Archive pour coronavirus guerre biologique

COVID-19 fabrication de pandémie et falsification des données, mensonges d’état pour dictature technotronique… Présentation du livre « Le virus et le président » (Izambert-Janvier)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 16 janvier 2021 by Résistance 71

 



 

COVID-19 le vaccin inachevé

 

Jean-Loup Izambert et Claude Janvier

 

Reçu par courriel des auteurs le 13 janvier 2021

 

Commander le livre : https://www.is-ebooks.com/produit/194/9782368452905/le-virus-et-le-president 

 

Impossible d’ignorer que Pfizer et Moderna ont créés en moins d’une année un vaccin ARN messager décrit et salué par des médecins, des politiciens et la presse main stream comme révolutionnaire et efficace contre le Coronavirus. Une vraie prouesse ! Et une vaste fumisterie qui cache les objectifs réels de ces  producteurs de « vaccins miracle ». Avec la complicité du gouvernement français.

Tout est bon pour inciter les citoyens à se faire injecter le précieux liquide. Du chef de l’Etat, en passant par les ministres, les parlementaires, les médias et une certaine caste de médecins, la propagande bat son plein. Comme si cela ne suffisait pas, un collectif d’artistes s’est formé afin de marteler le message tout en louant les vertus de ce vaccin1. Du reste que connaissent-ils ces artistes du processus de la mise au point d’un vaccin ? Rien ! Strictement rien ! Leur démarche est guidée par le bla-bla des lobbyistes des laboratoires et des toubibs médiatiques comme Karine Lacombe, récemment promue pour recevoir la Légion d’honneur en récompense de … Et bien, bonne question, on ne sait pas. Certainement pour son nombre d’interviews record. Elle va bientôt figurer en pôle position dans le Guinness. Pendant ce temps-là, d’autres docteurs et infirmières travaillant en milieu hospitalier nuits et jours ne bénéficieront pas de la même reconnaissance officielle. Pour ces derniers le pouvoir réserve matraques, gazages, arrestations et amendes s’ils viennent à protester contre sa politique de liquidation du système de santé publique.

Quant aux artistes engagés pour la vaccination, on retrouve entre autre Berléand2 qui avait dévoilé son mépris pour le peuple et les Gilets Jaunes, et le décevant Grand Corps Malade. En effet, avec sa chanson « Pas essentiel », on s’attendait à plus de réflexion3. Ce qui est dommage c’est que tout ce beau monde est fermement persuadé que, grâce à cette vaccination, la vie va reprendre comme avant. Retour à la normale, jouée en partition uniquement pour pipeau et violon ! 

Cette légion d’honneur, distribuée à tout-va comme des confettis à des enfants, ne signifie plus grand chose à part récompenser certains malfaisants. Jacques Servier, feu le grand patron des laboratoires du même nom, s’était vu remettre la décoration prestigieuse en plein scandale du Médiator. Rappelons que pendant trente ans, de 1976 à 2009, ce produit dangereux à été prescrit à plus de 5 millions de patients. Jugement final en 2021. Un record de « rapidité » dû à l’état de délabrement avancé du système judiciaire français que mettent en évidence depuis plusieurs années les enquêtes de la Commission européenne pour l’efficacité de la justice (CEPEJ). Entre 220 et 300 décès à court terme et entre 1300 et 1800 à long terme4.  Ce qui n’a pas empêché Nicolas Sarkozy, alors chef de l’Etat à l’époque, de remettre à Servier, le 7 juillet 2009, la plaque et le cordon de grand-croix – la plus haute distinction – de la Légion d’honneur5, alors que la célèbre pneumologue Irène Frachon, dans son livre – Médiator 150 mg, combien de morts ? – publié deux ans plus tôt dénonçait les méfaits du médicament « miracle ». 

Mais revenons à ce vaccin miraculeux fabriqué en moins d’un an. Les chercheurs ont bossé nuit et jour. Quand il y a des bénéfices à faire, pas d’hésitation…

Effets indésirables graves : la question est loin d’être résolue

Le professeur Raoult que l’on ne présente pas déclare le 8 janvier 2021 que ce vaccin n’est pas la baguette magique qui va arrêter l’épidémie. Extrait de l’article « … Je pense que la plupart d’entre eux (les vaccins) ne présentent pas de risques à court terme. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : il ne s’est pas passé de choses extraordinaires. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : Je ne le crois pas non plus. »6.

Côté Pfizer, le vaccin Covid-19 assurerait une efficacité globale de 80,2 % après la première injection, atteignant 94,1 % 14 jours après la seconde injection7.  

Côté Vidal, la bible des médecins, au 10 décembre 2020, dans son article  « Vaccin Pfizer/Biontech contre la Covid-19 : Enfin des données à analyser ! » : « un taux de protection de 52,4 % dès la première injection » mais surtout : « Les questions relatives à l’efficacité qui demeurent en suspens », « Des effets indésirables post-injection plus sévères chez les moins de 56 ans », « Les questions relatives à la toxicité qui demeurent en suspens »… Puis plus loin : « La possibilité d’effets indésirables graves, rares ou décalés dans le temps »8 ; « La toxicité chez les moins de 16 ans, les femmes enceintes et allaitantes et les personnes immunodéprimées ». Le Vidal souligne en conclusion : « la question d’une éventuelle toxicité à long terme se pose toujours, ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » En  cas d’effets indésirables graves possibles, qui ne semblent  nullement gêner ceux qui vaccinent avec ces vaccins inachevés, rendez-vous à l’hôpital s’il reste des lits hospitaliers ou au…cimetière. 

Le prix de l’incompétence

Comment ignorer que le développement et la mise au point d’un vaccin prend en moyenne une dizaine d’années en respectant le principe de précaution qui permet de s’assurer qu’il soit sans danger pour l’homme avant sa mise sur le marché ?

« Des prototypes de candidats-vaccins sont mis au point en laboratoire à partir de germes, puis on lance la production pharmaceutique et on réalise les premiers tests sur des animaux. Il faut ensuite obtenir des autorisations réglementaires pour mener des essais cliniques, plus vastes sur l’Homme. »9

Admettons quand même que ce vaccin soit efficace à 94,1 %. Si tel était le cas, et s’il protégeait réellement les vaccinés, pourquoi obliger ceux qui n’ont pas envie d’être vacciné à l’être ? Pourquoi vouloir établir un « passeport de santé/vaccination » qui serait exigible avant de prendre un avion, de monter dans un train, ou d’aller au spectacle ? La vérité semble ailleurs…

Nos braves artistes partant en guerre pour que tout le monde se fasse vacciner, feraient bien de revoir leurs copies. Car, s’ils s’imaginent que les salles de spectacles, les théâtres, les cinémas, et les restaurants (pour manger un petit bout en fin de soirée), vont réouvrir très vite, ils se fourrent le doigt dans l’oeil jusqu’au coude. 

Comment voulez-vous que le Conseil scientifique donne son feu vert à la liberté, vu que Jean-François Delfraissy, le  président du Conseil scientifique du pouvoir, a déclaré le 18 décembre 2020 que 2021 ressemblera à 2020.10. Tout comme il avait déjà déclaré en 2009 qu’il allait falloir vacciner deux fois les Français contre le virus de la grippe H1N1, alors présentée comme une terrible pandémie. Terrible au point qu’elle disparut en une année presqu’aussi vite qu’elle avait surgit … Coût pour l’Etat de ces prévisions aussi alarmistes qu’infondées et fumeuses : plus de 500 millions d’euros pour la seule opération vaccin dont des millions de doses seront annulées après dédommagements financiers de ses producteurs et 15 millions d’autres détruites ! Banco. 

Comme le reconnut lui-même le professeur Delfraissy une fois que l’orage fût passé, il « n’était pas un spécialiste des virus de la grippe », pas plus qu’il ne l’est d’ailleurs aujourd’hui de ce coronavirus. Voilà qui « rassure » et laisse déjà entrevoir que la nouvelle ardoise laissée par ce régime et ses conseillers – des milliards d’euros avec un nouveau surendettement du pays – pourrait bien tomber plus vite que prévu comme des tuiles sur la place publique.  

Un vaccin est normalement sensé vous immuniser contre une maladie. Si vous êtes vacciné contre le tétanos, vous êtes protégé à 100 %. Extrait du Vidal : « La vaccination contre le tétanos est efficace à 100 % et cette maladie a quasiment disparu dans les pays, dont la France, où une politique vaccinale complète est appliquée et réalisée. De 2005 à 2017, 112 cas de tétanos ont été déclarés en France – sois moins de 10 par an. » Si le vaccin contre la Covid-19 ne peut être efficace à 100% en 2021, aucun de ses fabricants ne peut garantir sa sûreté. Ceux-ci ne s’étendent pas sur ses possibles effets secondaires. Comme on les comprend. 

