Archive pour coronavirus science et nouvel ordre mondial

Dictature sanitaire et technotronique : liste (non exhaustive) de vidéos de médecins et scientifiques anti-vaccination

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 4 avril 2021 by Résistance 71

Liste non-exhaustive de vidéos de médecins anti-vaccins


4 avril 2021

Note de Résistance 71 : Certaines de ces vidéos ont sans doute déjà été censurées, nous invitons les lecteurs à sauvegarder celles qui peuvent encore l’être pour futur référence, la guerre de l’info et la censure font rage. Ce blog en est une victime parmi des centaines d’autres. Si l’internet permet de toucher une plus vaste audience, rien ne remplace le contact de proximité et la dissémination de l’information de bouche à oreille, sous le manteau ou au grand jour… Il est IMPOSSIBLE de faire taire à 100% une dissidence, tout pouvoir autoritaire, toute coercition la plus soft soit-elle contient en elle-même sa résistance. Il ne fait aucun doute pour nous que la voix de la raison prévaudra en tout et avec elle, l’humanité dans sa forme achevée émancipée de la dictature étatico-marchande et sa énième mutation en cette entité de gouvernance mondiale supranationale nommée « Nouvel Ordre Mondial » par l’oligarchie en place.
Messieurs/dames de la pourriture et de la dégénérescence marchande, rendez-vous, vous êtes cernés !

1. Dr. Nancy Banks –

2. Dr. Russell Blaylock –

3. Dr. Shiv Chopra –

4. Dr. Sherri Tenpenny –

5. Dr. Suzanne Humphries –

6. Dr. Larry Palevsky –

7. Dr. Toni Bark –

8. Dr. Andrew Wakefield –

9. Dr. Meryl Nass –

10. Dr. Raymond Obomsawin –

11. Dr. Ghislaine Lanctot –

12. Dr. Robert Rowen –

13. Dr. David Ayoub –

14. Dr. Boyd Haley PhD –

15. Dr. Rashid Buttar –

16. Dr. Roby Mitchell –

17. Dr. Ken Stoller –

18. Dr. Mayer Eisenstein –

19. Dr. Frank Engley, PhD –

20. Dr. David Davis –

21. Dr Tetyana Obukhanych –

22. Dr. Harold E Buttram –

23. Dr. Kelly Brogan –

24. Dr. RC Tent –

25. Dr. Rebecca Carley –

26. Dr. Andrew Moulden –

27. Dr. Jack Wolfson –

28. Dr. Michael Elice –

29. Dr. Terry Wahls –

30. Dr. Stephanie Seneff –

31. Dr. Paul Thomas –

32. Many doctors talking at once –

33. Dr. Richard Moskowitz – censored

34. Dr. Jane Orient –

35. Dr. Richard Deth –

36. Dr. Lucija Tomljenovic –

37. Dr Chris Shaw –

38. Dr. Susan McCreadie –

39. Dr. Mary Ann Block –

40. Dr. David Brownstein –

41. Dr. Jayne Donegan –

42. Dr. Troy Ross – censored

43. Dr. Philip Incao –

44. Dr. Joseph Mercola –

45. Dr. Jeff Bradstreet –

46. Dr. Robert Mendelson –

47. Dr Theresa Deisher

48. Dr. Sam Eggertsen-7a4dd71dafbb1404bfd494dae3fe02fd-b-mail-icon_video-link.gif

Lire notre page « Coronavirus, guerre contre l’humanité »

Apprenez plus sur la dictature technotronique sur Résistance 71

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71




Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~


Covid-19 – Preuves de fraude mondiale


Iain Davis


21 novembre 2020


Source de l’article en français:


La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source :

traduit par Réseau International


Lire notre page « Coronavirus, guerre biologique contre l’humanité »


Test COVID-19 RT-PCR : deux textes vitaux pour comprendre la fraude des chiffres statistiques de la pandémie (PDF)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 17 décembre 2020 by Résistance 71



Résistance 71


17 décembre 2020


Nous avons traduit et publié récemment ces deux textes que Jo nous a réunis en un temps record dans ce PDF vital à la compréhension de l’enfumage auquel nous sommes tous victimes et qui vise à la mise en place d’une bonne partie de la grille de contrôle technotronique planétaire, comme l’explique par ailleurs le physicien Philippe Guillemant, et du contrôle eugéniste de la population mondiale par l’oligarchie en charge de faire perdurer le système étatico-capitaliste en phase de mutation vers son objectif final transhumaniste.
La mise en place d’une dictature sanitaire planétaire ne peut reposer que sur une seule chose ressentie par la vaste majorité des gens: la peur, voire la psychose face à quelque chose qu’on ne peut pas voir ni maîtriser (plutôt, qu’on ne VEUT pas maîtriser). Quoi de mieux donc qu’un nouveau croquemitaine invisible et nuisible à souhait, entre ainsi en scène le nouveau coronavirus (créé en laboratoire) :

Bébert Corona. Pour que la peur soit effective, durable, ajustable et modulable il faut qu’elle s’appuie sur la « science », mais pas n’importe quelle science… celle des chiffres, des statistiques et des extrapolations modélisées, comme à l’accoutumée maintenant ; de cette science qui privilégie les modèles informatiques à l’observation de faits de terrain.
Pour ce faire, il faut des chiffres, mais pas n’importe lesquels et certainement pas ceux qui résulteraient d’une observation réelle de terrain, mais de chiffres « adaptés » pour la circonstance, non pas falsifiés par quelques personnes mal intentionnées, ce serait vite repérable, mais par un protocole litigieux à moins, frauduleux au pire, pratiqué à l’insu et au plein gré de toutes et tous. Entre en scène les kits de test RT-PCR pour Real Time-Polymerase Chain Reaction… Tout est en place… le virus a été largué dans la nature… Que la fête commence !

Qu’est-ce que ce test PCR et quel usage en est-il fait ? Quelques réponses essentielles dans ces deux articles que nous avons traduits et que Jo nous a mis en PDF, à lire et diffuser sans aucune modération.

format PDF


Entretien du Pr. Personne avec France-Soir au sujet de sa suspension.
Nous devons dire ici que depuis quelques semaines, nous sommes étonnés de voir France-Soir
comme voix critique dans les médias de masse français au sujet de cette crise COVID.
Tout à leur honneur, ne crachons pas dans la soupe…


Sensationnel de naturel brut !… Moi, Denise H., 88 ans, mère de clan, je vous emmerde Mr Macron…

Posted in actualité, coronavirus CoV19, gilets jaunes, militantisme alternatif, neoliberalisme et fascisme, police politique et totalitarisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, terrorisme d'état with tags , , , , , , , on 23 octobre 2020 by Résistance 71

La lettre coup de gueule, de Denise H., 88 ans, pour Macron.

Reçu par courriel

23 octobre 2020

Source Gilets Jaunes :

” Bonjour Monsieur le Président,

Je m’appelle Denise, j’ai 88 ans.

Ce n’est pas moi qui tape cette lettre, je ne sais pas trop comment faire.

C’est donc mon arrière petite fille de 19 ans, qui écrit sous ma dictée.

Je vous écris aujourd’hui pour vous dire toute ma colère contre vous, vos ministres, et vos conseillers « scientifiques ».

Qui êtes-vous, jeune godelureau, pour penser et décider à ma place, de ce qu’est ma vie, de ce que sera ma mort ?

J’ai 88 ans, j’ai eu une belle vie, avec ses hauts et ses bas, ses joies et ses blessures, comme tout le monde, je présume.

Dans les hauts, j’ai eu 5 enfants, tous mariés, qui ont eu à eux tous, 15 petits-enfants. La plupart de mes petits-enfants (12) sont aussi mariés, et ont maintenant à eux tous, 27 enfants. J’ai donc 27 arrières-petits enfants.

Si vous savez compter, ma famille, issue de mon mariage avec mon regretté Robert, se monte à 54 personnes. Sans parler de la famille de mes frères et sœurs, que je vois encore régulièrement. A nous tous, nous sommes plus de 250, qui nous réunissons tous les 15 août… enfin, sauf en 2020, grâce à vous.

Et encore, 2 de mes arrière-petites-filles viennent de se marier. SANS MOI !!!

Grâce à vous et vos sbires, elles ont toutes les deux été privées de leur famille au complet, et amis, car vous avez interdit les rassemblements familiaux de plus de 30 personnes pour ME PROTEGER, MOI !

Et accessoirement, mes enfants, qui ont 60 ans et plus.

Mais je ne vous ai rien demandé !


Moi, je veux VIVRE auprès des miens, les voir, les embrasser, rire et pleurer avec eux, SANS RESTRICTIONS.

Et si j’en meurs, et bien, c’est que ce sera mon heure. Je mourrais heureuse d’avoir profité de leur présence, de leur joie et de leur amour jusqu’à la fin de ma vie.

Je refuse que vous m’obligiez à vivre seule, loin de toutes et tous, sans aucun contact physique, sans câlins de mes amours, sans leur rire devant mes gâteaux… Et encore, j’ai la chance de vivre chez moi.

Mais je pense à mes amis, qui vivent en Ephad, emprisonnés dans leur chambre, sans voir personne, qui ont dû supporter la chaleur cet été, car on leur a interdit le ventilateur dans leur chambre. Ils sont en train d’en mourir ! De tristesse et de solitude. Vous êtes en train de les tuer bien plus sûrement que le covid.

Et en plus, vous les priverez de la présence de leur famille lors des obsèques, limitées elles aussi en nombre de personnes présentes.

