facteur peur est toujours un élément crucial pour diviser les gens, et pour les rassembler dans des « chambres de peur » à l’abri des soi-disants dangers- qui permet à quoi que ce soit d’extérieur de se produire comme développer l’industrie d’armements, de simuler une course aux armements. On invente ainsi des  menaces. L’Union soviétique est sortie de la Seconde Guerre mondiale – où elle a perdu entre 25 et 30 millions de personnes pour sauver l’Europe et le monde du fascisme.

Mais les livres d’histoire occidentaux disent que ce sont les États-Unis et leurs alliés européens qui ont vaincu Hitler en premier lieu. Cette fausse nouvelle est continuellement propagée, la dernière fois lors de la récente célébration de la victoire de la Seconde Guerre mondiale le 9 mai 2020 – sans aucune considération du rôle clé de l’Union soviétique – la Russie d’aujourd’hui – dans la défaite des nazis d’Hitler.

Après cet énorme sacrifice, l’Union soviétique n’avait ni l’intention ni les moyens de constituer une armée pour vaincre l’Occident – comme le propageaient les États-Unis, puis l’Europe, justifiant ainsi 40 ans de guerre froide fondée sur la peur. La guerre froide a détruit la relation naturelle (commerciale, diplomatique, culturelle) entre l’Europe et la Russie actuelle.

Aujourd’hui, cependant, quiconque ose rappeler aux médias, aux politiciens et aux amis occidentaux le véritable conquérant d’Hitler, à savoir l’Union soviétique, est un « théoricien du complot » ou quelqu’un qui répand de « fausses nouvelles ».

La crise du coronavirus

Le dernier exemple récent de conspiration à grande échelle est la crise du coronavirus. Ce qui se joue sous nos yeux, un verrouillage mondial de tout, suivi par presque tous les gouvernements de ce monde avec une sévérité similaire, une quarantaine, un confinement chez soi pour presque tout le monde sous le « prétexte » de vous protéger – vous les gens – d’un ennemi invisible – le coronavirus. Et chaque gouvernement SAIT que c’est un désastre pour l’économie nationale et mondiale – c’est un suicide social. Et pourtant, ils suivent les ordres de qui ?

Comme la plupart d’entre nous qui recherchons nos propres sources d’information, en dehors du mainstream (courant dominant ), le gouvernement a dicté ou soutenu des mensonges, la collecte de données et les statistiques sur les infections dues au COVID-19, ainsi que les taux de mortalité, sont largement gonflées et volontairement falsifiées, pour augmenter le facteur de peur et prolonger le verrouillage tout à fait destructeur. Voir ici. Cette horrible tricherie n’est pas seulement pratiquée aux États-Unis, mais aussi en Europe. L’Italie en est un exemple, voyez ceci.

Un autre exemple est la Suisse. L’Office fédéral suisse des statistiques (BAS, pour « Bundesamt für Statistik » en allemand) tient un registre de tous les décès survenus dans le pays chaque semaine. Au cours des 18 premières semaines de 2020 (se terminant le 3 mai 2020), le nombre de décès a en fait diminué par rapport aux 18 premières semaines de 2015 – 25 400 (2020) contre 26 596 (2015). Comment cela est-il possible si le nombre officiel de décès par coronavirus en Suisse est de 1 642, au 24 mai 2020. En d’autres termes, le nombre de personnes qui meurent chaque année avec ou sans coronavirus est à peu près le même. Voyez ceci.

La Suisse ayant le 8e taux de mortalité dû au coronavirus le plus élevé d’Europe, il est fort probable que des chiffres similaires de décès totaux soient enregistrés dans d’autres pays européens et aux États-Unis, c’est-à-dire pratiquement inchangés au cours des 18 premières semaines de 2019 et 2020.

À moins que des preuves solides ne soient présentées, comme par le député italien et un certain nombre de médecins, virologistes et microbiologistes d’Italie et d’autres pays européens, ainsi que des États-Unis, quiconque fait référence à la fausseté et au manque de fiabilité de la statistique est appelé un théoricien du complot – un menteur. Et dans certains pays, les personnes qui disent la vérité sont même passibles d’amendes et de poursuites judiciaires. Ces menaces et ces accusations de conspiration devraient nous faire taire. Mais elles ne le font pas et ne le feront pas. Nous voulons que la vérité éclate et soit connue du monde entier.