Si le vaccin vous rend malades, on y est pour rien…

Une réunion du comité consultatif de la Food and Drug Administration (FDA) des États-Unis intitulée Vaccins et produits biologiques connexes qui s’est tenue le 22 octobre 2020 n’a-t-elle pas listé 22 conséquences négatives possibles, y compris la mort, avec ces vaccins alors en cours d’élaboration ?11 Cette liste, projet de travail sur les événements indésirables très graves pouvant survenir, n’incluait pas tous les effets négatifs mineurs et non étudiés sur la santé qui résulteront de ces injections pour une raison simple : ceux-ci ne peuvent apparaître qu’au bout de plusieurs années.

Voilà qui explique pourquoi les dirigeants de ces transnationales de la pharmacie ont été jusqu’à solliciter très fortement la Commission « européenne » afin qu’elle les décharge de leurs responsabilités sur les effets secondaires. Extrait de l’article LCI du 22 septembre 2020 : «  Le 27 août, la Commission européenne a confirmé être en discussion avec les laboratoires » sur ce sujet. Ces clauses sont ainsi en discussion afin de « compenser les risques élevés pris par les laboratoires ». Risques élevés ? Risques de pertes de profits faramineux par la vente de vaccins qui ne peuvent qu’être inachevés dans leur conception au moment de leur mise sur le marché ? Non, risques financier pour des effets secondaires liés à « une éventuelle toxicité à long terme (qui) se pose toujours » en début d’année 2021 « ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » Et c’est justement pourquoi « les contrats d’achat anticipé prévoient que les états membres de l’UE indemnisent les fabricants pour les responsabilités encourues dans certaines conditions. »12 

Cerise sur le gâteau, ces vaccins ne garantiraient qu’une immunité de quelques mois, variable selon les fabricants. Ensuite rebelote pour une injection et jackpot pour Pfizer, Moderna et les autres. 

On imagine mal que des producteurs de vaccins assurés de l’efficacité et de la sûreté de leurs produits aillent quémander l’aide d’un Etat qu’ils ne cessent de stipendier au nom de la « libéralisation des entreprises » et auquel ils reprochent un prétendu « interventionnisme » pour qu’il prenne à sa charge les déboires qui pourraient survenir après l’injection de leur « vaccin révolutionnaire » 

Aussi, nul besoin d’être un grand devin pour deviner que le délire confinatoire avec port du masque et couvre feu va continuer alors que le mardi 12 mars 2020, l’inénarable Directeur général de la Santé, Jérôme Salomon, déclarait que « 98% des gens guérissent » de la Covid-19. Et attention, en matière de coronavirus le haut fonctionnaire Jérôme sait de quoi il parle : c’est lui qui annonça le 3 février 2020 qu’ « il n’y a pas d’épidémie en France, même pas de chaîne de transmission dans notre pays et aucune circulation du virus sur le territoire. » Le jour même la France comptait ses six premiers cas confirmés porteurs du virus SRAS-CoV-2, 57 le 29 du même mois et 191 avec le premier décès le 3 mars !

Notre enquête

 Se soigner ? Du repos chez soi, et pour aider, du zinc, de la vitamine D, de la vitamine C, de l’aspirine ou du Doliprane13, 14. Mais alors que devient l’Hydroxychloroquine, interdite par la « sinistre » de la Santé Buzyn aux médecins généralistes bien que ceux-ci parviennent à soigner des malades à l’hôpital s’ils sont traités dès les premiers symptômes ? 

Difficile de s’y retrouver dans les affirmations les plus contradictoires qui agitent la communauté scientifique auxquelles s’ajoutent les fausses  nouvelles diffusées par le Premier ministre et certaines administrations. Rien d’étonnant pourtant puisque ce coronavirus est nouveau pour les chercheurs, du moins pour ceux qui ne travaillent pas à la mise au point d’armes biologiques offensives dans l’un de ces laboratoires de l’armée des Etats-Unis échappant à tout contrôle international. Mais ceci est une autre histoire, celle de guerres biologiques et chimiques qui ne commencent ni en République populaire de Chine, ni en France mais au cœur de la Maison Blanche…

Nous sommes journalistes et non scientifiques et notre rôle est de rapporter avec rigueur à la population les informations et les idées qui circulent dans la société. Nous n’avons pas la prétention d’affirmer ce qu’il faut faire ou ne pas faire au plan médical ainsi que s’y ridiculisent des éditocrates parisiens et autres médecins imaginaires autoproclamés qui se répandent dans des médias dont les transnationales de Big Pharma sont l’un des principaux annonceurs. Par contre nous avons la détermination inébranlable de dénoncer les fausses informations, d’où qu’elles viennent, en nous appuyant sur des sources fiables – Insee, CNRS, Inserm, etc. -, en vérifiant et croisant leurs données et en analysant les faits avec le nécessaire recul. 

La pratique rigoureuse de l’enquête journalistique implique de suivre la « règle des trois principes » : bannir toute idée reçue, ne faire confiance à personne, vérifier les informations par recoupements. C’est pourquoi nous pouvons affirmer que ce gouvernement ment à l’opinion publique lorsqu’il prend prétexte d’une prétendue virulence du virus pour imposer de nouvelles mesures qui détruisent le contrat social français. Parvenu à ce stade de mensonge d’Etat, ce gouvernement n’a plus d’autre choix que d’entretenir la peur pour endiguer la révolte qui menace et permettre aux sociétés transnationales de la pharmacie d’écouler leurs millions de doses de vaccins autant inutiles qu’inachevés. 

Vous doutez ?

Fausses informations gouvernementales

Un nouvel exemple de l’esbroufe gouvernementale appert en début d’année 2021 : le nombre de personnes contaminées par la Covid-19 annoncé en décembre 2020 par le gouvernement, son ministre de la santé et son administration, et relayé par la plupart des médias, est de 1068 cas confirmés par semaine par million d’habitants. Cette statistique est diffusée par la plateforme ouverte des données publiques françaises (www.data.gouv.fr, https://LaFibre.info/Covid19, Comparatif du nombre de cas Covid-19 par semaine entre pays rapporté par million d’habitants, mise à jour du 06 décembre 2020 à 17h.)

Or, si l’on examine de près les chiffres du réseau Sentinelles de l’Institut national de la santé et de la recherche médicale (Inserm) composé de 1200 cabinets médicaux sur tout le territoire, ce rapport s’avère bien différent : 14 cas pour 100 000 personnes soit environ 140 cas pour un million d’habitants. Huit fois moins ! Rappelons que le taux de Sentinelles correspond aux vrais malades symptomatiques rencontrés dans les cabinets médicaux et testés. Ainsi que l’indique le réseau Sentinelles dans son bulletin sur la situation observée pour la semaine 53 – du 28 décembre 2020 au 03 janvier 2021-, « à partir des données cliniques et virologiques concernant les cas d’IRA (NdA : Infections respiratoires aiguës) vus en consultation de médecine générale, il est possible d’estimer la part de ces cas dus au COVID-19. » En semaine 53 à cheval entre décembre 2020 et janvier 2021, « aucun prélèvement n’a été testé positif au SARS-CoV-2 (COVID-19) parmi les prélèvements analysés. Ceci permet d’estimer que le taux d’incidence des cas d’IRA dus au SARS-CoV-2 (COVID-19) vus en médecine générale serait inférieur à 14 cas pour 100 000 habitants, représentant moins de 9 097 nouveaux cas de COVID-19 ayant consulté un médecin généraliste. » Précision de l’Inserm : « Cette estimation est stable par rapport aux semaines précédentes. » Quel média vous a rapporté ces faits et cette « stabilité par rapport aux semaines précédentes » ?… Le seuil épidémique étant de 150 à 200 cas pour 100 000 personnes, il est permis d’affirmer que le virus est en voie de disparition. 