Pourtant, vous, vous vivez bien avec une femme de plus de 65 ans. Elle n’est pas à risques ? Pourquoi ne pas l’isoler de tous contacts, elle aussi ?

En fait, selon les critères que vous nous appliquez, vous la mettez en danger, elle aussi….

Encore une incohérence de votre part.

Ma petite-fille n’a pas pu se marier avec ses amis, mais ses frères et sœurs sont venus en trains bondés, avec parfois plus de 5 heures de trajet… Logique, selon vous ?

Vous autorisez 700 personnes à se réunir sous un chapiteau, mais vous interdisez 100 personnes sous une tente de mariage ?

Vous nous interdisez de vivre car vous avez sabré les lits d’hôpitaux, sous Hollande, puis vous, directement. Vous parlez de saturation, car 1500 personnes sont en réanimation. 1500 personnes sur 66 millions de français ? De qui vous moquez-vous ? D’autant que toutes ne le sont pas pour des raisons de covid.

Il y a environ 50 morts par jour, ATTRIBUES au Covid. Est-ce une raison pour moi, mes amis, nous les « vieux », de nous priver de vivre ?

Sans compter tous les français, condamnés à la peur, au désespoir et au chômage à cause de vous… Vous ne voulez pas que nous, les vieux, nous mourrions, mais vous vous servez de nous pour faire mourir toute la France !

Monsieur le Président, laissez les français tranquilles,


Sachez qu’à partir d’aujourd’hui, 12 octobre 2020, je vais vivre comme je l’entends, en recevant qui je veux, et j’embrasserai tous ceux qui viendront me voir.

Votre avis, comme disait mon cher Robert, « je m’en tamponne le coquillard ».

Bien à vous,

Denise H.”

Dictature sanitaire : Une neurologue allemande avertit : « La privation d’oxygène crée des dommages neurologiques irréversibles »…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, militantisme alternatif, politique et lobbyisme, politique et social, politique française, résistance politique, santé, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , on 10 octobre 2020 by Résistance 71


Une neurologue allemande met en garde contre le port du masque : “La privation d’oxygène provoque des dommages neurologiques irréversibles”


8 octobre 2020


Le Dr Margareta Griesz-Brisson, docteur en médecine, est neurologue consultante et neurophysiologiste, titulaire d’un doctorat en pharmacologie, avec un intérêt particulier pour la neurotoxicologie, la médecine environnementale, la neurorégénération et la neuroplasticité. Voici ce qu’elle a à dire sur les masques et leurs effets sur notre cerveau :

« La réinhalation de l’air que nous respirons va incontestablement générer un déficit en oxygène et une saturation en dioxyde de carbone. Nous savons que le cerveau humain est très sensible à la privation d’oxygène. Il y a des cellules nerveuses, par exemple dans l’hippocampe, qui ne peuvent pas rester plus de 3 minutes sans oxygène – elles ne peuvent pas survivre.

Les symptômes d’alerte aigus sont les maux de tête, la somnolence, les vertiges, les problèmes de concentration, le ralentissement du temps de réaction – qui sont des réactions du système cognitif.

Cependant, lorsque vous souffrez d’une privation chronique d’oxygène, tous ces symptômes disparaissent, car vous vous y habituez. Mais votre efficacité demeure altérée, et la sous-alimentation en oxygène de votre cerveau continue de progresser.

Nous savons que les maladies neurodégénératives mettent des années, voire des décennies, à se développer. Si aujourd’hui, vous oubliez votre numéro de téléphone, cela indique que le processus de dégradation de votre cerveau a démarré il y a 20 ou 30 ans.

Vous pensez peut-être que vous vous êtes habitué à porter un masque et à inspirer l’air que vous venez d’expirer, mais il n’en reste pas moins que les processus dégénératifs dans votre cerveau s’amplifient à mesure que votre privation d’oxygène se poursuit.

Le deuxième problème est que les cellules nerveuses de votre cerveau sont incapables de se diviser normalement. Ainsi, au cas où nos gouvernements seraient assez généreux pour nous autoriser à enlever nos masques et à respirer à nouveau librement de l’oxygène dans quelques mois, les cellules nerveuses perdues ne seront plus régénérées. Ce qui est perdu est perdu.

Je ne porte pas de masque, j’ai besoin de mon cerveau pour réfléchir. Je veux avoir les idées claires quand je m’occupe de mes patients, et ne pas être anesthésiée au dioxyde de carbone.

Il n’existe pas d’exemption médicale infondée pour les masques faciaux, car la privation d’oxygène est dangereuse pour chaque cerveau. Chaque être humain doit pouvoir décider librement s’il veut porter un masque absolument inefficace pour se protéger contre un virus.

Pour les enfants et les adolescents, les masques sont un interdit absolu. Les enfants et les adolescents ont un système immunitaire extrêmement actif et adaptatif, et ils ont besoin d’une interaction constante avec le microbiome de la Terre. Leur cerveau est également incroyablement actif, car il a beaucoup à apprendre. Le cerveau de l’enfant, ou de l’adolescent, a soif d’oxygène. Plus l’organe est métaboliquement actif, plus il a besoin d’oxygène. Chez les enfants et les adolescents, chaque organe est métaboliquement actif.

Priver le cerveau d’un enfant ou d’un adolescent d’oxygène, ou le restreindre de quelque manière que ce soit, est non seulement dangereux pour sa santé, mais aussi absolument criminel. Le manque d’oxygène inhibe le développement du cerveau, et les dommages qui en résultent ne PEUVENT PAS être réparés.

L’enfant a besoin du cerveau pour apprendre, et le cerveau a besoin d’oxygène pour fonctionner. Nous n’avons pas besoin d’étude clinique pour le savoir. C’est un fait physiologique simple et incontestable. Un manque d’oxygène provoqué consciemment et délibérément est un danger absolument délibéré pour la santé, et une contre-indication médicale absolue.

En médecine, une contre-indication médicale absolue signifie que ce médicament, cette thérapie, cette méthode ou mesure ne doit pas être utilisé, et n’est pas autorisé à être utilisé. Pour contraindre par la force toute une population à utiliser une contre-indication médicale absolue, il faut qu’il y ait des raisons précises et sérieuses à cela, et ces raisons doivent être présentées à des organismes interdisciplinaires et indépendants compétents, pour être vérifiées et autorisées.

Lorsque, dans dix ans, la démence augmentera de manière exponentielle et que les jeunes générations ne pourront pas atteindre leur potentiel inné, cela ne servira à rien de dire que « nous n’avions pas besoin des masques ».

Comment un vétérinaire, un distributeur de logiciels, un homme d’affaires, un constructeur de voitures électriques et un physicien peuvent-ils décider des questions concernant la santé d’une population entière ? S’il vous plaît, chers collègues, nous devons tous nous réveiller.

Je sais à quel point le manque d’oxygène est dommageable pour le cerveau, les cardiologues savent à quel point il est dommageable pour le cœur, les pneumologues savent à quel point il est dommageable pour les poumons. La privation d’oxygène endommage tous les organes.

Où sont nos services de santé, notre assurance maladie, nos associations médicales ? Il aurait été de leur devoir de s’opposer avec véhémence au confinement et d’y mettre fin – dès le début.

Pourquoi les autorités médicales infligent-elles des sanctions aux médecins qui accordent des exemptions aux gens ? La personne ou le médecin doivent-ils sérieusement prouver que la privation d’oxygène est nocif pour tous ? Quel genre de médecine nos médecins et nos associations médicales représentent-ils ?

Qui est responsable de ce crime ? Ceux qui veulent le faire appliquer ? Ceux qui le laissent se produire et jouent le jeu, ou ceux qui ne l’empêchent pas ?

Il ne s’agit pas de masques, ni de virus, et certainement pas de votre santé. Il s’agit de bien plus que cela. Je ne rentre pas dans ce jeu. Je n’ai pas peur.

Comme vous pouvez le remarquer, ils nous prennent déjà notre air. L’impératif à l’heure actuelle est la responsabilité personnelle. Nous sommes responsables de ce que nous pensons – pas les médias. Nous sommes responsables de ce que nous faisons – pas nos supérieurs. Nous sommes responsables de notre santé – pas l’Organisation mondiale de la santé. Et nous sommes responsables de ce qui se passe dans notre pays – pas le gouvernement. »

Comment:Il n’existe pas de preuves scientifiques de l’efficacité des masques contre la transmission des virus par voie aérienne, mais il existe des preuves scientifiques des dangers inhérents au port du masque.

= = =

Lectures complémentaires :

COVID 19_version finale 2020_08_25

Tract aux covidiots de la terre (Jo)


Notre page « Coronavirus guerre biologique contre l’humanité »

« Le masque comme rituel de passage vers le Nouvel Ordre Mondial »


Dictature du masque et eugénisme…

CoV19 et guerre pharmaceutique… Permis de tuer et interdiction de guérir (Dr Pascal Sacré)

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, guerres imperialistes, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , on 17 juillet 2020 by Résistance 71



CoV19 Remdesivir : permis de tuer… Hydroxychloroquine : interdiction de guérir


Dr Pascal Sacré


12 juillet 2020




A lire aussi: « Coronavirus et manipulation politico-sociale : le masque comme rite de passage vers un Nouvel Ordre Mondial »


Le combat du Remdesivir contre l’Hydroxychloroquine (HCQ), c’est un peu le symbole du combat de la médecine des revues, des institutions corrompues contre la médecine de terrain, celle des médecins généralistes, nombreux, qui sont au chevet des malades.

Le Remdesivir est une molécule coûteuse, propriété d’une compagnie pharmaceutique, Gilead. Dans la course au traitement miracle du COVID-19, Gilead essaie de remporter la palme car cela peut lui rapporter gros [1].