La crise économique mondiale

Nous nous rendons déjà compte que les des dégâts sont d’une ampleur inouïe. Au cours des quatre premiers mois de cette pandémie dite « de l’OMS », nous assistons à une catastrophe mondiale dont les proportions dépassent de loin celles de 1929-1933 et de 2008-2009. Jamais dans l’histoire de l’humanité on n’a créé autant de misère.

Les faillites abondent, la bourse a plongé jusqu’à présent de plus de 30 % (avec quelques hauts et bas – appelés « prise de profit rapide » par les riches et les puissants sur le dos des petits investisseurs). Cependant, les milliardaires étasuniens ont augmenté leur richesse au cours des 4 premiers mois de 2020 de 406 milliards de dollars, selon la CNBC du 1er mai 2020.

Le verrouillage universel de Covid-19 a également provoqué un effondrement des actifs productifs, qui deviennent désormais des proies faciles pour les grandes entreprises – le chômage atteignant des sommets jamais vus auparavant par l’humanité moderne, avec actuellement 40 millions d’Étasuniens sans emploi. Cela ne tient pas compte de ceux qui ont renoncé à chercher un emploi ou à demander l’indemnisation du chômage.

Selon Fox Business News, jusqu’à 40 % des personnes concernées pourraient ne jamais retrouver d’emploi. La FED prévoit que le chômage pourrait atteindre 50% d’ici la fin de l’année (dans la pire période de récession de 1929, le chômage a atteint 25%). Ce ne sont que des statistiques étasuniennes. La situation en Europe, plus chaotique, pourrait être encore pire.

Le Bureau international du travail (BIT) a annoncé que d’ici quelques mois, le chômage mondial pourrait toucher 1,6 milliard de personnes, soit la moitié de la population active mondiale. Nombre de ces personnes, en particulier dans les pays du Sud, ont déjà été au seuil de la pauvreté ou sous le seuil de pauvreté, vivant au jour le jour, sans aucune épargne. Elles sont maintenant condamnées à mendier – et beaucoup, peut-être des centaines de millions, à mourir de famine, selon le Programme alimentaire mondial (PAM). Nombre d’entre eux, si ce n’est la majorité, n’ont pas accès aux services de santé, ni à un abri, ni à aucune autre forme de filet de sécurité sociale, car l’effondrement économique causé par le COVID-19 a anéanti les structures de sécurité sociale, même les plus fragiles, que les pays pauvres avaient pu mettre en place.

La misère n’a pas de fin. Et ce n’est que la pointe de l’iceberg. Le pire est encore à venir – quand, dans quelques semaines ou mois, on aura une idée plus précise des industries qui vivront ou mourront – et que davantage de personnes seront reléguées dans la pauvreté économique.

La véritable conspiration

Si l’on prend un peu de recul, il est clair que ce n’est pas un hasard si le monde entier est frappé par le même virus et pratiquement en même temps. Cela n’arrive pas naturellement – mais peut arriver, comme cela s’est produit, lorsque le virus est implanté artificiellement dans chaque pays – et cela en même temps. Il y a donc un plan diabolique derrière cette soi-disant crise du coronavirus qui ne doit même pas être une crise, si nous regardons les taux réels de maladie et de mortalité – et non pas les taux gonflés et provoquant la peur (voir ci-dessus, les cas de l’Italie et de la Suisse).

Pour aller plus loin : Bill Gates et le programme de dépeuplement. Robert F. Kennedy Junior demande une enquête


Fondations Rockefeller + Gates = Apocalypse eugéniste

Alors, qui est derrière tout cela ? – Eh bien, sans citer de noms et sans vous laisser aller à des suppositions, il existe plusieurs rapports et événements qui ont « prédit » une telle pandémie. L’un des plus importants est le rapport Rockefeller de 2010, qui décrit de manière étonnamment détaillée ce qui se passe actuellement et l’appelle le scénario « Lock Step ». Selon ce rapport, la situation devrait s’aggraver et la pandémie actuelle pourrait être suivie d’une vague plus forte plus tard dans l’année ou en 2021. Curieusement, les projections économiques du FMI pour une « économie post-Covid » prévoient 3 scénarios, dont deux envisagent une autre épidémie au cours du second semestre de 2020, ou en 2021.