Aussi, la troisième vague, le reconfinement, le couvre-feu et autres mesures annoncées par le gouvernement à grand renfort de médias semblent n’avoir qu’une raison d’être : entretenir la peur pour écouler le stock de millions de doses de vaccins ! Olivier Veran, ministre des Solidarités et de la Santé, ne tient visiblement pas à jouer « Bachelot 2 le retour » sur les traces de la « sinistre » de la Santé du gouvernement Fillon. Rappelez-vous : en 2010 celle-ci, suivant à la lettre les conseils du même Jean-François Delfraissy et de son équipe pour contrer la grippe H1N1, s’était retrouvée avec des dizaines de millions de doses de vaccins inutiles…

Les « profiteurs pandémiques »

Ceux qui depuis le début de l’année 2020 n’arrêtent pas de diffuser des annonces gouvernementales et d’administrations sans les vérifier puisqu’émises par des sources officielles  – donc a priori crédibles – se retrouvent, devant les arguments que nous présentons aux lecteurs, seuls et démunis avec le sentiment d’avoir été trompés par le pouvoir et ses représentants pour les plus honnêtes et professionnels d’entre eux. Si, si, il en existe encore… Si des erreurs peuvent survenir dans la création et la diffusion d’informations, celles-ci répétées dans le temps sur un même sujet façonnent ce qui s’appelle un mensonge d’Etat.

Ceux qui en font les frais ? 

Les professionnels de la santé et, d’une manière générale, les salariés des entreprises, les transporteurs, commerçants, artisans, hôteliers-restaurateurs, patrons de boîtes nuits, autocaristes, TPE et PME-PMI, les professions du spectacle et de l’événementiel, les salles de sports…Bref, tous les entrepreneurs et indépendants, qui grâce à leur travail et à leur dur labeur font vivre leurs familles et donnent de la convivialité à notre nation sont en train de disparaître.

En revanche, comme nous le montrons dans Le virus et le président, les « profiteurs pandémiques » se portent plutôt très bien. Parmi eux, les sociétés transnationales du CAC 40 – dont celles de la pharmacie – qui, tout en réalisant les plus importants chiffres d’affaires reçoivent, bon an mal an, plus de 200 milliards d’euros de subventions publiques et d’exonérations fiscales de l’Etat et de l’Union dite « européenne » et continuent de coter à la hausse en Bourse tout en tuant des milliers et des milliers d’emplois en France. C’est un peu aussi pourquoi nous disons que lorsque le président Macron qui a consacré son temps, depuis qu’il s’est assis en 2012 près de l’ancien président François Hollande, a privatiser l’économie, créer du chômage, réduire encore le système de santé publique, endetter le pays, déclare vouloir « reconstruire une économie forte et souveraine » c’est un peu comme si une dinde fêtait Noël.

Le livre qui dérange

Le virus et le président n’oublie pas ces fauteurs de crise tant sanitaire qu’économique et financière. Vous y lirez comment les privilégiés du système se gavent des richesses de notre beau pays avec le concours de parlementaires qui, pour la plupart, ne sont plus que des sortes de greffiers de la Commission « européenne » qui confinent le budget de la Santé publique dans l’une des dernières places du budget de l’Etat. Pendant que la France du travail et de la création perd sa santé jusqu’à l’agonie sur l’une des toutes premières marches du podium du taux de suicide d’Europe occidentale, des profiteurs sans scrupules la pillent en flux tendu 24 heures sur 24. La fable du « vaccin miracle » inachevé contre la Covid-19 ne raconte pas une autre histoire que celle des manigances de ces accapareurs à la recherche de profit maximum immédiat quelles qu’en soient les conséquences pour le peuple.

Ce vol noir de corbeaux sur le pays qu’ils enchaînent à coups d’ordonnances de l’Union « européenne » et de lois liberticides et anti-sociales est le tableau « idyllique » annoncé par Klaus Schwab, le fondateur de Davos et de son Forum Economique Mondial, ainsi qu’il l’explique dans son livre, Covid-19 : la grande réinitialisation. C’est écrit noir sur blanc et ce n’est pas complotiste. C’est une réalité qui est en train de s’étendre, comme une gangrène malfaisante à toute la planète15. Aussi, le temps de la perdition, de la désespérance et du silence est révolu. Place à la réflexion, au débat et à l’action ! 

Notre livre Le virus et le président, (IS Edition, www.is-edition.com), qui vient de sortir souhaite y contribuer, peut vous éclairer, vous permettre de comprendre comment et pourquoi le pouvoir vous trompe, favoriser le débat, inciter à rechercher et à écrire les propositions qui permettront de changer de cap. Enquêtes minutieuses, faits, chiffres, zestes d’humour16… 

Le vaccin inachevé ? Comme pour ses promoteurs et propagandistes, au vu de ce qui précède, vous aurez deviné notre position. 

Jean-Loup Izambert et Claude Janvier

Notes :

1.https://www.msn.com/fr-fr/actualite/france/appel-de-200-artistes-pour-la-vaccination-c-est-le-seul-moyen-de-sortir-de-ce-bordel/ar-BB1cyLhj?ocid=msedgdhp et https://www.leparisien.fr/culture-loisirs/covid-19-l-appel-de-200-personnalites-de-la-culture-qui-veulent-se-faire-vacciner-06-01-2021-8417619.php

2.https://www.lefigaro.fr/cinema/ils-me-font-ch-francois-berleand-s-explique-devant-des-gilets-jaunes-20191209

3.https://www.youtube.com/watch?v=NencPkx7qgY

4.https://www.lepoint.fr/justice/proces-mediator-dernier-round-07-07-2020-2383304_2386.

5.https://www.nouvelobs.com/societe/20111010.OBS2124/nicolas-sarkozy-et-la-legion-d-honneur-le-revers-de-la-medaille.html

6.https://www.lindependant.fr/2021/01/08/covid-19-pour-didier-raoult-le-vaccin-nest-pas-la-baguette-magique-qui-va-arreter-lepidemie-9299989.php

7.https://www.vidal.fr/actualites/26337-vaccin-pfizer-biontech-contre-la-covid-19-enfin-des-donnees-a-analyser.html

8.https://www.vidal.fr/actualites/26105-vaccins-contre-la-covid-19-doit-on-s-inquieter-du-risque-de-maladie-aggravee-chez-les-personnes-vaccinees.html

9.https://www.santemagazine.fr/traitement/medicaments/vaccins/vaccins-contre-le-coronavirus-quelles-differences-pour-qui-quand-873097

10.https://www.ouest-france.fr/sante/virus/coronavirus/covid-19-jean-francois-delfraissy-2021-ressemblera-a-2020-7091792 

11.FDA U.S., Food & Drug Administration, Steve Anderson, VRBPAC, meeting October 22, 2020. Vaccines and Related Biological Products Advisory Committee (VRBPAC), October 22, 2020. Meeting Announcement. La FDA révèle une longue liste de problèmes de santé graves pouvant résulter de la vaccination contre le covid-19, y compris la mort, par Lance D.Jolmage, Natural News, mercredi 09 décembre 2020.

12.https://www.lci.fr/sante/vaccins-contre-le-covid-19-les-laboratoires-seront-ils-vraiment-decharges-de-toute-responsabilite-en-cas-d-effets-secondaires-2165265.html

13.https://france3-regions.francetvinfo.fr/occitanie/haute-garonne/toulouse/collectif-medecins-preconise-utilisation-vitamine-du-zinc-prevenir-formes-graves-covid-1908356.html

14.https://www.bfmtv.com/sante/en-combien-de-temps-guerit-on-du-coronavirus_AN-202003120174.html

15.https://blogs.mediapart.fr/semcheddine/blog/011220/covid-19-grande-reinitialisation-ou-insurrection-des-consciences et  https://lecourrierdesstrateges.fr/2020/12/29/le-great-reset-annonce-t-il-la-fin-du-travail-independant/

16.https://www.is-edition.com/actualites/parution-le-virus-et-le-president-jean-loup-izambert-claude-janvier/

 

Lectures complémentaires sur notre page « Coronavirus, guerre contre l’humanité »

 

Un an… Ce que l’on sait du SRAS-CoV2 et de la « pandémie » COVID-19 associée : une mise à jour des données récentes (Denis Rancourt)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , on 12 janvier 2021 by Résistance 71

 

Une remarquable synthèse de Denis Rancourt sur ce qu’on sait aujourd’hui SCIENTIFIQUEMENT sur le SRAS-CoV-2 et la « pandémie » COVID-19 associée. A lire et diffuser au plus grand large et sans aucune modération.
Nous devons stopper cette imposture avant qu’elle ne nous enferme dans sa dictature technotronique eugéniste programmée.
~ Résistance 71 ~

 

 

Mise à jour des données récentes concernant la politique COVID-19

Les mesures de confinement n’empêchent pas les décès, la transmission ne se fait pas par contact, les masques n’apportent aucun bénéfice, les vaccins sont intrinsèquement dangereux.