L’Hydroxychloroquine est une molécule libre de droit, passée dans le domaine public et très peu coûteuse. Autrement dit, bien que fabriqué au départ par une compagnie pharmaceutique, Sanofi, ce traitement ne rapportera rien à l’industrie et donc rien à tous les gens corrompus par elle.

Le combat du Remdesivir contre l’Hydroxychloroquine, c’est le symbole du combat de la médecine mensongère, la médecine des gros sous, contre la médecine factuelle, une médecine qui peut rapporter gros au malade (sa santé), sans rien coûter ou presque à la société.

On dit que l’Hydroxychloroquine (traitement défendu par le professeur Raoult à Marseilles, France, entre autres) est inefficace dans le COVID-19, voire dangereux [2].

C’est faux. 

Suffisamment d’indices laissent à penser que l’Hydroxychloroquine, associée ou non à l’azythromycine et au zinc, est efficace pour inhiber la réplication virale du SRAS-CoV-2, avec un profil de sécurité tout à fait satisfaisant en particulier pour des médecins habitués et habilités à le prescrire. Ces molécules, la chloroquine et l’Hydroxychloroquine, sont connues depuis des dizaines d’années [3]. Voilà la vérité.

Inversement, on dit que le Remdesivir est efficace et sans danger particulier. 

C’est faux.

Le Remdesivir peut engendrer insuffisance rénale sévère (nécessitant dialyse, greffe rénale), insuffisance hépatique (foie), mutation génétique, problèmes cardiaques allant jusqu’à l’arrêt cardiaque, entre autres [4]. Voilà la vérité.

D’un côté, le Lancet essaie de démolir l’hydroxychloroquine [5], de l’autre, le New England Journal of Medicine fait l’éloge du Remdesivir [6-7].

Dans un article précédent, j’ai écrit que ce que les anciens rédacteurs en chef de ces revues disent ce qu’il faut en penser : corruption et mensonges à tous les étages [8].

Pour tous les médecins intègres, les véritables scientifiques, le public, cela pourrait même devenir un critère de discernement : quand une « grande » revue médicale encense un médicament, méfiez-vous ! Quand elle démolit un traitement, alors, vous feriez bien de vous y intéresser.

Big Pharma hier et aujourd’hui

Remdesivir contre Hydroxychloroquine, c’est encore et toujours une histoire de gros sous.

La médecine, ce n’est plus que cela, à présent.

Le Remdesivir rapporterait 4500 dollars par traitement à Gilead [9].

[Note de R71: Notons au passage que Gilead Science avait aussi « commis » cette escroquerie au Tamiflu lors de la crise « pandémique » de la grippe porcine H1N1 en 2009. Ce sont des coutumiers du fait avec un ancien patron qui n’est autre que Donald Rumsfeld, le ministre de la défense en charge dans l’administration Bush lors des attentats du 11 septembre 2001… Les mêmes ordures et entités derrière le flux des saloperies engendrées par le système étatico-capitaliste moribond.]

L’hydroxychloroquine, même associé à l’Azithromycine, ne coûte que 10 euros par traitement et ne rapporte rien à l’industrie.

Au lieu de culpabiliser et de faire peur à tout le monde avec des chiffres de mortalité exagérés et des deuxièmes vagues qui n’existent pas, au lieu d’imposer des mesures aussi inefficaces que toxiques comme le port du masque partout pour tous, au lieu de faire croire aux gens que des médicaments efficaces et bon marchés sont dangereux et que des médicaments chers et dangereux sont la solution, au lieu de se prosterner devant la vaccination, Graal illusoire dans la lutte contre le COVID-19, voici ce que nos hautes autorités de santé devraient faire :

  1. Prendre les conseils de scientifiques appelant à plus de calme et de réalisme sur le modèle du professeur John Ioannidis de Stanford
  2. Observer et mesurer les faits réels, et non des modèles mathématiques statistiques
  3. Ne pas confondre test RT-PCR positif et maladie COVID-19
  4. Prévoir des mesures de protection drastiques seulement pour les personnes fragiles et à haut risque
  5. Laisser circuler librement, sans masques, les personnes saines, en bonne santé et surtout, les jeunes et les enfants
  6. Proposer à toute la population des prises en charge psychologiques adaptées pour gérer les états de stress post-traumatiques générés par les médias anxiogènes
  7. Permettre à tous les médecins de première ligne de prescrire aux vrais malades du COVID-19, dès les premiers signes, l’association hydroxychloroquine-azythromycine-zinc, selon les modalités de sécurité bien établies depuis toutes ces années où ces médicaments sont prescrits dans leurs diverses indications

Ce n’est possible que si ces hautes autorités de santé ne sont pas corrompues par tout l’argent des compagnies pharmaceutiques telles que Gilead.

Pour le dernier point, numéro 6, le médecin généraliste bruxellois Éric Beeth et moi-même avons envoyé à tous les responsables concernés, ministre de la santé, membres du conseil COVID-19 au sein de SCIENSANO qui encadre le gouvernement dans la gestion de la crise, une lettre requérant la liberté pour tous les médecins belges de prescrire l’hydroxychloroquine dans le COVID-19 et surtout, la constitution au sein des pharmacies belges, d’un stock suffisant de ce médicament.

Nous attendons réponse.

Notes :

[1] Une brève histoire du remdésivir (GS-5734),  17 juin 2020, mise à jour le 25 juin 2020

[2] Hydroxychloroquine versus Remdesivir, 8 juillet 2020

[3] Hot Topic, Chloroquine for the 2019 novel coronavirus SARS-CoV-2, International Journal of Antimicrobial Agents, February 2020

[4] L’entreprise Gilead aurait-elle dissimulé la vraie toxicité du Veklury© (remdesivir) ?, 8 juillet 2020, « Il semble donc qu’au regard des éléments présentés précédemment, nous puissions fortement penser que le Veklury (remdesivir) est un médicament nocif et que ces éléments ont été dissimulés par Gilead.  Nous pensons que l’opération de lobbying conduite dans les médias et certaines instances de santé publique afin de décrédibiliser l’hydroxychloroquine, spécifiquement en milieu hospitalier, avait vocation à faire du Velkury (remdesivir) la seule solution dans cette situation. »

[5] RETRACTED: Hydroxychloroquine or chloroquine with or without a macrolide for treatment of COVID-19: a multinational registry analysis

[6] Compassionate Use of Remdesivir for Patients with Severe Covid-19, NEJM 10 avril 2020

[7] Remdesivir for the Treatment of Covid-19 — Preliminary Report, NEJM 22 mai 2020

[8] COVID-19: le côté obscur de la science révélé, « Une grande partie de la littérature scientifique, sans doute la moitié, pourrait être tout simplement fausse, affligée d’études avec des échantillons réduits, d’effets infimes, d’analyses préliminaires invalides, et de conflits d’intérêts* flagrants, avec l’obsession de suivre les tendances d’importance douteuse à la mode, la science a pris le mauvais tournant vers les ténèbres. »

[9] Remdésivir : une molécule d’intérêt thérapeutique très discutable sur le COVID-19

= = =

Lire notre page “CORONAVIRUS, guerre biologique contre l’humanité”

et aussi…


Affaire CoV19 OGM





Nombre de deces quotidiens par departement | Insee



Bouh !


Coronavirus… Réduction de la population mondiale par imposition de la dictature chimique et biologique… la phase ultime de l’eugénisme pilotée par la Fondation Bill Gates

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, guerres imperialistes, militantisme alternatif, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , on 21 juin 2020 by Résistance 71


Confiance en Bill la piquouze ?


Eugénisme n.m : méthodes consistant à améliorer le patrimoine génétique de groupes humains. La théorie qui prône l’application de ces méthodes.
( source: Encyclopaedia Universalis)


Réduire la population mondiale par des mesures eugénistes

(Extrait de la 3ème partie de la série de Derrick Broze sur Bill Gates et le réseau du fric et de l’influence)


1ère partie à lire : « Qui gère l’OMS ? »


Traduit de l’anglais par Résistance 71


14 juin 2010




Les dynasties Gates et Rockefeller sont aussi unies par leurs intérêts communs dans l’eugénisme, la pseudo-science qui fait la promotion de l’idée que les gens “biens-nés” devraient être encouragés à se reproduire tandis que ceux ayant de “mauvais gènes” devraient en être et en fait être stérilisés. Cette pseudo-science fut développé par Francis Galton (NdT: neveu de Charles Darwin, tout comme Bernays était le neveu de Freud et Julian et Aldous Huxley les petits-fils de Thomas Huxley, un des fondateurs du darwinisme-social… Qui parle de “mauvais gènes” ?…) comme stratégie afin “d’améliorer la race humaine”. L’idée fut très populaire aux Etats-Unis avant que les nazis n’embrassent cette doctrine et ne la mènent à son extrême.

L’eugénisme fut aussi très populaire au sein de la famille Rockefeller. Un rapport du Hudson Institute note : “Les premières fondations américaines furent très immergées dans l’eugénisme cet effort de promotion de la reproduction des plus forts et de supprimer la reproduction des plus faibles.” Le rapport dit que les Rockefeller et autres philanthropes américains croient en un “eugénisme philanthropique”, l’idée qu’ils pourraient utiliser leur argent pour créer des fondations qui feraient la promotion de la philosophie eugéniste.