L’événement 201 du 18 octobre 2019 à New York, qui simule entre autres des atrocités dont une pandémie de coronavirus qui ferait 65 millions de morts en 18 mois (voir ceci). Il s’agissait de la dernière attaque avant l’épidémie prévue. Disons simplement que les cerveaux maléfiques derrière cette crise monstrueuse sont quelques psychopathes très riches et assoiffés de pouvoir, ainsi que leurs familles et leurs amis. Ils planifient un gouvernement mondial unique, également appelé le Nouvel ordre mondial, ou l’Ordre mondial unique – qui est en préparation depuis la fin du siècle dernier. Il exige un contrôle total de la population et une réduction importante de celle-ci.

C’est là que l’eugénisme entre en jeu. De nombreux membres du Rockefeller club, de la « Bilderberg Society », préconisent la réduction de la population depuis des décennies, dont Bill Gates. Il s’en est même vanté lors d’un discours du TED en Californie du Sud en 2010, « Innover pour atteindre le zéro », il a déclaré : « quand nous faisons un vrai travail d’orfèvre en matière de vaccination, nous pouvons réduire la population mondiale de 10 à 15 % ». (voir ceci). Il veut éliminer la pauvreté, littéralement.

Cependant, en parler, et relier les points de ce que nous vivons aujourd’hui – est qualifié de théorie de la conspiration.


Confiance… Avec Bill la piquouze
Big Pharma engrange le flouze…

Pourquoi les nouveaux vaccins anti-coronavirus de Bill Gates pourraient être mortels ? – Voici comment cela fonctionne. La Fondation Gates a d’abord créé la société pharmaceutique « Moderna » à Seattle, dans l’État de Washington, non loin de son empire Microsoft, essentiellement pour produire des vaccins sur mesure pour la Fondation Gates. Ensuite, la fondation a donné 20 millions de dollars à Moderna pour le développement d’un vaccin contre le COVID-19. Il y a quelques jours, Moncef Slaoas a démissionné du conseil d’administration de Moderna pour devenir directeur à la Maison Blanche de l’opération « Warp Speed », un plan visant à accélérer la mise au point d’un vaccin anti-COVID. Personne ne semble se soucier du conflit d’intérêts flagrant – sans parler du risque sanitaire qui en découle. Voir Robert F. Kennedy Jr. sur le sujet.

Mais il y a encore mieux. La Defense Advanced Research Project Agency (DARPA) du Pentagone, une agence peu connue qui ne fait guère parler d’elle, avait, selon Whitney Webb (Last American Vagabond), connaissance de l’apparition de la pandémie au moins depuis novembre dernier, peut-être même avant.

Cela signifie que le président Trump était au courant, mais qu’il n’a rien fait, il a plutôt laissé faire. Le fait qu’il blâme aujourd’hui la Chine pour sa mauvaise gestion de la crise du coronavirus est un pur mensonge et un bluff de propagande pour dénigrer la réputation de la Chine, son économie en pleine croissance et sa monnaie solide, le yuan – qui pourrait bientôt prendre le relais du dollar comme monnaie clé de réserve mondiale.

La DARPA est également soutenue financièrement par la Fondation Bill Gates. Ils travaillent sur de nouvelles technologies de vaccins depuis plusieurs années. L’épidémie de la COVID-19 a mis en évidence ces travaux de recherche. LA DARPA collabore étroitement avec Bill Gates pour appliquer cette nouvelle technologie au vaccin que Bill Gates veut développer et imposer à la population mondiale.

Selon Whitney Webb, lA DARPA et ses agences partenaires prévoient de

« produire des vaccins à ADN et à ARN, des classes de vaccins qui n’ont jamais été approuvés pour l’usage humain aux États-Unis et impliquent l’injection de matériel génétique étranger dans le corps humain. C’est notamment cette même classe de vaccins, actuellement produite par des sociétés partenaires du DARPA, qui, selon le milliardaire et « philanthrope » de la santé mondiale Bill Gates, est « la plus enthousiaste », par rapport aux autres candidats vaccins Covid-19″.