 

Denis Rancourt

 

28 décembre 2020

 

Source Research Gate

 

url de l’article en français :
https://lesakerfrancophone.fr/mise-a-jour-des-donnees-scientifiques-recentes-concernant-la-politique-covid-19#fn-98503-18

Le texte en PDF :
Denis_Rancourt_Mise_a_jour_des_donnees_de_ce_quon_sait_sur_le_SRAS-CoV-2

Les mesures sans précédent de confinement universel, de confinement institutionnel strict des maisons de soins, de masquage universel de la population, d’obsession hygiénique des surfaces et des mains et de déploiement accéléré des vaccins sont contraires à la science connue et aux récentes études de référence. Le gouvernement a fait preuve d’imprudence par action et de négligence par omission. Des mesures institutionnelles sont nécessaires depuis longtemps pour endiguer la corruption dans le domaine de la médecine et de la politique de santé publique.

Introduction – Pandémie iatrogène de panique

Le contexte politico-sanitaire est un contexte dans lequel, jusqu’en 2019, le consensus scientifique et politique passé en revue était que les mesures globales généralement et universellement appliquées en 2020 étaient 1 2 :

  • non recommandées sans être justifiées par des preuves quantitatives suffisantes des circonstances épidémiologiques locales (juridictionnelles) (transmissibilité, gravité de la maladie, impact), et sans être mises en balance avec les préjudices économiques, sanitaires et sociaux locaux qui en résultent
  • pour de nombreuses mesures (recherche des contacts, mise en quarantaine des personnes exposées, contrôle des entrées et des sorties, fermeture des frontières), « non recommandé en aucune circonstance », quelle que soit la gravité de la maladie respiratoire virale pandémique (modérée, élevée ou extraordinaire)

Le contexte politico-sanitaire est également un contexte dans lequel il existe une histoire récente documentée de « paniques répétées de pandémie de santé » dans laquelle « les experts en maladies souhaitent attirer l’attention du public et faire pencher les décisions d’allocation de ressources en faveur de la maladie qui les intéresse ». 3. Bonneux et Van Damme, en 2011, l’ont exprimé ainsi 4 :

“Les paniques répétées de pandémie de santé causées par un virus aviaire H5N1 et un nouveau virus de grippe humaine A(H1N1) font partie de la culture de la peur [réf.] Le pire des scénarios a remplacé l’évaluation équilibrée des risques. Le pire des scénarios est motivé par la conviction que le danger auquel nous sommes confrontés est tellement catastrophique que nous devons agir immédiatement. Plutôt que d’attendre des informations, nous avons besoin d’une frappe préventive. Mais si les ressources achètent des vies, le gaspillage des ressources gaspille des vies. Le stockage préventif d’antiviraux largement inutiles et les politiques irrationnelles de vaccination contre un virus H1N1 exceptionnellement bénin ont gaspillé plusieurs milliards d’euros et érodé la confiance du public dans les responsables de la santé. [réf.] La politique de lutte contre la pandémie n’a jamais été guidée par des preuves, mais par la crainte des pires scénarios.”

En outre, un important scandale de conflit d’intérêts concernant les recommandations de l’OMS en matière de pandémie de grippe a été exposé en détail en 2010, où les enquêteurs Cohen et Carter ont conclu : « Parmi les principaux scientifiques qui conseillent l’Organisation mondiale de la santé sur la planification d’une pandémie de grippe, certains ont fait un travail rémunéré pour les entreprises pharmaceutiques qui ont tout à gagner des conseils qu’ils ont rédigés. Ces conflits d’intérêts n’ont jamais été rendus publics par l’OMS ». 5

En 2020, rien de tout cela n’avait d’importance. Nous sommes entrés dans un monde de propagande, avec des institutions captives. Le principe de précaution (le gouvernement doit prouver l’absence probable de dommages avant d’imposer des politiques dangereuses) a été renversé, et la charge de la preuve a été imposée à la science pour justifier a posteriori des mesures sans précédent, rapidement imposées en l’absence de science ou même en s’opposant à elle. Malheureusement, une grande partie ou la plupart de l’establishment scientifique s’est conformé au nouveau programme.

Récemment, il y a eu à la fois des événements dramatiques (lancement du vaccin) et des communications scientifiques importantes, depuis que j’ai publié mes deux premiers articles scientifiques concernant la politique autour de la COVID-19, le 11 avril 2020 6 et le 3 août 2020 7, ainsi que des articles sur les préjudices mortels des réponses gouvernementales, déduits des données sur la mortalité toutes causes confondues, dépendantes du temps et de la juridiction 8 9.

Mes deux premières analyses ont porté sur la science et la politique des masques 10 11. La présente mise à jour des développements récents porte à nouveau sur les masques, et comprend en outre des points clés sur les mesures de confinement et les vaccins.

La rigueur des mesures n’a aucun effet sur le nombre total de décès attribués à la COVID-19

Deux grandes études récentes ont été menées à l’échelle mondiale.

Dans leur article du 21 juillet 2020 intitulé « Une analyse au niveau national mesurant l’impact des actions gouvernementales, de l’état de préparation du pays et des facteurs socio-économiques sur la mortalité de la COVID-19 et les résultats sanitaires associés » (50 pays), Chaudhry et al. ont indiqué 12 :

“La fermeture rapide des frontières, le confinement total et les tests à grande échelle n’ont pas été associés à la mortalité de la COVID-19 par million de personnes. (Résumé / Résultats)

Lorsque la mortalité de la COVID-19 a été évaluée, les variables significativement associées à une augmentation du taux de mortalité par million étaient la prévalence de l’obésité dans la population et le PIB par habitant. En revanche, les variables qui étaient négativement associées à une augmentation de la mortalité de la COVID-19 étaient la réduction de la dispersion des revenus au sein de la nation, la prévalence du tabagisme et le nombre d’infirmières par million d’habitants. En effet, un plus grand nombre d’infirmières dans un système de soins de santé donné était associé à une réduction de la mortalité. Les taux de mortalité étaient également plus élevés dans les comtés dont la population était plus âgée […]. Enfin, les mesures gouvernementales telles que la fermeture des frontières, le confinement total et un taux élevé de tests COVID-19 n’ont pas été associées à des réductions statistiquement significatives du nombre de cas critiques ou de la mortalité globale. (Section 3.4)”

Dans leur article du 19 novembre 2020 « Mortalité du fait de la COVID-19 : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées » (160 pays), De Larochelambert et al. ont trouvé 13 :

“Résultats : Des taux de mortalité plus élevés sont observés dans les zones de latitude [25/65°] et de longitude [-35/-125°]. Les critères nationaux les plus associés au taux de mortalité sont l’espérance de vie et son ralentissement, le contexte de santé publique (fardeau des maladies métaboliques et non transmissibles (MNT) par rapport à la prévalence des maladies infectieuses), l’économie (produit national de croissance, soutien financier) et l’environnement (température, indice ultra-violet). La rigueur des mesures mises en place pour lutter contre la pandémie, y compris le confinement, ne semble pas être liée au taux de mortalité.

Conclusion : Les pays qui ont déjà connu une stagnation ou une régression de l’espérance de vie, avec des revenus et des taux de mortalité élevés, ont eu le plus lourd tribut à payer. Ce fardeau n’a pas été allégé par des décisions publiques plus strictes. Des facteurs inhérents ont prédéterminé la mortalité de la Covid-19 : leur compréhension peut améliorer les stratégies de prévention en augmentant la résilience de la population grâce à une meilleure condition physique et une meilleure immunité. (Résumé)”

L’American Institute for Economic Research (AIER Staff) a passé en revue ces études et 22 autres études qui aboutissent à des conclusions similaires, dans son rapport du 19 décembre 2020 intitulé « Les confinements ne contrôlent pas le coronavirus : Les preuves » 14.

Par conséquent, dans l’ensemble, le nombre total de cas critiques et le nombre total de décès étaient associés à l’état de santé préexistant et à l’état sociétal de la population, et cela n’a pas été amélioré par les mesures gouvernementales visant à ralentir la transmission.

Il est important de noter qu’en plus des études sur les associations avec la mortalité totale, la dépendance temporelle et la granularité (dépendance juridictionnelle) de la mortalité toutes causes confondues montrent que la déclaration de pandémie de l’OMS du 11 mars 2020 et la recommandation universelle de « préparer vos hôpitaux » ont été suivies d’un grand nombre de décès, probablement induits par les infections et le confinement strict des maisons de soins non ventilées pour les personnes malades et âgées 15 16.

La pandémie iatrogène de propagande en terme de psychologie de masse et la sociologie autour de la COVID-19 de 2020 commencent à être étudiées par des méthodes quantitatives 17.