La famille Rockefeller et sa fondation ont aidé à financer des chercheurs au Kaiser Willhem Institute de Berlin en Allemagne, qui furent impliqués dans les programmes de stérilisation nazis, elles financèrent l’Eugenics Records Office, et beaucoup  de programmes faisant la promotion du contrôle démographique des populations. En 1952, après que les expériences eugénistes nazies furent ouvertement et largement connues, John D. Rockefeller III aida à la création du Population Council afin de promouvoir l’eugénisme sans avoir la responsabilité de le mener à terme.

Dans son livre, Showing Up for Life, le père de Bill Gates, William H. Gates II, écrivit au sujet de son admiration pour les Rockefeller et leur philanthropie :

“Une leçon que nous avons apprise de l’étude et du travail avec les Rockefeller est que pour réussir dans la poursuite de buts audacieux, vous avez besoin de partenaires ayant le même état d’esprit avec lesquels collaborer. Nous avons appris que de tels buts ne sont pas des trophées conquis par des personnes au souffle court. Les Rockefeller ont affronté de durs problèmes sur des générations.”

Il apparaît que Gates II était un supporteur de l’eugénisme des Rockefeller alors qu’il servit comme patron de la société Planned Parenthood pendant un moment. Ceci fut financé en partie par un don de 1,5 millions de dollars du Population Council créé par les Rockefeller. Gates II fut précédé à la tête de Planned Parenthood par Alan Guttmacher, qui fut simultanément le directeur de l’American Eugenics Society (AES) (Director of the American Eugenics Society.).

Cet intérêt pour l’eugénisme pourrait remonter à trois générations, au grand-père de Bill Gates du nom de William H. Gates, car l’AES avait un membre de ce nom dans les années 1920. Celui listé sur la liste de l’AES l’était sous le titre de “professeur” et il il y avait un professeur William H. Gates de l’université d’état de Louisiane, mais il n’y a pas d’évidence que le grand-père de Bill Gates soit ce même professeur “William H. Gates”.

Quoi qu’il en soit, la famille Gates d’aujourd’hui a l’habitude de passer du temps avec leurs comparses philanthropes eugénistes. En décembre 2001, William H. Gates a reçu la première “Andrew Carnegie Medals of Philanthropy” pour son œuvre de charité. Gates Senior a reçu sa récompense avec Walter H et Leonore Annenberg pour la Fondation Annenberg, Brooke Astor, Irene Diamond, David et Laurance S. Rockefeller pour la famille Rockefeller, George Soros et Ted Turner. Bien que Bill Gates ne figure pas sur la photo, la corporation Carnegie mentionne que Gates senior représentait la “famille Gates”.

Plus récemment, en 2010, Bill Gates fut vu avec des comparses milliardaires dans un évènement qui fut décrit par les médias comme suit:  “Ils sont appelés le Club du Bien et ils veulent sauver le monde”. Le journal du Guardian rapporta :

“C’est le Club du Bien, le nom donné à une toute petite élite de milliardaires philanthropes qui ont récemment tenu leur première et très secrète réunion au cœur de la ville de New York.

Les noms de quelques uns de ces membres sont très connus : Bill Gates, George Soros, Warren Buffett, Oprah Winfrey, Michael Bloomberg, David Rockefeller et Ted Turner. Mais il y en a d’autres aussi, comme des géants du monde des affaires qui sont aussi riches mais beaucoup moins connus. En tout, les membres de ce club pèsent quelques 125 milliards de dollars…”

Le Guardian note également que les Rockefeller, Gates et Buffet organisèrent cette réunion. Le Wall Street Journal aussi rapporte que la réunion avait pour sujet principal la décroissance de la population mondiale, un euphémisme pour eugénisme. L’apparition de Ted Turner à la fois à a réunion de 2001 et de 2010 ne devrait pas être une surprise car Turner a toujours été un ferme avocat de la réduction de la population.

Notons aussi que malgré le déni de Bill Gates, celui-ci fut un associé du prédateur sexuel Jeffrey Epstein, comme l’a documenté Whitney Webb sur TLAV, ainsi que les tentatives de cacher ce fait.

Coïncidentalement, Epstein a aussi été exposé comme un avocat de l’eugénisme.

= = =

Lectures complémentaires :

La seconde partie du livre de G. Edward Griffin « Un monde sans cancer » sur « La politique du cancer », traite de la phagocytose du système médical américain par l’industrie chimique emmenée, à l’époque, par la très pétrochimique Standard Oil, dans les années 1910… A lire car édifiant, de fait notre traduction de très larges extraits du livre est à lire et à diffuser sans aucune modération.

Nous avons beaucoup écrit et traduit au sujet de l’eugénisme au cours de ces 10 dernières années, lire notre « dossier eugénisme ».





Affaire CoV19 OGM


Main basse sur la santé…

La fine équipe de la santé chimique…


Pandémie, dictature et répression… L’avertissement du discours de V (James McTeigue et Alan Moore)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, gilets jaunes, guerres hégémoniques, guerres imperialistes, militantisme alternatif, N.O.M, neoliberalisme et fascisme, pédagogie libération, police politique et totalitarisme, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 31 mai 2020 by Résistance 71



Résistance 71


31 mai 2020


« Derrière ce masque, il y a plus que de la chair, il y a une idée et les idées sont à l’épreuve des balles… »
~ V ~


Le monde occidental s’enferme pas à pas dans la dictature et la répression absolue. Le monde dystopique d’aujourd’hui qui s’avance fait certes de plus en plus penser au récit signal d’alarme de George Orwell « 1984 » (publié en 1948), à tel point que cela en devient tristement un cliché, mais il fait aussi penser à un autre récit futuriste, celui d’Alan Moore et de David Lloyd publié en GB en 1982 et 1983 sous forme de bande dessinée (roman graphique), reprise en 1988 par DC Comics aux Etats-Unis : « V for Vendetta ».
L’histoire fut portée à l’écran en 2005 par James McTeigue et est devenue depuis un de ces films « cultes ». Une des scènes les plus marquantes du film et qui fait référence et celle du piratage de la station de télévision par V le résistant et la diffusion de son allocution aux habitants de la ville de Londres et du Royaume-Uni, devenu une abominable dictature. Dans ce discours diffusé par piratage de la chaîne, V secoue les consciences et incite à la révolte.

Le discours de V mis à l’écran en 2005 a été adapté de l’original d’Alan Moore datant de 1982 sur toile de fond de GB thatchérienne et le rendant plus « moderne ». Ci-dessous la vidéo du discours de V dans le film de McTeigue et sous la vidéo les deux textes traduits par nos soins, le premier, transcription du discours filmé, le second du discours du livre.

Écoutez et lisez ce que dit V, où est la fiction et où est la réalité ? Il est aussi à rappeler que l’avènement, dans le récit, du haut chancelier Adam Sutler, a fait suite à une.. épidémie provoquée par la contamination volontaire au moyen d’un virus mortel, de la population de Londres et de la Grande-Bretagne, épidémie répandue et ayant fait plus de 100 000 morts…
Où va t’on ?…

A voir, lire et diffuser sans aucune modération.


Le discours de V * « V for Vendetta » (2005)



Transcription / traduction des discours du film et du livre:


Intervention télévisée de V


Traduit de l’anglais par Résistance 71


Juin 2020


Transcription du discours du film (2005) :

“Bonsoir Londres. Permettez-moi d’abord de présenter des excuses pour cette interruption. J’apprécie comme vous tous, les petits conforts de la vie routinière quotidienne, la sécurité du familier, la tranquillité de la répétition. Croyez-moi, je l’aime comme tout à chacun. Mais dans l’esprit de la commémoration, où ces évènements importants du passé habituellement associés avec la mort de quelqu’un ou la fin de quelque lutte horrible et sanguinaire, sont célébrés avec un bon jour férié. J’ai pensé que nous pouvions marquer ce 5 novembre, jour qui ne fait plus malheureusement partie du souvenir, en prenant un peu congé de nos vies quotidiennes afin de nous assoir ensemble et d’avoir une petite conversation. Il y a bien sûr ceux qui ne veulent pas que nous parlions. Je suspecte même que maintenant, des ordres ont été donnés, hurlés dans le téléphone et des hommes en armes seront bientôt en route. Pourquoi ?

Parce que bien la trique puisse être utilisée au lieu de la conversation, les mots vont toujours retenir un certain pouvoir, une certaine puissance. Les mots offrent les moyens de la signification et pour ceux qui écoutent, l’annonce de la vérité. Et la vérité est qu’il y a quelque chose de terriblement dérangé dans ce pays n’est-il pas ? Cruauté et injustice, intolérance et oppression ; et là où vous aviez la liberté de ne pas être d’accord, de penser et d’exprimer ce que vous pensiez, vous avez maintenant des censeurs et des systèmes de surveillance qui vous imposent une conformité et sollicite votre soumission. Comment cela s’est-il produit ? Qui est responsable ? Et bien certes, il y en a qui sont plus responsables que d’autres et ils seront mis devant leur responsabilité, mais une fois de plus, pour dire vrai, si vous voulez vraiment rechercher les coupables, vous n’avez qu’à regarder dans un miroir. Je sais pourquoi vous l’avez fait. Je sais que vous aviez peur. Qui n’aurait pas peur ? Guerre, terreur, maladie.