Ce n’est pas une théorie de conspiration ; c’est une véritable conspiration. Cela ressemble plus aux essais médicaux du Troisième Reich. Les auteurs ont été condamnés à Nuremberg. Dans notre monde dystopique, personne ne sera puni, même si des milliers ou peut-être des centaines de milliers de personnes seront touchées par la ruée vers un vaccin non testé soutenue par l’OMS. Mais cela correspondrait à l’agenda de l’eugénisme.

Le vaccin COVID-19 est « la plus grande escroquerie jamais perpétrée sur la race humaine« . Il s’agit d’un mensonge multigénérationnel qui est devenu une « fausse norme », déclare le Dr Sherry Tenpenny, fondatrice du Tenpenny Integrative Medical Center. Elle a 20 ans d’expérience dans la recherche sur les vaccins et ses articles sont traduits en 12 langues. Elle apparaît aussi fréquemment à la radio et à la télévision pour informer les parents.

« En introduisant des vaccins dans notre corps, nous introduisons des matières étrangères, des toxines, dans nos cellules, comme le mercure et l’aluminium ». En termes juridiques, les vaccins sont « inévitablement dangereux ». Grâce au lobbying des pharmaciens, le Congrès a adopté en 1986 la loi nationale sur les vaccins pour les enfants, une loi qui interdit aux entreprises pharmaceutiques d’être poursuivies pour tout dommage causé par leurs vaccins, y compris la mort. La Cour suprême des États-Unis se prononce en faveur de la protection des fabricants de vaccins contre les poursuites judiciaires des États (5 mai 2020).

Les vaccins ont d’énormes effets secondaires, en particulier chez les jeunes enfants, provoquant diverses maladies durables, comme les allergies aux arachides, l’asthme, l’eczéma et – oui – l’autisme.

Les vaccins particulièrement nocifs sont le ROR (rougeole), la polio et le DTC (diphtérie, tétanos et coqueluche) fabriqués en Occident. Les vaccins de fabrication russe ont des compositions différentes et ont contribué à prévenir des millions de cas de polio et d’autres maladies débilitantes, invalidantes ou mortelles. Depuis 2002, lorsque les revenus des vaccins pour les sociétés pharmaceutiques étasuniennes se sont élevés à environ 8 milliards de dollars, les recettes et les profits ont grimpé en flèche pour atteindre plus de 60 milliards par an d’ici 2020. Chaque nouveau vaccin vaut environ un milliard de dollars. Pour en savoir plus, cliquez ici.

Quiconque s’oppose à la vaccination, quelles que soient les preuves fournies, est qualifié de théoricien du complot par les médias, et souvent par la société médicale cooptée par les pharmaciens.

Les gens commencent à comprendre que c’est Bill Gates et sa Fondation Bill et Melinda Gates (FBMG) qui décident de la santé publique dans le monde entier, en particulier de la vaccination – et maintenant de la vaccination contre le virus COVID-19. Les sinistres nouveaux vaccins qui seront développés par Bill Gates en tandem avec le Dr Anthony Fauci, directeur du NIAID (National Institute of Allergy and Infectious Diseases), l’une des 27 agences du National Institute of Health (NIH), et soutenus par les CDC et l’OMS – et en coopération avec la DARPA – sont décrits ci-dessus. Tous les vaccins promus par Gates sont fabriqués par des sociétés pharmaceutiques occidentales.

Vous devez savoir que la Fondation Bill Gates finance aussi généreusement le NIAID, le NIH et le CDC. Le CDC et les NIH possèdent tous deux plusieurs centaines, voire milliers, de brevets de vaccins. Ils ont donc tout intérêt à promouvoir la vaccination, quel que soit le préjudice qu’elle cause à la population.