La corruption de la science est mise à nue – Masques et PCR

Un aspect positif de ce que l’on peut appeler la « pandémie de propagande » actuelle est que la corruption systémique généralisée de l’establishment scientifique est exposée, non seulement par des rétractations très médiatisées d’articles publiés dans des revues de premier plan, mais aussi par des éditoriaux critiques. Par exemple, le 13 novembre 2020, le rédacteur exécutif Kamran Abbasi l’a exprimé en termes très clairs dans les pages de l’éminent BMJ 18 :

“La science est supprimée pour des raisons politiques et financières. La Covid-19 a déclenché une corruption de l’État à grande échelle, et elle est nuisible à la santé publique. [réf] Les politiciens et l’industrie sont responsables de ce détournement opportuniste. Les scientifiques et les experts de la santé le sont également. La pandémie a révélé comment le complexe politico-médical peut être manipulé en cas d’urgence, à un moment où il est encore plus important de sauvegarder la science.”

J’en donne trois exemples.

Premièrement, le biais systémique est palpable dans une mini-saga récente sur les masques, publiée dans les pages du New England Journal of Medicine 19 20 21.

Gandhi et Rutherford ont écrit un article intitulé « Perspective », publié le 29 octobre 2020 22. Les auteurs avancent l’idée extraordinaire que se masquer réduit la gravité de la maladie chez les personnes infectées. Ils commencent par l’affirmation propagandiste selon laquelle le masquage facial universel est « l’un des piliers de la lutte contre la pandémie de Covid-19 ». Ils poursuivent en avançant l’argument fantastique suivant : les masques peuvent réduire l’inoculum viral et donc provoquer des infections asymptomatiques dans lesquelles le sujet développe une immunité. Cela a alarmé les répondants car le mécanisme proposé est ce que l’on pourrait appeler « l’immunité acquise naturellement grâce aux masques ». Admettre tout type d’immunité naturelle, qui est une dure réalité de la biologie de l’évolution, est devenu sacrilège.

Deux groupes de chercheurs ont publié des réfutations contre Gandhi et Rutherford, dans la même revue.

Rasmussen et al. ont écrit 23 :

“Il n’y a pas suffisamment de preuves pour soutenir l’affirmation selon laquelle les masques réduisent la dose infectieuse du SRAS-CoV-2 et la gravité de la Covid-19, et encore moins que leur utilisation peut induire une immunité protectrice. […] La suggestion que les masques offrent une alternative à la vaccination sans preuve que les bénéfices l’emportent sur les grands risques encourage implicitement les comportements irresponsables.”

Brosseau et al. ont, pour leur part, réajusté diplomatiquement les vues exposées par Gandhi et Rutherford en ramenant les lecteurs à la science et à la réalité établies 24 :

“La réplication virale est liée à la dose, mais la gravité de la maladie ne l’est pas. L’épidémiologie indique que l’apparition de formes graves de Covid-19 est associée à des conditions préexistantes et à d’autres facteurs de risque, tels que l’âge, le sexe et la grossesse [réf].

Bien qu’elle n’ait pas encore été démontrée dans des modèles expérimentaux, la dose infectieuse du SRAS-CoV-2 est probablement similaire à celle du SRAS-CoV – environ 300 virions [réf]. Quelle que soit la gravité de la maladie, les gens présentent des charges virales élevées et un virus infectieux pendant au moins 8 jours après l’apparition des symptômes. La parole normale peut générer jusqu’à 3000 particules de 1 micron par minute dans l’air expiré, [ref] et chaque particule pourrait contenir plus de 250 virions, ce qui signifie qu’une seule minute de parole génère potentiellement plus de 750 000 virions. Les revêtements de visage en tissu ont une efficacité très variable en fonction de la capacité de filtrage et de l’ajustement. Le port d’un couvre-visage en tissu à proximité d’une personne infectée pendant plusieurs minutes peut ne pas empêcher la réception d’une dose infectieuse, qui, comme indiqué ci-dessus, n’est pas corrélée à une maladie moins grave.”

Les auteurs de l’article original n’ont pas été dissuadés et ont répondu :

« Plus de preuves s’accumulent pour supporter cette idée » et « il y a de plus en plus de preuves à la fois physiques et d’enquêtes épidémiologiques que les masques en tissu (s’ils sont portés correctement) réduisent à la fois la transmission et l’acquisition » 25 L’examen de leurs sources montre que les auteurs ont une vision généreuse de ce qui peut constituer une « preuve » à l’appui. Voir également 26, concernant la tournure que prend l’« accumulation de preuves » dans le contexte politique des masques faciaux.

Deuxièmement, un exemple étonnant, toujours à propos des masques, est fourni dans les pages de Nature Medicine. Ici, l’équipe de prévision de la COVID-19 de l’IHME, le 23 octobre 2020 (« étude de l’IHME »), a déclaré que le port universel de masque serait d’une grande utilité aux États-Unis 27 :

“L’utilisation du port universel de masque pourrait sauver 129 574 (entre 85 284 – 170 867) vies supplémentaires entre le 22 septembre 2020 et la fin février 2021, ou 95 814 (entre 60 731 – 133 077) vies supplémentaires en supposant une adoption moindre du port du masque (85%), par rapport au scénario de référence. (Résumé)”

Si les masques offrent un avantage aussi important, il est impossible de comprendre comment aucun des nombreux grands essais contrôlés randomisés (ECR) dont les résultats sont vérifiés, n’a détecté cet avantage. Il est impossible d’obtenir les résultats négatifs souvent répétés dans les études ECR de qualité suffisante pour informer la politique sanitaire, si les prémisses et les conclusions de l’étude IHME sont correctes. L’étude de l’IHME a été réfutée avant même sa publication.

L’étude de l’IHME est fatalement défectueuse sur au moins deux points :

  1. La méta-régression utilisée pour estimer (« suggérer », selon leurs termes) que le port universel du masque permet une réduction de 40% et plus de la transmission est sans valeur, et est le fruit d’un biais constructif ;
  2. Ils ont utilisé des données incorrectes pour évaluer la conformité du masquage de la population américaine pour la période concernée.

Cette dernière faille fatale a été exposée par Magness, dans son rapport publié dans le Wall Street Journal, intitulé « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées » 28 :

“Malheureusement, les conclusions des modélisateurs de l’IHME contenaient une erreur que même un examen minimal aurait dû permettre de détecter. Le nombre prévu de vies sauvées et le cas implicite d’une obligation de port de masques sont basés sur une statistique erronée. En utilisant une enquête datant de plusieurs mois, les modélisateurs de l’IHME ont supposé à tort que le taux d’adoption de masques aux États-Unis ne s’élevait qu’à 49% à la fin du mois de septembre, et qu’il y avait donc une grande marge de manœuvre pour passer à une « adoption universelle », définie comme 95%, ou à un taux plus plausible de 85%. Cependant, selon les résultats d’une enquête plus récente, le taux d’adoption de masques aux États-Unis tourne autour de 80 % depuis l’été.”

Magness ne fait aucune mention de la prémisse fictive de l’étude de l’IHME selon laquelle le port universel de masques réduit la transmission de 40 % et plus.

Troisièmement, dans l’un des plus grands scandales de l’épisode COVID-19, un test d’amplification en chaîne par polymérase par transcription inverse (RT-PCR) a été mis au point à la hâte, dans des circonstances douteuses, qui n’est ni un diagnostic de la présence de virus infectieux, ni spécifique du SRAS-CoV-2, et déployé par les États pour la confirmation de l’infection chez les individus symptomatiques, et pour les tests de masse de la population générale asymptomatique.

Le dit test RT-PCR a été présenté ainsi par Corman et al. 29, et leur propre article indique :

“Nous avions pour objectif de développer et de déployer une méthodologie de diagnostic robuste à utiliser dans les laboratoires de santé publique sans disposer de matériel viral. […]

Dans toutes ces situations [toutes les applications passées de la RT-PCR pour « détecter les virus responsables des sécrétions respiratoires »], les isolats de virus étaient disponibles comme substrat principal pour établir et contrôler les tests et les performances des tests.

Dans le cas présent du 2019-nCoV, les isolats de virus ou les échantillons provenant de patients infectés ne sont pas encore disponibles pour la communauté internationale de la santé publique. Nous faisons ici rapport sur l’établissement et la validation d’un flux de diagnostics pour le dépistage et la confirmation spécifique du 2019-nCoV, conçu en l’absence d’isolats de virus disponibles ou d’échantillons originaux de patients. La conception et la validation ont été rendues possibles par l’étroite parenté génétique avec le CoV-SARS de 2003, et facilitées par l’utilisation de la technologie des acides nucléiques synthétiques. […]

Le présent rapport décrit la mise en place d’un processus de diagnostic pour la détection d’un virus émergent en l’absence de sources physiques d’acide nucléique génomique viral. La rapidité et l’efficacité de l’effort actuel de déploiement et d’évaluation ont été rendues possibles par les réseaux de recherche nationaux et européens mis en place en réponse aux crises sanitaires internationales de ces dernières années, ce qui démontre l’énorme capacité de réaction qui peut être dégagée par l’action coordonnée des laboratoires universitaires et publics [réf]. Cette capacité des laboratoires ne soutient pas seulement les interventions immédiates de santé publique, mais permet aux sites d’enrôler des patients lors de réponses rapides de recherche clinique.”