Il y a eu une myriade de problèmes qui ont conspiré pour corrompre votre raison et vous voler de votre bon sens commun. La peur a triomphé de vous et dans votre panique, vous vous êtes tournés vers le Haut Chancelier, Adam Sutler. Il vous a promis l’ordre, la paix et tout ce qu’il vous demandait en retour était votre silence, votre consentement asservi. La nuit dernière j’ai voulu mettre fin à ce silence. La nuit dernière j’ai détruit Old Bailey pour rappeler à ce pays ce qui est oublié. Il y a plus de 400 ans, un grand citoyen [Guy Fawkes] a voulu incruster à tout jamais le 5 novembre dans nos mémoires. Son espoir était de rappeler au monde que l’équité, la justice et la liberté sont au delà des mots, qu’elles sont des perspectives. Alors si vous n’avez rien vu, si les crimes de ce gouvernement vous demeurent inconnus, alors je vous suggère de laisser passer ce 5 novembre comme si de rien n’était. Mais si vous voyez ce que je vois, si vous ressentez ce que je ressens et si vous recherchez ce que je recherche, alors je vous demande de vous dresser à mes côtés dans un an  soirée pour soirée, juste devant le parlement et ensemble nous leur donnerons un 5 novembre qui jamais au grand jamais ne sera oublié.”

Du livre DC Comics USA (1990) première publication Vertigo GB (1982-83) :

Cette traduction provient de l’édition Vertigo (GB) dans une réédition datant de l’année du film en 2005, p.112-118 (traduction, Résistance 71 )

“Bonsoir Londres. J’ai pensé que nous devions avoir une petite discussion. Êtes-vous assis confortablement ? Très bien, je vais donc commencer… Je suppose que vous vous demandez pourquoi je vous ai convoqué ce soir. Et bien voyez-vous, je ne suis pas entièrement satisfait de votre performance récemment… et j’ai bien peur que nous ayons pensé à vous virer.

Oh, je sais, je sais, vous êtes avec l’entreprise depuis très très longtemps maintenant, presque… Attendez voir, oui, presque 10 000 ans ! Nom de nom que le temps passe !… Cela me semble être hier. Je me souviens quand vous avez commencé le boulot à l’entreprise, descendant de votre arbre, tout fringant et nerveux, un os agrippé dans votre poing velu… “Où est-ce que je commence monsieur ?” avez-vous demandé d’une voix lancinante. Je me rappelle de mes mots exacts de réponse : “Il y a une pile d’œufs de dinosaures là-bas gamin” dis-je en souriant paternellement… “Commencez à sucer”. Il y a un moment depuis ce temps n’est-ce pas ? et oui, oui, vous avez raison, de tout ce temps vous n’avez pas manqué une seule journée. Excellent, bon et fidèle serviteur.

Aussi s’il vous plaît, ne pensez pas que j’ai oublié les super choses que vous avez entreprises ou toutes ces inestimables contributions que vous avez faites à l’entreprise comme le feu, la roue, l’agriculture, liste impressionnante vieille branche, une superbe liste impressionnante, ne me faites pas dire ce que je n’ai pas dit, mais… bon, pour être parfaitement franc, nous avons eu nos problèmes également, impossible d’en sortir sans le mentionner. Savez-vous d’où je pense que tout cela provient ? Je vais vous le dire… C’est votre mauvaise volonté fondamentale de vous entendre au sein de l’entreprise, vous ne semblez pas vouloir prendre quelque vraie responsabilité que ce soit ou d’être votre propre patron. Pourtant, vous avez eu beaucoup d’opportunités. Nous vous avons offert une promotion encore et encore et à chaque fois vous l’avez refusée. “Je n’ai pas pu faire le boulot, gouverneur, je sais où est ma place..” avez-vous pathétiquement dit. Franchement, vous n’essayez même pas n’est-ce pas ?… Voyez-vous, vous êtes demeurés sur place bien trop longtemps, vous stagnez, et ça commence à vraiment se voir dans votre performance et ajouterai-je, dans votre attitude générale. Le pinaillage incessant dans l’usine ne m’a pas échappé, le désordre récent à la cantine du personnel et puis bien sûr il y a… je ne voulais vraiment pas aborder ce sujet, mais j’ai aussi entendu des rumeurs assez perturbantes sur votre vie personnelle. Non, non, pas de nom, je ne vous dirai pas qui m’a dit… Je comprends que vous êtes incapables de vous entendre avec votre époux(se), on me dit que vous vous disputez sans cesse, que vous hurlez votre violence. Je suis informé de manière fiable sur le fait que vous blessez toujours ceux que vous aimez, de fait, ceux à qui vous ne devriez jamais faire aucun mal… Et les enfants ? Ce sont toujours eux qui souffrent comme vous le savez sans nul doute. Pauvres chérubins, que vont ils faire et devenir ? Que vont-ils devenir après vos abus, votre désespoir, votre couardise et toutes vos bigoteries bien manigancées. Ce n’est pas assez n’est-ce pas ? Et rien ne sert non plus de blâmer la baisse des standards de travail sur la gérance non plus… Bien que, soyons persuadés que la gestion de l’affaire est particulièrement mauvaise. De fait, ne mâchons pas nos mots… La gestion est pathétique ! Nous avons eu toute une série de charlatans, de fraudeurs, de menteurs et de barjots psychos qui ont pris toute une série de décisions particulièrement catastrophiques, ceci est un fait établi et bien réel, mais qui les a élus ? qui les a amenés au pouvoir ? Vous ! C’est vous qui avez mis ces personnes au pouvoir, vous qui leur avez donné le pouvoir de prendre toute décision pour vous ! Alors, je veux bien admettre que tout le monde puisse faire une erreur une fois, mais continuer à répéter cette même erreur létale siècle après siècle, cela me semble en fait être quelque chose de parfaitement délibéré. Vous avez encouragé ces incompétents malfaisants qui ont réduit vos vies de tous les jours à la misère et au pathétisme actuel ; vous avez accepté sans questions leurs ordres insensés. Vous les avez autorisés à remplir votre espace de vie et de travail  de machines dangereuses et sans fondement réel. Vous auriez pu les arrêter. Tout ce que vous aviez à faire était de dire NON ! Vous  n’avez pas de couilles, pas de fierté, vous n’êtes plus un membre de valeur de cette entreprise. Mais je serais néanmoins généreux. Vous aurez deux ans pour me montrer une amélioration dans votre travail. Si à la fin de cette période vous n’êtes toujours pas capables ou vous ne voulez toujours pas allez de l’avant, vous serez virés. Ce sera tout, vous pouvez retourner à vos travaux. Le service régulier reprendra dès que possible…”


Déconfinement CoV19… L’opération psychologique de domination continue…

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, guerres imperialistes, N.O.M, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , on 14 mai 2020 by Résistance 71



Résistance 71


14 mai 2020


Après l’état de psychose et de paranoïa généralisé au cœur de la maladie, savamment entretenu par les instances politico-médiatico-oligarcho-sanitaires, nous sommes en phase 3 de l’opération psychologique : celle de redonner l’espoir, de refaire toucher du doigt ce qu’était « le monde d’avant » comme ils l’appellent maintenant, tout en faisant comprendre que « plus rien ne sera jamais comme avant » ( « … Alligator 427 aux longs crocs venimeux, je vous attends… » nous disait déjà Hubert Félix Thiéfaine il y a quelques décennies…).
Dans le même temps, le but caché est de rendre la vie des citoyens si pathétique et misérable en soufflant constamment le chaud et le froid en usant de la carotte et du bâton que ceux-ci, se disent les maîtres manipulateurs, à terme, imploreront pour que soit mis en place une solution qui « rendra une forme de normalité »… En l’occurence, la solution toute prête à cette chaîne réactive classique de l’action => réaction => solution, l’oligarchie contrôlant depuis le départ chaque élément de la chaîne à des fins bien spécifiques.
Nous vivons dans une gigantesque PsyOp à l’échelle planétaire dont le seul but est de mener les gens à accepter de leur plein gré les mesures dictatoriales déployées pas à pas jusqu’à l’estocade finale d’ici un an ou 18 mois: le déroulement planétaire simultané du « vaccin CoV19 » et de la 5G qui sera alors perçu, pensent nos soi-disants maîtres, comme la solution miracle à la misère induite que nous aurons subie.
Nous réitérons ici ce que nous avions dit en note d’un précédent article, parce que ceci est à nos yeux d’une importance capitale pour la compréhension de ce qui se passe et pour notre capacité d’agir sur cette réalité qui nous est imposée en plus du reste de notre réalité historique de dominés que nous devons comprendre, assimiler et intégrer pour enfin pouvoir lutter efficacement contre la tyrannie étatico-marchande qui nous opprime depuis bien trop longtemps. Elle est en phase finale d’auto-destruction et veut nous emmener avec elle dans le nihilisme chaotique de sa nature enfin révélée car ne pouvant plus la cacher. Le fin du système est proche et il est en phase de son ultime métamorphose en ce Nouvel Ordre Mondial, dictature achevée de la dictature marchande technotronique, seuls, nous, les peuples, pourront empêcher l’apocalypse eugéniste planifiée qui arrive. Nous ne pourrons le faire que dans un sursaut de conscience de l’humanité.

Voici ce que nous disions le 12 mai 2020:

« Pour en savoir plus sur le comment et pourquoi la santé est tombée dans l’escarcelle de cette méduse Big Pharma qui contrôle tout ce qui y touche en partant de l’industrie (pétro)chimique, lire ces deux PDF faits de nos traductions. Le premier concerne le cancer, « Un monde sans Cancer », la seconde partie du livre de G. Edward Griffin est consacrée à la « politique » de la santé et concerne la méduse pétrochimique d Big Pharma et comment fut phagocytée la médecine holistique au profit du tout chimique. Le second est notre traduction de 2011 de larges extraits du livre de Gary Allen « The Rockefeller’s Files » (1976) et que Jo nous a récemment mis en format PDF. 