Mais cela ne peut être remis en question, et encore moins critiqué – sinon vous serez dénigré comme un théoricien du complot. En fait, les gouvernements occidentaux engagent des psychologues, des sociologues et des médecins pour donner des interviews et parler aux médias des théories du complot, dans un ultime effort pour dissuader les gens de penser et de croire la vérité, si elle est présentée par des médias non traditionnels, ou simplement si elle ne correspond pas au discours politique en cours. Et beaucoup tombent encore dans le mensonge, mais de plus en plus de personnes deviennent méfiantes et s’en tiennent à leurs propres informations, et manifestent et protestent, souvent en désobéissant civilement, contre les mesures sévères prises par le gouvernement à l’encontre de la police et, souvent, de l’armée.

Ils s’insurgent contre Bill Gates et l’OMS, une organisation corrompue qui reçoit entre la moitié et les trois quarts de son budget annuel de donateurs privés, principalement de l’industrie pharmaceutique, de Bill Gates, mais aussi des industries des télécoms (c’est pourquoi l’OMS est restée silencieuse sur les effets potentiellement néfastes de la 5G). Bill Gates est le plus grand donateur de l’OMS. Les conflits d’intérêts ne sont jamais abordés dans les médias. Ceux qui connaissent la vérité et qui n’hésitent pas à la dénoncer sont réduits au silence en étant traités de conspirateurs, de menteurs par les médias et – bien sûr – par une grande partie de la communauté médicale. En fait, Bill Gates prend littéralement les rênes sur des questions de santé publique qui touchent le monde entier.

Soyez tous conscients !

Le Dr Judy Mikovits, micro-biologiste de longue date du NIAID, s’est également prononcée contre les vaccins et les virus produits en laboratoire dont sont finalement dérivés les vaccins. Elle a été sévèrement punie par le Dr Fauci pour avoir défendu les résultats de ses recherches que ce dernier voulait cacher. Son livre, « Plague of Corruption », est actuellement le best-seller numéro un d’Amazon. Cela raconte en soi l’histoire de l’éveil de l’opinion publique.

En faisant référence au Dr Judy Mikovits et à ses nombreuses entrevues, à des articles scientifiques évalués par des pairs et à son livre, on parle de conspiration, et même son propre franc-parler est qualifié de conspiration – tout cela dans le but de faire taire les critiques du système actuel, de la « nouvelle-normale » actuelle qui nécessitera bientôt la vaccination universelle (Bill Gates, avec un sourire sournois, veut vacciner 7 milliards de personnes dans les dix prochaines années). Sera-t-elle obligatoire ? Contre la plupart des pays Droits constitutionnels et démocratiques ? Nous ne le savons pas. Sept milliards est une légère exagération, car la Russie et la Chine ne vaccineront certainement pas leur population avec des vaccins produits sous le financement et la supervision de Bill Gates.

Mais même si ce n’est pas obligatoire, il se peut qu’il y ait tellement d’obstacles « légaux » mis en place par les gouvernements occidentaux que la plupart des gens finiront par se retourner et accepter le vaccin potentiellement mortel que Bill Gates et son association de produits pharmaceutiques (GAVI), soutenue par l’OMS, imposeront à l’humanité.

Par exemple, vous pourriez ne pas pouvoir recevoir ou renouveler votre permis de conduire, aller à des concerts, au cinéma, à des manifestations sportives, prendre l’avion, etc. Tout cela a été évoqué et fait partie du scénario « Lock Step » du rapport Rockefeller de 2010, dans lequel nous naviguons actuellement de façon désespérée – sous le coup d’un confinement et avec une « mise à distance sociale » – afin que personne ne puisse se réunir et éventuellement organiser un complot contre ces mesures inhumaines draconiennes.

Robert F. Kennedy Jr, neveu de JFK, fondateur de « Children’s Health Defense », une organisation de défense des ONG, a déclaré ceci:

« Bill Gates est le plus grand producteur de vaccins au monde et le plus grand donateur de l’OMS et de la Fondation CDC. Ces agences commercialisent maintenant des armes pour son empire du vaccin. »


Bill 2020 « Permis de tuer »…

En janvier 2019, M. Gates a fait déclarer par l’OMS que « l’hésitation en matière de vaccins » était la principale « menace mondiale pour la santé » (avec le virus Ebola, le cancer, la guerre et les agents pathogènes résistants aux médicaments), signalant ainsi une ruée vers l’or de l’industrie pharmaceutique mondiale pour rendre les vaccins obligatoires pour tous.