Un consortium international de scientifiques des sciences de la vie estime que l’article de Corman et al. présente des lacunes technologiques et méthodologiques fatales : Voir le rapport de Borger et al qui concluent, parmi plusieurs critiques, que 30 :

Il s’agit là de graves erreurs de conception, puisque le test ne peut pas faire la distinction entre le virus entier et les fragments de virus. Le test ne peut pas être utilisé comme un diagnostic pour les virus du SRAS.

En outre, l’absence du gène HE dans le CoV-1 et le CoV-2 du SRAS fait de ce gène le témoin négatif idéal pour exclure d’autres coronavirus. Le document de Corman-Drosten ne contient pas ce contrôle négatif, ni aucun autre contrôle négatif. Le test PCR du papier Corman-Drosten ne contient donc ni témoin positif unique ni témoin négatif permettant d’exclure la présence d’autres coronavirus. Il s’agit là d’un autre défaut de conception majeur qui classe le test comme inadapté au diagnostic.

Nous constatons de graves conflits d’intérêts pour au moins quatre auteurs, outre le fait que deux des auteurs de l’article de Corman-Drosten (Christian Drosten et Chantal Reusken) sont membres du comité de rédaction d’Eurosurveillance. Un conflit d’intérêt a été ajouté le 29 juillet 2020 (Olfert Landt est PDG de TIB-Molbiol ; Marco Kaiser est chercheur senior au GenExpress et est conseiller scientifique de TIB-Molbiol), qui n’était pas déclaré dans la version originale (et qui manque toujours dans la version PubMed) ; TIB-Molbiol est la société qui a été « la première » à produire des kits PCR (Light Mix) basés sur le protocole publié dans le manuscrit de Corman-Drosten, et selon leurs propres termes, ils ont distribué ces kits de test PCR avant même que la publication ne soit soumise à relecture [réf] ; de plus, Victor Corman & Christian Drosten ont omis de mentionner leur deuxième affiliation : le laboratoire de test commercial « Labor Berlin ». Tous deux sont responsables du diagnostic des virus dans ce laboratoire [réf.] et la société opère dans le domaine des tests PCR en temps réel.

À la lumière de notre réexamen du protocole de test pour identifier le CoV-2 du SRAS décrit dans le document de Corman-Drosten, nous avons identifié des erreurs et des failles inhérentes qui rendent le test PCR du SRAS-CoV-2 inutile.”

Bon nombre des critiques de Borger et al ont déjà été prouvées par des vérifications détaillées en laboratoire, comme le remarquable article de Singanayagam et al 31, qui utilise la RT-PCR avec le gène cible RdRp, qui montre (en particulier leur figure 3 A) :

  • L’importance du nombre de cycles de PCR (Ct), à la fois dans le compte rendu clinique et dans l’interprétation clinique
  • Qu’à l’exception des cas d’hospitalisation extrême (qui n’ont pas été étudiés), tous les cas positifs détectés avec la RT-PCR plus de 10 jours après l’apparition des symptômes ou l’exposition correspondaient à des virus non infectieux (fragments de virus morts) (aucun virus n’a pu être cultivé dans des cultures cellulaires optimales)
  • Qu’aucun délai n’a été observé pour la détection de ces virus non infectieux (fragments de virus morts), car ceux-ci ont été obtenus, avec une Ct=28-39, jusqu’à 60 jours après l’apparition des symptômes ou l’exposition.
  • Qu’à moins de 10 jours, avec un Ct=18-40, près de la moitié des « positifs » étaient des virus non infectieux (fragments de virus morts)
  • Un seuil opérationnel de Ct=30, au-delà duquel les « positifs » ont moins de 40% de probabilité (<8% à Ct>35) de correspondre à un virus viable, indépendamment du temps relatif à l’apparition des symptômes ou à l’exposition (leur figure 2)

De tels résultats concernant la fausse détection de virus présumés viables ont également été obtenus dans la grande étude plus récente de Jaafar et al. 32 qui ont utilisé l’amplification par RT-PCR du gène E que l’on pense être un peu moins spécifique du SRAS-CoV-2.

Il est clair que le test RT-PCR utilisé dans le monde entier est en soi sans valeur. Il produit de grandes quantités de « positifs » qui ne correspondent à aucun virus infectieux viable, qu’il s’agisse du SRAS-CoV-2 ou d’un autre. On n’y remédie que partiellement si les laboratoires se limitent à des Ct<30, sans parler du grand potentiel d’autres mauvaises pratiques de laboratoire sur le terrain.

Ajoutez à cela la malhonnêteté de la santé publique qui consiste à fabriquer une nouvelle définition de ce qui constitue un « cas ». Un « cas » est défini en médecine comme une infection active, symptomatique et diagnostiquée. Ce n’est plus le cas. Tout cas « positif » dans le « test » RT-PCR défectueux est désormais considéré comme un « cas ». La campagne massive de tests RT-PCR de la population générale asymptomatique, qui n’a aucune utilité clinique ou épidémiologique, alimente ainsi la propagande médiatique de la peur, avec des conséquences désastreuses : Tests RT-PCR non pertinent → signifie « cas » → propagande → mesures arbitraires / plus grand mal → popularité des dirigeants 33

La transmission ne se fait pas par contact

Le 17 septembre 2020, une étude approfondie a été publiée par Meyerowitz et al 34 dans l’une des principales revues médicales du monde, Annals of Internal Medicine, qui a conclu ce qui aurait dû être évident dès le départ, même pour l’OMS : La transmission par contact des maladies respiratoires virales, y compris le SRAS-CoV-2, est hors sujet.

Selon les termes de Meyerowitz et al :

“Des preuves solides provenant de rapports de cas et de groupes de cas indiquent que la transmission respiratoire est dominante, la proximité et la ventilation étant les principaux déterminants du risque de transmission. Dans les quelques cas où un contact direct ou une transmission fomitive est présumé, la transmission respiratoire n’a pas été complètement exclue. L’infectiosité atteint son maximum environ un jour avant l’apparition des symptômes et diminue dans la semaine qui suit, et aucune transmission liée tardivement (après qu’un patient a eu des symptômes pendant environ une semaine) n’a été documentée. Le virus présente une dynamique de transmission hétérogène : La plupart des personnes ne transmettent pas le virus, tandis que certaines provoquent de nombreux cas secondaires dans des groupes de transmission appelés « super-dispersion ». (Résumé)

[…] Il n’existe actuellement aucune preuve concluante de la transmission par fomite ou par contact direct du SRAS-CoV-2 chez l’homme.”

Cette conclusion a des implications de grande portée :

  • Elle signifie que la « recherche des contacts » est une absurdité pour les maladies respiratoires virales. Il n’est donc pas étonnant que l’OMS ait recommandé en 2019 que la recherche des contacts soit « déconseillée en toutes circonstances » (voir ci-dessus). Pourquoi l’OMS a-t-elle rejeté la transmission par aérosol pour la COVID-19 ? C’est de l’anti-science arbitraire. 35
  • Cela signifie que le lavage compulsif des mains et le nettoyage des surfaces sont des absurdités épidémiologiques, avec des conséquences négatives évidentes, comme les rappels massifs de désinfectants toxiques 36.
  • Cela signifie que les gouvernements et l’OMS ont été négligents pendant plus d’une décennie en n’étudiant pas, en ne recommandant pas et en ne mettant pas en œuvre des politiques de ventilation axées sur la transmission pour l’environnement bâti. En fait, l’OMS a enterré son propre rapport d’experts sur le sujet de 2009, sous la rubrique « eau / assainissement / santé » sur son site web 37, et un article de synthèse exhaustif du domaine public a été publié en 2007 38.
  • Cela signifie que le verrouillage des portes et des fenêtres des maisons de soins pour personnes âgées constitue le pire scénario possible pour prévenir les épidémies dans les maisons de soins 39 40.