« Un monde sans cancer, histoire de la vitamine B17 »

Gary Allen « Les dossiers Rockefeller »

A lire et à diffuser sans aucune modération tant il est vital de comprendre les rouages du comment on en est arrivé là. Le vaccin du CoV19 à venir sera DEVASTATEUR pour l’humanité tant sur un plan santé publique que sur un plan de contrôle technotronique de la planète au profit de la même clique oligarchique. Ils vont commencer dans les écoles par nos enfants ! Personne ne saura précisément ce que ces ordures vont leur injecter. La composition de tout vaccin doit être indépendamment vérifiée et RENDUE PUBLIQUE. Ceci est une nécessité de salut public !

Toute composition de vaccin et de médicament doit fonctionner sur le modèle informatique de « l’open source » qui voit tous les codes de programmation d’un logiciel être rendus publics de façon à ce que le contrôle et la participation de tout spécialiste au développement du ou des logiciels, rende impossible la falsification des codes et la création de backdoors servant des intérêts privés ou gouvernementaux à l’insu des utilisateurs. Ainsi les compositions chimiques voire génétiques de tous vaccins et médicaments doivent être vérifiées et rendues publiques. A défaut, et sachant qu’historiquement nous ne pouvons en aucun cas faire confiance à Big Pharma (IG Farben, Standard Oil et consorts) au passé eugéniste, corrompu et criminel d’une lourdeur sans précédent, toute fabrication médicale du consortium marchand du contrôle sanitaire doit être rejetée par les peuples comme étant au mieux foireux et manipulé, au pire toxique à dessein.

La suite de cette crise fabriquée du CoV19 va prendre une tournure des plus sinistres si nous laissons faire les criminels irresponsables du haut de la pyramide. De fait, afin de sortir de cette relation mortifère dominant / dominé, aplatissons cette pyramide une bonne fois pour toute… Comment ? Quelques éléments de réponse ici et là.« 

Aussi, qu’est-ce que le CoV19 / SRAS-COV-2 exactement ?…

Le futur oligarchique dans les prochains 18 mois ou peu s’en faut sera ceci:


Il suffit de dire NON !

…d’embrasser notre complémentarité,
et de vivre, unis et solidaires dans notre
humanité finalement achevée !

Coronavirus : Être conscient de l’utilisation de la crise sanitaire courante comme d’un outil de la domestication et de la domination…

Posted in 3eme guerre mondiale, actualité, altermondialisme, autogestion, coronavirus CoV19, crise mondiale, gilets jaunes, guerres hégémoniques, guerres imperialistes, ingérence et etats-unis, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 11 mai 2020 by Résistance 71


Contre le virus du contrôle…


La crise sanitaire comme outil de domestication


Paris Luttes Info


1er mai 2020


url de l’article en français:


Ce texte a été publié le 3 avril 2020 par la Biblioteca Social Contrabando de Valencia en Espagne, un mois après que l’OMS déclarait que le Covid-19 passait d’épidémie à pandémie, et quinze jours après que le gouvernement espagnol décrétait l’état d’urgence et le confinement de la population. Alors que seules les informations des institutions gouvernementales, sanitaires et policières étaient relayées par les médias, déconstruire le discours officiel sur la pandémie est apparu comme une nécessité : en même temps qu’était annoncée la catastrophe sanitaire pointait l’impossibilité d’énoncer toute critique. Il ne s’agit pas de mettre en doute le virus et son origine biologique – ce qui est un leurre pour dévier notre attention – mais de faire la distinction entre la pandémie et sa mise en scène, entre la menace de la contagion et son instrumentalisation par l’État pour s’assurer un contrôle social total. La crise sanitaire n’est-elle pas une aubaine pour l’État et le capitalisme ?

La crise sanitaire comme outil de domestication

Ce texte se veut une contribution au débat sur ce qui est en train de se passer. Il tente de comprendre un peu mieux ce que le récit officiel de l’épidémie nous raconte, ce qu’il nous cache, et la manière dont les institutions le mettent en pratique. Il s’agit de contribuer à la création d’une perspective critique qui puisse servir à affronter ce qui nous attend.

Ce que nous racontent les médias sur l’épidémie ressemble à une histoire d’horreur, et ce qui se passe dans le voisinage et dans les hôpitaux semble en confirmer l’authenticité. L’histoire officielle de cette épidémie dirige notre attention vers certains aspects de la réalité tout en occultant d’autres. Cette histoire paraît familière et semble simplifier trop les choses : une menace, des gentils, des méchants et la promesse d’une fin rassurante. À condition de bien suivre les directives, évidemment ! Les mesures prises par les institutions publiques vont dans le même sens que ce récit et donnent lieu à des situations graves en matière sanitaire et sociale.

Au milieu de la confusion, le récit officiel donne un visage aux agents qui interviennent dans la crise et apporte ainsi un sens concret aux événements. Il indique les voies à suivre pour la gestion sanitaire, sociale et punitive de la crise. Il convient de prêter attention à ce que disent, ce que font et ce que cachent les institutions pour mieux comprendre ce qui se passe. La forme littéraire permet aux autorités de mélanger le social avec le policier, le malade avec les institutions et le virus avec l’indiscipline. Le récit permet l’emprunt de mots et de métaphores entre des sphères différentes, ce qui facilite la gouvernance.

Un virus sauvage

Selon les médias, l’épidémie vient d’Orient, précisément d’une zone où la civilisation et le progrès cohabitent avec le primitif. Il est curieux que la plupart des récits sur les épidémies situent leurs origines loin d’Europe et des États-Unis. Ils présentent le virus comme une manifestation de la nature sauvage. On dit de lui qu’il est féroce, rusé, égoïste, destructeur… des traits à mi-chemin entre l’animal et l’humain. Curieusement, ce sont les mêmes attributs avec lesquels les Romains décrivaient les Barbares. Pour l’Empire romain, étaient barbares celles et ceux qui menaçaient la stabilité de Rome depuis l’extérieur (les peuples voisins) ou depuis l’intérieur (la plèbe rebelle et les esclaves).

Le récit officiel relie le degré de civilisation d’un endroit donné à la force des institutions chargées de la sécurité et de la santé ; un État fort serait synonyme de civilisation. Quand les médias signalent un territoire comme origine de l’épidémie, ce qu’ils annoncent c’est l’imposition dans cette zone de nouvelles mesures de contrôle sanitaire et policier, que ce soit au niveau national ou international. L’alibi le plus fréquent pour justifier la colonisation a toujours été le désir de civiliser l’autre.

Ce qui n’est pas dit, c’est que beaucoup de ces maladies apparaissent dans des territoires récemment urbanisés et industrialisés. Les processus brusques d’urbanisation et d’entassement de la population favorisent la transmission d’agents pathogènes. L’urbanisation intensive des écosystèmes naturels accule la faune dans des espaces réduits. L’industrie agroalimentaire entasse les animaux et introduit des produits chimiques, des antiviraux, des antibiotiques, etc. En général, la transformation soudaine de l’habitat humain et animal favorise l’apparition de maladies. On en a pour exemples la grippe porcine, la grippe aviaire, la maladie de la vache folle, etc. Le capitalisme a sans cesse besoin de s’étendre et de coloniser des territoires, mais il n’apparaîtra jamais comme responsable d’aucune épidémie. Il est beaucoup plus facile d’accuser un peuple lointain et étranger, aux mœurs prétendument peu civilisées.

Le virus incarné

Le récit officiel nous suggère qu’en franchissant la barrière des espèces, le virus nous transforme, mais pas tous à la même enseigne. À celles et ceux qui se soumettent à la discipline sanitaire et au contrôle social, malades ou pas, on attribue le rôle de victimes. Les personnes indisciplinées, quant à elles, sont désignées comme étant complices du virus, par égoïsme ou par irresponsabilité, et deviennent des boucs émissaires. La période d’incubation du virus facilite l’apparition de la figure du porteur sain, inconscient de sa propre infection. Le récit officiel accorde beaucoup d’attention à cette figure du porteur sain, le culpabilisant, et génère ainsi une atmosphère de méfiance générale proche de la paranoïa.

Selon la version officielle, la guérison exige une soumission totale aux normes sanitaires et la réalisation d’une sorte de sacrifice. Les sacrifices du et de la malade sont l’isolement et la soumission au traitement médical (quand il a la chance d’en recevoir), pour les autres le sacrifice est le confinement. Dans la Bible, lorsque Jésus soigne un lépreux, il lui recommande d’expier ses péchés par le sacrifice pour guérir complètement. Le lien entre maladie et péché vient de loin sauf qu’aujourd’hui on ne parle plus de rédemption, mais de soumission aveugle comme forme de responsabilité sociale.

Cette manière moralisatrice de présenter l’épidémie culpabilise les personnes tandis qu’elle exempte de toutes responsabilités le commerce et la gestion publique. Mais les maladies ne deviennent pas des épidémies par la faute d’une ou plusieurs personnes. Il faut pour cela un contexte favorable qui soit à la fois environnemental, social, économique, infrastructurel, etc. Affronter cela impliquerait de rentrer en collision avec le commerce capitaliste, et ce n’est pas ce que veulent les autorités. Toute personne est susceptible d’être porteuse du virus, c’est pour cela qu’a été décrété notre confinement à la maison, au quartier ou au village, dans le pays. Les autorités nous assurent que c’est pour éviter la contagion, mais en verbalisant les gens qui sortent dans la rue, seul·e·s ou accompagné·e·s d’un·e cohabitant·e, la justification médicale semble laisser place à celle de l’ordre public. On nous informe mal et on nous dit, avec un ton paternel et un langage infantilisant, que nous devons rester à la maison pour notre bien et celui des autres. L’urgence contraint à ne pas questionner les décisions des experts, et encore moins à envisager une autre forme de gestion de la crise ; il n’y a rien à discuter. Le problème c’est que l’urgence devient de plus en plus la norme. En outre, notre totale dépendance au système de santé publique, l’absence d’alternatives de base dans ce domaine, fait qu’il est même difficile d’envisager d’autres manières d’affronter l’épidémie.