Le comité d’action politique (PAC) du président du comité de renseignement Adam Schiff a agi au nom de Big Pharma et de la Fondation Gates. En février 2019, Schiff a écrit à Facebook, Google, Amazon et Pinterest, leur demandant de censurer la « désinformation sur les vaccins », terme qui signifie tout scepticisme à l’égard des déclarations des gouvernements et de l’industrie sur la sécurité ou l’efficacité des vaccins, qu’elles soient vraies ou non. – « Les vaccins sont à la fois efficaces et sûrs », a écrit M. Schiff.

« Il n’y a pas de preuve que les vaccins provoquent des maladies mortelles ou invalidantes ».

C’était de la désinformation. Un an plus tôt, Schiff avait poussé un projet de loi visant à augmenter le budget de l’administration de la Vaccine Court à 11 200 000 dollars afin de réduire le nombre de blessures dues aux vaccins. La Cour avait déjà versé 4 milliards de dollars pour les décès et les handicaps liés aux vaccins.

Facebook et Pinterest ont déclaré qu’ils s’en remettront à l’OMS et au CDC de Gates pour déterminer quelles déclarations en ligne sont « de la désinformation ou des canulars ». Facebook et Google ont engagé « FactChecker » (Politifact) pour censurer la désinformation sur les vaccins. La Fondation Gates est le principal bailleur de fonds de « FactChecker ». Dans son article « Fact Checker, un dispositif de propagande », le journaliste d’investigation Jeremy Hammond conclut que « Facebook est coupable de désinformer ses utilisateurs sur la sécurité des vaccins…

« Ils n’ont aucun problème avec les mensonges sur la sécurité et l’efficacité des vaccins, tant qu’ils visent à persuader les parents de vacciner leurs enfants ».

Le 4 mai 2017, le FactChecker a déclaré comme fausse la déclaration de Del Bigtree :

« Les vaccins contiennent de l’aluminium et du mercure, qui sont des neurotoxines, et les vaccins provoquent l’encéphalopathie ».

Le FactChecker a expliqué : « Les données actuelles montrent que les vaccins sont sûrs et ne causent pas de toxicité ou d’encéphalopathie. » Cependant, les notices des fabricants révèlent que de nombreux vaccins contiennent de l’aluminium et du mercure et provoquent des encéphalopathies. – Enfin, les dons massifs à NPR & PBS achètent à Gates une couverture vaccinale biaisée.

Cette déclaration provient de l’agence de presse publique Highwire.

« Je ne suis pas (Robert Kennedy) anti-vaccins. Je suis contre les vaccins dangereux, mal testés, à responsabilité zéro et contenant des ingrédients toxiques. Si quelqu’un proposait un vaccin testé à fond, totalement sûr et efficace, qui fonctionne comme promis, qui rend les gens plus sains plutôt que malades, je serais pour. – En effet, seul un idiot s’y opposerait.

Mais en aucun cas, je ne serais favorable à la vaccination obligatoire. Le gouvernement n’a pas le droit de forcer les citoyens à prendre des médicaments non désirés ou à se soumettre à des interventions médicales involontaires ».

Et il ajoute :

« Google est une entreprise de vaccins. Il a un partenariat de 760 millions de dollars avec Glaxo, le plus grand fabricant de vaccins au monde, et des accords similaires avec Sanofi et Merck pour exploiter vos informations médicales. La société mère de Google, Alphabet, a 4 développeurs de vaccins qui travaillent sur des vaccins contre la grippe et d’autres maladies ».

Google et Youtube suppriment les vidéos de médecins, épidémiologistes, biologistes et virologistes très expérimentés – la censure est également la nouvelle norme – mais ils font la promotion d’un développeur de logiciels milliardaire et d’un « expert » du changement climatique de 16 ans sur les virus et les vaccins – qu’est-ce que cela signifie pour les médias, pour les gouvernements qui soutiennent et financent les médias.