Li et al 41 ont conclu (leur étude a été citée plus de 600 fois) :

“Dix des 40 études examinées ont été considérées comme concluantes en ce qui concerne l’association entre la ventilation des bâtiments et la transmission d’infections aéroportées. Il existe des preuves solides et suffisantes pour démontrer l’association entre la ventilation, les mouvements d’air dans les bâtiments et la transmission / propagation de maladies infectieuses telles que la rougeole, la tuberculose, la varicelle, la grippe, la variole et le SRAS. (Résumé)”

J’ai fait valoir que c’est précisément parce que la principale voie de transmission est constituée de fines particules d’aérosol que les masques ne peuvent pas réduire la transmission 42 43.

Face à la preuve irréfutable que les masques ne réduisent pas le risque d’infection de leur porteur 44 45, l’OMS et le complexe de santé publique ont inventé le « masque magique à sens unique », qui empêche la transmission par le porteur, tout en ne le protégeant pas. Les médias ont été ravis de propager ce fantasme, contraire aux lois de la physique, concernant la circulation de l’air porteur d’aérosols par les voies de moindre impédance à travers et autour des masques faciaux. Ce fantasme est ce qu’on appelle le « contrôle à la source », que de nombreux scientifiques qualifiés ont également répété.

En fait, même une stricte quarantaine de niveau militaire des jeunes adultes en bonne santé ne peut empêcher la transmission 46.

Les infirmières le savent. En Ontario, deux décisions importantes de tribunaux administratifs, en 2015 et en 2018, avec de longues audiences d’experts de tous bords, ont conclu que les infirmières de plusieurs grands hôpitaux ne pouvaient pas être obligées de porter des masques, qu’elles soient vaccinées ou non, car cela ne protégerait pas les patients 47 :

« Je pense qu’il y a maintenant un consensus qui se développe dans la communauté arbitrale selon lequel il ne fait aucun doute que ces politiques ne protègent pas vraiment les patients. L’arbitre a été assez ferme en décrivant les preuves apportées par l’hôpital comme insuffisantes, inadéquates et totalement non convaincantes », a dit Sharan Basran, avocate des infirmières.

Le port du masque dans la population générale n’apporte aucun bénéfice détectable

Depuis le 11 avril 2020, j’ai fait valoir en détail que les masques ne fonctionnent pas, et j’ai disséqué et exposé la fausse idée du contraire48 49. À cette époque, il n’y avait pas encore eu d’étude de qualité suffisante pour informer la politique sanitaire sur le port du masque dans la population générale.

Le 18 novembre 2020, Bundgaard et al ont publié leur vaste essai contrôlé randomisé (ECR) sur des participants sélectionnés dans la population générale danoise. Selon leurs propres termes 50 :

“Un total de 3030 participants ont été assignés au hasard à la recommandation de porter des masques, et 2994 ont été assignés au contrôle ; 4862 ont terminé l’étude. L’infection par le SRAS-CoV-2 s’est produite chez 42 participants à qui l’on avait recommandé de porter un masque (1,8%) et chez 53 participants du groupe témoin (2,1%). La différence entre les groupes était de -0,3 point de pourcentage (IC à 95%, -1,2 à 0,4 point de pourcentage ; P = 0,38) (rapport de cotes, 0,82 [IC, 0,54 à 1,23] ; P = 0,33). L’imputation multiple tenant compte de la perte au suivi a donné des résultats similaires. Bien que la différence observée ne soit pas statistiquement significative, les IC de 95% sont compatibles d’une réduction de 46% jusqu’à une augmentation de 23% de l’infection. (Résumé / Résultats)

[…] la recommandation de porter un masque chirurgical en dehors de la maison, entre autres, n’a pas réduit, à des niveaux conventionnels de signification statistique, l’incidence de l’infection par le SRAS-CoV-2 par rapport à l’absence de recommandation de port de masque. […] Les masques faciaux fournis aux participants étaient des masques chirurgicaux de haute qualité avec un taux de filtration de 98% [réf]. (Discussion)”

Pour être clair, « 95% d’IC sont compatibles avec une réduction de 46% jusqu’à une augmentation de 23% de l’infection » signifie que, dans les limites de l’incertitude, le port d’un masque pourrait avoir augmenté la probabilité d’être infecté de 23%. Telle est la nature de l’évaluation du risque relatif, lorsque l’impact comparatif sur le risque absolu est trop minime pour être détecté.

Les auteurs semblent avoir été contraints par le processus d’« examen par les pairs » de souligner que leur étude n’a pas été conçue pour tester l’hypothèse que j’ai évoquée plus haut, à savoir le masque magique à sens unique : « … et aucune évaluation de la capacité des masques à diminuer la transmission de maladies de leurs porteurs à d’autres personnes. »

À ce stade, quelque quinze (15) ECR de niveau politique plus tard, avec des résultats vérifiés, il faut se demander ce qu’il faudrait pour que le complexe de santé publique abandonne son nouvel enthousiasme pour le port de masque forcé de la population générale, ou au moins pour financer la recherche sur les préjudices répartis et les coûts sociétaux de cette politique draconienne.

Des études sur les préjudices quantifiables et potentiels du port de masque universel commencent à être publiées, tant dans des revues médicales régulières que dans des revues alternatives. Si le « principe de précaution » était plus qu’un simple effet de mode, de telles études auraient été nécessaires avant l’adoption de lois et d’obligations en matière de port de masque universel.

Le 6 juillet 2020, par exemple, Fikenzer et al ont publié une étude rigoureuse sur l’effet physiologique des masques sur 12 hommes en bonne santé (âgés de 38 ± 6 ans). Ils ont conclu 51 :

Les masques médicaux ont un impact négatif marqué sur la capacité cardio-pulmonaire, ce qui entrave considérablement les activités physiques et professionnelles pénibles. De plus, les masques médicaux nuisent considérablement à la qualité de vie de leur porteur. Ces effets doivent être considérés par rapport aux effets protecteurs potentiels des masques faciaux sur les transmissions virales. Les données quantitatives de cette étude peuvent donc éclairer les recommandations médicales et les décideurs politiques.”

En novembre 2020, Borovoy et al. 52 ont publié une étude approfondie des connaissances biologiques et médicales qui leur permet de déduire un potentiel important de dommages significatifs liés au port de masque. Ils soulignent à juste titre le rôle connu mais sous-estimé des bactéries dans les pandémies virales, et passent également en revue les maladies respiratoires dues aux bactéries buccales.

Les vaccins sont intrinsèquement dangereux

Le 13 juillet 2020, Arvin et al. ont publié dans les pages de la revue scientifique de premier plan Nature un important rappel à la réalité sous la forme d’une vaste « Perspective » (revue). L’article, à lire attentivement, est un exposé détaillé sur l’ignorance de l’homme concernant l’interférence artificielle avec le système immunitaire humain. Tout étudiant en sciences devrait conclure que « surtout, nous ne savons rien ». Les auteurs l’affirment sous une forme enjolivée 53 :

“L’augmentation de la maladie dépendante des anticorps (ADE) est une préoccupation générale pour le développement de vaccins et de thérapies par anticorps car les mécanismes qui sous-tendent la protection par anticorps contre tout virus ont un potentiel théorique d’amplifier l’infection ou de déclencher une immunopathologie nocive. Cette possibilité doit être examinée attentivement à ce stade critique de la pandémie de coronavirus 2019 (COVID-19), qui est causée par le coronavirus 2 du syndrome respiratoire aigu sévère (SRAS-CoV-2).

Nous passons ici en revue les observations relatives aux risques d’ADE de la maladie, et leurs implications potentielles pour l’infection par le SRAS-CoV-2. À l’heure actuelle, il n’existe pas de résultats cliniques, d’essais immunologiques ou de biomarqueurs connus qui permettent de différencier une infection virale grave d’une maladie à immunité renforcée, que ce soit par la mesure des anticorps, des cellules T ou des réponses intrinsèques de l’hôte. Les systèmes in vitro et les modèles animaux ne permettent pas de prédire le risque d’ADE de la maladie, en partie parce que les mécanismes de protection et les mécanismes potentiellement nuisibles médiés par les anticorps sont les mêmes et que la conception de modèles à base d’animaux dépend de la compréhension de la manière dont les réponses antivirales de l’hôte peuvent devenir nuisibles chez l’homme.

Les implications de notre manque de connaissances sont doubles. Premièrement, des études complètes sont nécessaires de toute urgence pour définir les corrélats cliniques de l’immunité protectrice contre le SRAS-CoV-2. Deuxièmement, étant donné qu’il est impossible de prévoir de manière fiable l’apparition de la maladie après une vaccination ou un traitement par anticorps – quel que soit le virus responsable – il sera essentiel de s’appuyer sur une analyse minutieuse de la sécurité chez l’homme à mesure que les interventions immunitaires contre la COVID-19 progressent. (Résumé)”

Compte tenu du déploiement qui a suivi, cela signifie que nous nous sommes lancés aveuglément dans une expérience à grande échelle sur des sujets humains, sans essais sur des animaux, sans transparence scientifique, sans possibilité de consentement éclairé, sous l’impulsion de sociétés pharmaceutiques qui ne veulent que le bien de l’humanité.