Le confinement encourage la surexposition aux médias et aux réseaux sociaux. La combinaison d’isolement et de communication télématique génère une culture du confinement dont l’ingrédient principal est le syndrome de Stockholm. De plus, le virtuel se normalise comme substitut aseptisé au réel et aux relations de proximité. Cette culture naturalise le contrôle social, commence à percevoir la rue comme un espace à risques, et la maison comme un refuge serein. Dans ce contexte, l’isolement s’annonce comme une forme d’hygiène sociale qui doit être complétée par la discipline et le maintien de l’ordre. La culture du confinement reproduit les traits de la culture, des valeurs et des habitudes de la classe dominante. La propagande officielle nous dit que nous devons être solidaires et rester à la maison, mais en échange elle fomente à tout instant une culture de l’individualisme, de l’indifférence pour l’autre, du calcul sans émotions, des émotions sans réflexion, une culture qui s’infiltre à domicile par l’intermédiaire des médias et des réseaux cybernétiques. Parce que la majeure partie de la population dépend au quotidien de réseaux informels d’entraide et de solidarité, adopter la culture de l’élite est non seulement frustrant, mais aussi suicidaire. Le récit officiel de l’épidémie est le principal promoteur de cette culture du confinement, et c’est le seul qu’on entend pour le moment.

Les rues sont réduites à des lieux de passage pour les travailleur·euse·s et les consommateur·rice·s, la ville est pacifiée. Cela ressemble au rêve des premiers urbanistes du XIXe siècle devenu réalité. C’est à cette époque qu’est apparu le terme « contrôle social » pour parler du travail des urbanistes qui incorporaient déjà la logique sanitaire à leurs projets. La planification urbaine devait ordonner l’espace, la mobilité et les interactions entre les individus pour prévenir l’apparition de pathologies médicales (maladies) et sociales (révoltes, mutineries, etc.). Certaines de ces transformations ont eu des effets positifs sur la santé, mais en contrepartie elles ont accru le contrôle social. À l’époque comme aujourd’hui, la soumission et le contrôle social sont le prix à payer en échange de la promesse d’une bonne santé. Quand on transpose le récit officiel de l’épidémie au territoire, il se convertit en un mécanisme de gouvernance en étroite relation avec les processus de gentrification. Ce que cache la version officielle c’est qu’en étant isolé·e·s, nous sommes plus vulnérables aux effets de n’importe quelle crise et du capitalisme en général.

Ce qu’elle évite de dire aussi, c’est que le verbiage médical sert à maquiller la domestication sanitaire de la population.

Selon le récit officiel, la maison est un espace sûr qui sert de refuge contre la menace extérieure. Cette logique s’applique aussi au domaine institutionnel, et ainsi la fermeture des frontières cherche à immuniser le pays face à la menace extérieure, même si celles-ci étaient déjà fermées à la majorité des humains. Ce transfert du personnel au public prétend, entre autres, stimuler l’identité nationale entendue comme collectivité immunitaire. Les crises sont des moments délicats et les institutions ont besoin de préserver leur légitimité. Les phénomènes biologiques ne respectent pas les limites des frontières ni les contrôles douaniers, et mettent en évidence leur caractère arbitraire, artificiel. De plus, le manque de moyens et le manque de prévision face à la probabilité d’épidémies montrent que l’État ne tient pas sa promesse de protéger la santé de la population. Tout envelopper dans le drapeau national permet d’éviter que la légitimité des institutions soit atteinte.

La guerre sanitaire

Ces derniers jours, la plupart des décisions gouvernementales ont suivi une logique à mi-chemin entre le médical et le militaire. En principe, voir des militaires et des médecins réunis dans une même conférence de presse peut paraître étrange, mais là non plus il n’y a rien de nouveau [1]. Durant la Première Guerre mondiale, les épidémies avaient tendance à occasionner beaucoup de pertes, elles représentaient une menace aussi importante que les armées ennemies. Pour les médecins militaires, la patrie était un corps social menacé par les ennemis aussi bien humains que microbiens. Le style belliqueux de la lutte contre l’épidémie, que l’on retrouve autant dans le récit que dans sa mise en pratique, suit cette même logique. Ce qui ne se dit pas c’est que la santé des institutions et celle de la population sont deux choses différentes. On n’explique pas non plus pourquoi la plupart des mesures gouvernementales prises pendant et après la crise ont tendance à empirer les conditions de vie des secteurs les plus opprimés et les plus exploités.

L’ambiance de guerre a converti les médias et les réseaux sociaux en une espèce d’aspirateur de l’attention. Chaque jour, les pales (médicale, politique, militaire et policière) de la machine de l’État se mettent à tourner, et génèrent un courant de statistiques, de données et d’émotions qui nous emporte dans la logique institutionnelle. Ce courant statocentrique prétend renforcer le lien entre individus et institutions, en présentant ces dernières comme les seules intermédiaires entre la population et l’épidémie (ou l’incendie, le tremblement de terre, l’inondation, etc.). Selon leurs porte-paroles, la guerre sanitaire comporte deux fronts principaux : celui microbien du ressort du personnel sanitaire et scientifique, et celui territorial du ressort de la police. Il est fort probable que la suractivité dans le domaine répressif cherche à dissimuler la faiblesse d’un système sanitaire déjà effondré avant l’épidémie et avant les coupes budgétaires successives. La harangue militaire ne reconnaît pas non plus que ce sont les transformations politiques, économiques et sociales du capitalisme qui répandent les épidémies. Le discours officiel éclipse le fait que la logique militaire ne fait que contribuer à aggraver les problèmes provoqués par la maladie.

Le courant statocentrique a tendance à affaiblir les liens sociaux qui ne sont pas axés sur les institutions. Ces liens sont nécessaires à la vie, et plus on est dans une situation de vulnérabilité plus on en dépend. La logique immunitaire est un luxe que tout le monde ne peut pas se permettre. Les systèmes de santé publique et privée monopolisent la gestion de notre santé, et les décisions se prennent entre experts et gestionnaires. Compte tenu de la situation du système public de santé déjà avant la crise, il est probable qu’il n’y avait pas tellement d’autres alternatives que le confinement, mais de toute manière la population n’est pas appelée à donner son avis sur la question. Comme ce fut le cas dans d’autres crises, l’État reprend la main pour gérer les catastrophes produites par le capitalisme et garantir sa continuité. La gestion publique de cette épidémie semble suivre le modèle chinois, surtout dans le domaine répressif.

Le couronnement des héros

Le récit officiel fonctionne parce qu’il promet une fin rassurante : l’endiguement de l’épidémie. Il nous indique à l’avance qui seront les artisans de la victoire ; les héros seront les institutions sanitaires, scientifiques et punitives, et le gouvernement. En deuxième lieu il y aurait les citoyen·ne·s discipliné·e·s, puis viendraient les porteur·euse·s inconscient·e·s du virus et enfin, au fond des enfers, une minorité indisciplinée atteinte par le virus. Cette échelle est parfaitement reconnaissable par le traitement médiatique différencié que reçoit chaque échelon. Le récit officiel fait bien la distinction entre le rôle des héros et des simples soldats qui accomplissent leur devoir, comme le personnel soignant (rémunéré ou non), et le reste des travailleur·euse·s qui continuent de travailler. Ceci dit, le couronnement des héros ne sera qu’une pause, jusqu’à la prochaine apparition du virus ou de son cousin. Si ce sont des contextes sociaux, économiques ou géopolitiques à long terme qui provoquent l’apparition des épidémies, alors la prochaine crise nous attend déjà au coin de la rue. Les héros servent de modèles de conduite, ils sont la jonction qui permet aux personnes confinées de s’identifier avec les autorités aux commandes. Quand, malgré les héros, le lien sujet-État se fragilise apparaissent la critique et l’indiscipline, ce qui est la pire des maladies pour une institution.

Comprendre les stats…

La nécessité d’une approche critique

Les analystes militaires disent que le langage doit être employé pour confondre l’ennemi, rallier et motiver les amis, et gagner le soutien des spectateur·rice·s hésitant·e·s, et ils ajoutent que la guerre est davantage un duel de narrations que de raisons ou de données. Dans cette guerre sanitaire, l’ennemi est a priori le virus. Ce virus semble avoir pour alliés les relations interpersonnelles non médiées par l’État, et la population indisciplinée. Le récit officiel génère la panique, il court-circuite la capacité critique et renforce la culture de la classe dominante. Il oriente ainsi les axes de travail scientifiques, médicaux et policiers, aggravant la situation déjà délicate de nombreuses personnes. Le récit encourage la soumission aveugle à l’autorité et stigmatise des secteurs précis de la population. Il serait bon de sortir du cloisonnement militaro-sanitaire dans lequel on cherche à nous confiner pour avoir une perspective plus large, c’est-à-dire meilleure.