La stratégie derrière les cris de conspiration – Théoricien du complot

Il y a beaucoup de psychologie derrière cette stratégie – amener les gens à un état de dissonance cognitive, à croire qu’un récit qu’ils savent être une fiction, c’est-à-dire, vous savez qu’il y a quelque chose qui ne va pas tout à fait, mais vous n’osez pas le remettre en question. Pourquoi ? Parce qu’on vous traite de théoricien du complot. Et pourquoi est-ce important ? Parce que c’est un terme dégradant, qui prive l’accusé de sa crédibilité (bien pensée par la CIA dans les années 1950). Quelqu’un estampillé comme un théoricien du complot, qui croit aux théories du complot – aux fausses nouvelles, fait de vous une personne moins importante aux yeux de vos amis. Ainsi, ils peuvent vous éviter – et si vous vous en tenez à votre opinion, vous risquez de vous isoler progressivement. Être isolé, sans amis, est une source de peur. Alors, mieux vaut croire le récit officiel.

La lueur d’espoir qui entoure ce nuage sombre est de plus en plus visible et de plus en plus claire.

Soyez sûr de vous. Ne cédez pas

Tenez-vous en à vos propres recherches, à votre opinion fondée sur les faits, même si vous êtes insulté en tant que théoricien du complot. Défendez ce que vous croyez – et faites-le avec passion. D’autres personnes ont également des doutes, et lorsqu’elles voient des gens défendre leurs convictions avec passion, elles peuvent se joindre à vous. Et ainsi, une masse critique se développe. Et la stratégie de la théorie du complot perd rapidement de son efficacité et s’estompe. L’effacement est déjà visible dans les villes européennes et étasunienne, où des dizaines de milliers de personnes descendent dans la rue pour défendre leurs droits civils, humains et constitutionnels.

Ce sont là des signes encourageants. L’espoir ne s’efface jamais – jusqu’à ce que « nous vainquions ».

Peter Koenig est économiste et analyste géopolitique. Il est également spécialiste des ressources en eau et de l’environnement. Il a travaillé pendant plus de 30 ans à la Banque mondiale et à l’Organisation mondiale de la santé dans le monde entier dans les domaines de l’environnement et de l’eau. Il donne des conférences dans des universités aux États-Unis, en Europe et en Amérique du Sud. Il écrit régulièrement pour Global Research, ICH, New Eastern Outlook (NEO), RT, Countercurrents, Sputnik, PressTV, The 21st Century, Greanville Post, Defend Democracy Press, The Saker Blog, et d’autres sites Internet. Il est l’auteur de Implosion – Un thriller économique sur la guerre, la destruction de l’environnement et la cupidité des entreprises – une fiction basée sur des faits et sur 30 ans d’expérience de la Banque mondiale dans le monde entier. Il est également co-auteur de The World Order and Revolution ! – Essais de la Résistance.  Il est associé de recherche au Centre de recherche sur la mondialisation.


Google/Alphabet et dictature technotronique

= = =

Lectures complémentaires:

Affaire CoV19 OGM

Dossier-coronavirus-cov19-experience-ingenierie-sociale

Gary_Allen_Le-dossier-Rockefeller

Stop_Linky_gazpar_5G_etCie

HistoriqueCartelPharmaceutique

SARS-CoV_UCN

Nombre de deces quotidiens par departement | Insee

Italy_Report-COVID-2019_24_marzo_eng

L’essentiel de Résistance 71 de 2010 à 2020

La_solution_a_10%

Dossier-complet–pour-stopper-net-la-dictature-technotronique

Alerte_scientifiques_medecins_5G

 

« Un homme vivant seul répond à une frappe à sa porte. Devant lui se tient Tyrannie, armée et toute puissante qui lui demande: ‘Te soumettras-tu ?’ L’homme ne répond pas et la laisse entrer. L’homme la sert durant des années, puis Tyrannie devient malade par empoisonnement de sa nourriture. Elle finit par mourir. L’homme ouvre alors sa porte, se débarrasse du corps encore chaud, retourne dans sa maison, ferme la porte derrière lui et dit: ‘Non ! »

— Bertold Brecht —