Crise structurelle, non exceptionnelle

Cette épidémie n’a rien d’un événement singulier et soudain, nous en avons déjà connu d’autres semblables auparavant, quoiqu’à des degrés différents. L’émergence d’épidémies et de guerres dépend de facteurs sociaux, et en cela elles sont en lien avec les formes de la domination. La forme actuelle est le capitalisme et cela faisait déjà longtemps qu’on nous annonçait qu’il allait de nouveau entrer en crise ; il semblerait que ce soit en train d’arriver. L’épidémie accélère des processus économiques et de contrôle social. Certains de ces processus s’annonçaient déjà depuis longtemps, comme le retour de la crise économique, d’autres en revanche n’étaient encore testés qu’à une plus petite échelle, comme les technologies de contrôle social. C’est maintenant la crise du coronavirus, comme ce fut en 2008 la crise des subprimes, comme il y eut avant celle de la bulle Internet et celle du pétrole. Toutes ces crises sont diverses manifestations d’un capitalisme en crise permanente, depuis au moins cinquante ans. Sauf que l’originalité de celle-ci est de conduire à la paralysie d’une grande partie de l’économie.

En 2008, le récit officiel décrivait la crise comme une catastrophe naturelle, avec ses tremblements de terre financiers, ses tempêtes sur les marchés, sa sécheresse du crédit, etc. Le capitalisme se présentait comme un fait naturel, et le remettre en question reviendrait à remettre en question la brise marine. Cette crise tendait aussi à être décrite comme une maladie qui attaquait la santé de l’économie, et à laquelle on injectait de la liquidité pour assainir les comptes. Représenter la crise comme une pathologie occulte la possibilité d’un autre type de diagnostic, comme le fait que la maladie soit le capitalisme lui-même.

Les épidémies répondent à des causes structurelles, elles sont en lien avec le modèle social dans lequel elles se développent, qui dans ce cas précis est le capitalisme. Chaque crise que nous vivons répond aux nécessités de transformation du modèle capitaliste.

Le récit sur l’épidémie qu’on nous conte aujourd’hui n’a rien de nouveau, il en existe des versions antérieures. Tandis que la Bible faisait le lien entre maladie et péché, les théologiens médiévaux en raffinèrent l’argument. Dans leurs écrits, ils accusaient les hérétiques, les Juifs, les gitans et les Maures de provoquer des épidémies et d’être eux-mêmes un fléau contagieux. La diffusion de ces idées poussa au confinement et à la persécution des populations entières.

Les chroniques des épidémies du XIXe siècle accusaient les personnes migrantes d’être porteuses de maladies, d’autant plus si elles résistaient contre la perte de leur culture d’origine. Les premières femmes qui luttèrent contre les rôles assignés par le patriarcat furent aussi l’objet de cette accusation. Dans leur cas, on les accusait de propager une maladie au cœur même du corps social, la famille. Le traitement qui leur fut administré fut, une fois encore, de les confiner au foyer. Pendant la Guerre froide, les porteurs de maladies devinrent plus sinistres. Dissident·e·s et agitateur·rice·s s’infiltraient en catimini dans la population et contaminaient par leurs idées les citoyen·ne·s honorables. Dans ces mêmes années, la lutte anticoloniale amena les métropoles à accuser leurs colonies d’être des territoires dangereux sur le plan sanitaire et prédisposés à la maladie communiste.

Dans tous ces cas, le récit de l’épidémie a eu une structure similaire, des héros et des vilains comparables, et une fin analogue. Finalement, le récit se termine toujours par le renforcement de la culture des élites comme culture dominante, et par la criminalisation de secteurs entiers de la population.

Un virus qui chevauche le capitalisme

Les agents pathogènes ont besoin d’écosystèmes favorables pour se reproduire, c’est-à-dire qu’il faut qu’il y ait une relation adéquate entre le virus et les processus sociaux, environnementaux, technologiques, etc. L’industrialisation et l’urbanisation intensives constituent des écosystèmes favorables pour l’émergence d’épidémies, comme toute transformation brutale de l’habitat animal et humain. Le capitalisme est l’authentique patient zéro, tandis que les institutions étatiques s’en lavent les mains et se limitent à gérer les conséquences de l’épidémie. Le modèle social capitaliste repose sur la compétition et l’inégalité, c’est la raison pour laquelle il a besoin de structures qui puissent garantir la sécurité de son commerce et la paix sociale. L’état d’urgence actuel ne fait qu’intensifier des mesures répressives déjà existantes auparavant, mais il les étend surtout à une grande partie de la société. Le confinement est une mesure qui prétend éviter le contact entre les personnes et entrave les réseaux informels d’amitié et d’entraide. La distance sociale qu’on nous impose nous touche tou·te·s sans exception, mais il y a celles et ceux dont la survie dépend totalement de ces réseaux tel·le·s que les migrant·e·s, les détenu·e·s, les mères célibataires, etc. Et même lorsqu’on n’est pas directement concerné·e par ces situations, le confinement aggrave le malaise provoqué par l’exploitation et la domination déjà présentes depuis longtemps. Il y a confinements et confinements.

La « Ley Mordaza » [2] a été conçue pour réprimer les protestations durant la crise précédente et elle est devenue un outil fondamental pour punir l’indiscipline à cette période. Il est fort probable que, comme cela s’est passé ailleurs, certaines des mesures exceptionnelles prises aujourd’hui finissent par s’inscrire de manière permanente dans nos vies. Désormais, le bâillonnement a une utilité sanitaire.

Agresser la vie

Le capitalisme nuit à la vie en polluant l’environnement et en détruisant les milieux naturels. Les inégalités et l’exploitation rendent difficile le maintien de la vie collective. La logique capitaliste découpe la vie, elle la divise entre travail productif et travail reproductif, et la convertit en une course suicidaire. L’État attaque la vie avec son système punitif et les guerres. De surcroît, le capitalisme sacrifie de temps en temps une partie de la population en favorisant la survenue d’épidémies.

La structure du récit officiel est semblable à celle des rites de passage ancestraux, ceux-là mêmes en usage autrefois pour marquer les différentes étapes de la vie (de l’enfance à l’âge adulte, du célibat au couple, etc.). Ces cérémonies servent à préparer les membres de la communauté aux changements qui les attendent. Ces rites de passage avaient l’habitude de se structurer en trois phases, la première étant la séparation du reste de la communauté. Venait ensuite une période de transformation personnelle. Enfin, l’individu réintégrait le groupe en tant que personne nouvelle.

Le récit officiel de l’épidémie et ses applications pratiques prétendent transformer la culture, les valeurs et les habitudes de la population pour les adapter aux besoins du capitalisme. À cette fin, ils font la promotion d’identités collectives, comme celle du citoyen responsable ou celle du patriote, et ils encouragent des formes déterminées de relations entre les personnes, et entre celles-ci et le milieu naturel. Certains aspects de cette transformation sont déjà perceptibles, comme l’utilisation du foyer comme un espace multiusage (travail, consommation, éducation, gestion domestique). Dorénavant, la distance sociale est présentée comme une habitude saine, alors que la rencontre qui n’est pas médiée par les institutions génère de la suspicion.

Les processus de transformation du capitalisme constituent des situations délicates pour les institutions étatiques. Ils mettent en jeu la légitimité des États, qui mobilisent alors beaucoup de ressources et intensifient la violence structurelle et la violence plus visible. Les conséquences de cette manière d’affronter la crise commencent déjà à se voir, et ce n’est que le début.

Défendre la possibilité de vivre dignement, de vivre tout simplement, requiert la capacité de créer une perspective critique sur ce qui est en train de se passer, et sur ce que le récit officiel de l’épidémie dit qu’il se passe. Cela doit se traduire dans la pratique, par exemple, avec les tentatives de créer des réseaux d’entraide. Ces réseaux constituent une réponse cohérente face à l’attaque des relations entre les personnes et les groupes, et c’est la raison pour laquelle l’État est déjà en train d’essayer de les récupérer pour en faire un exemple de citoyenneté responsable. L’entraide est une bonne base à partir de laquelle dépasser la logique de guerre sanitaire, mais pour éviter qu’elle soit récupérée elle doit aussi marquer clairement la ligne entre les camps. De l’entraide, il faut faire éclater la colère, il faut contribuer à ce qu’émerge son essence anticapitaliste.

Pour y parvenir, nous devons prendre soin de nous-mêmes, et c’est peut-être le meilleur moment pour reconsidérer le fait que laisser allègrement notre santé et notre sécurité aux mains de l’État et du Marché n’est pas la chose la plus sensée. Les réseaux d’entraide, les assemblées de quartier, les collectifs de soutien aux personnes migrantes et détenues, etc. pourraient constituer une bonne base pour tisser de nouveaux liens de solidarité. Ces tissus collectifs pourraient arracher au pouvoir des espaces d’autonomie, à partir desquels faire face aux agressions de l’État et du marché et vivre plus dignement.

Biblioteca Social Contrabando, le 3 avril 2020

Version originale en castillan sur Ateneulibertaricabanyal


[1] Chaque jour, le midi, les radios et télévisions publiques espagnoles diffusent une conférence de presse au cours de laquelle des représentants des autorités sanitaires, militaires et policières mettent à jour les données officielles sur la situation du Covid-19 dans le pays. (NdT)

[2] « Loi Bâillon » ou « loi de sécurité citoyenne » votée au printemps 2015 pour répondre à la contestation sociale qui agite l’Espagne en pleine crise économique. Elle restreint considérablement les libertés individuelles et publiques comme les droits de la presse, de grève, de réunion et de manifestation, en plus de renforcer les capacités répressives de l’État. (NdT)

= = =

Comment en sortir ?… Lectures complémentaires essentielles:

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir !

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »


4 textes modernes complémentaires pour mieux comprendre et agir:


Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés



Eh classe dominante…
¡Ya Basta!