Le 1er octobre 2020, Wehenkel 54 a publié un article dans lequel il a étudié 39 pays et a constaté une forte association entre le taux national de vaccination contre la grippe (IVR) des personnes âgées de 65 ans et plus et le nombre de décès dus à la COVID-19 par million d’habitants. Les résultats sont préliminaires mais peuvent constituer un exemple documenté de « renforcement de la maladie dépendant des anticorps (ADE) » impliquant la COVID-19. Tous les taux de décès par COVID-19 les plus élevés ont été enregistrés dans les pays où l’IVR est supérieure à 50 % (voir ses figures 1 et 3). Je sens une opportunité de financement de la recherche pour défaire cette découverte.

Denis G. Rancourt

Chercheur, Association des libertés civiles de l’Ontario

L’auteur présente ci dessous ses compétences pour examiner les données scientifiques sur la COVID-19

Je suis retraité et ancien professeur titulaire de physique à l’université d’Ottawa. Le poste de professeur titulaire est le plus haut grade universitaire. Au cours de mes 23 ans de carrière en tant que professeur d’université, j’ai développé de nouveaux cours et j’ai enseigné à plus de 2000 étudiants universitaires, à tous les niveaux, et dans trois facultés différentes (sciences, ingénierie, arts). J’ai supervisé plus de 80 stages de recherche ou diplômes à tous les niveaux, du post-doctorant aux étudiants de troisième cycle en passant par les chercheurs de premier cycle du CRSNG. J’ai dirigé un laboratoire de recherche interdisciplinaire de renommée internationale, et j’ai attiré d’importants fonds de recherche pendant deux décennies.

J’ai été invité une quarantaine de fois à participer à des conférences scientifiques majeures, que ce soit en séance plénière, en tant que conférencier principal ou en session spéciale. J’ai publié plus de 100 articles de recherche dans des revues scientifiques de premier plan évaluées par des pairs, dans les domaines de la physique, de la chimie, de la géologie, de la bio-géochimie, de la science des mesures, de la science du sol et de la science environnementale.

Mon facteur d’impact de l’indice H scientifique est de 40, et mes articles ont été cités plus de 5 000 fois dans des revues scientifiques à comité de lecture (profil sur Google Scholar).

Mes connaissances personnelles et ma capacité à évaluer les faits présentés dans cet article sont fondées sur mon éducation, ma recherche, ma formation et mon expérience, comme suit :

  1. En ce qui concerne les nanoparticules environnementales. Les maladies respiratoires virales sont transmises par la plus petite fraction de taille des particules d’aérosols chargées de virions, qui sont des nanoparticules environnementales réactives. Par conséquent, les stabilités chimiques et physiques et les propriétés de transport de ces particules d’aérosol sont à la base du mécanisme dominant de contagion par l’air. Mes travaux approfondis sur les nanoparticules environnementales réactives sont reconnus au niveau international et portent sur les aspects suivants : précipitation et croissance, réactivité de surface, agglomération, charge de surface, transformation de phase, décantation et sédimentation, et dissolution réactive. En outre, j’ai enseigné la dynamique des fluides (l’air est un fluide compressible) et la sédimentation gravitationnelle au niveau universitaire, et j’ai effectué des recherches sur les applications industrielles de la technologie de filtration (les masques faciaux sont des filtres).
  2. En ce qui concerne la science moléculaire, la dynamique moléculaire et la complexation de surface. Je suis un expert en structures, réactions et dynamiques moléculaires, y compris la complexation moléculaire des surfaces biotiques et abiotiques. Ces processus sont à la base de la fixation des virus, de la fixation des antigènes, de la réplication moléculaire, de la fixation aux fibres des masques, de la charge des particules, de la perte et de la croissance des particules d’aérosol, et de tous ces phénomènes impliqués dans la transmission et l’infection virale, et dans les mesures de protection. J’ai enseigné pendant de nombreuses années la mécanique quantique au niveau universitaire avancé, qui est la théorie fondamentale des atomes, des molécules et des substances ; et dans mes recherches publiées, j’ai développé la théorie et la méthodologie de la diffraction des rayons X pour la caractérisation des petites particules de matériaux.
  3. En ce qui concerne les méthodes d’analyse statistique. L’analyse statistique des études scientifiques, y compris l’analyse robuste de la propagation des erreurs et les estimations robustes des biais, fixe la limite de ce qui peut être déduit de manière fiable de toute étude d’observation, y compris les essais contrôlés randomisés en médecine, et y compris les mesures sur le terrain pendant les épidémies. Je suis un expert en analyse d’erreurs et en analyse statistique de données complexes, au niveau de la recherche dans de nombreux domaines scientifiques. Les méthodes d’analyse statistique sont à la base de la recherche médicale.
  4. En ce qui concerne la modélisation mathématique. Une grande partie de l’épidémiologie est basée sur des modèles mathématiques de transmission et d’évolution des maladies dans la population. J’ai des connaissances et une expérience au niveau de la recherche en matière de modèles mathématiques prédictifs et exploratoires et de méthodes de simulation. J’ai des connaissances d’expert liées aux incertitudes des paramètres et aux dépendances des paramètres dans ces modèles. J’ai réalisé des simulations approfondies de la dynamique épidémiologique, en utilisant des modèles compartimentaux standard (SIR, MSIR) et de nouveaux modèles.
  5. En ce qui concerne les méthodes de mesure. En science, il existe cinq grandes catégories de méthodes de mesure : (1) la spectroscopie (y compris la spectroscopie nucléaire, électronique et vibratoire), (2) l’imagerie (y compris la microscopie optique et électronique, et l’imagerie par résonance), (3) la diffraction (y compris la diffraction des rayons X et des neutrons, utilisée pour élaborer des structures moléculaires, des défauts et des structures magnétiques), (4) les mesures de transport (y compris les taux de réaction, les transferts d’énergie et les conductivités), et (5) les mesures des propriétés physiques (y compris la densité spécifique, les capacités thermiques, la réponse aux contraintes, la fatigue des matériaux…). J’ai enseigné ces méthodes de mesure dans un cours interdisciplinaire de troisième cycle que j’ai développé et donné à des étudiants de troisième cycle (M.Sc. et Ph.D.) en physique, biologie, chimie, géologie et ingénierie pendant de nombreuses années. J’ai fait des découvertes et des progrès fondamentaux dans les domaines de la spectroscopie, de la diffraction, de la magnétométrie et de la microscopie, qui ont été publiés dans des revues scientifiques de premier plan et présentés lors de conférences internationales. Je connais la science des mesures, la base de toutes les sciences, au plus haut niveau.

Traduit par Hervé pour le Saker Francophone

Notes

  1. 2019–OMS : « Mesures de santé publique non pharmaceutiques pour atténuer le risque et l’impact de la grippe épidémique et pandémique », avec annexe, Organisation mondiale de la santé, octobre 2019 : OMS . Rapport, ISBN : 978-92-4-151683-9, pp 91, « Annexe : Rapport des revues systématiques de la littérature », WHO/WHE/IHM/GIP/2019.1, pp 125
  2. 2017–OMS : « Évaluation de la gravité de la grippe pandémique (PISA) : Un guide de l’OMS pour évaluer la gravité de la grippe dans les épidémies et pandémies saisonnières », Organisation mondiale de la santé, mai 2017, WHO/WHE/IHM/GIP/2017.2
  3. 2011–Bonneux : Luc Bonneux & Wim Van Damme. « La santé, c’est plus que la grippe ». Bulletin de l’Organisation mondiale de la santé 2011;89:539-540. doi : 10.2471/BLT.11.089086
  4. Ibid note 3
  5. 2010–Cohen : Cohen, D. et Carter, P. « L’OMS et les « conspirations » de la grippe pandémique ». BMJ 2010 ; 340:c2912. doi. (Publié le 04 juin 2010)
  6. 2020–Rancourt : « Les masques ne fonctionnent pas : un examen de la science en rapport avec la politique sociale de Covid-19 ». Rancourt, DG (11 avril 2020) ResearchGate, a obtenu 400 000 lectures, puis a été retiré de la plate-forme, selon ce rapport. Maintenant sur vixra.org , et sur rcreader.com. Et voir les Digi-Debates sur les critiques de l’article : « Digi-Debates. The Face Mask Debate », Digi Debates YouTube Channel, 25 juillet 2020, et à l’adresse suivante
  7. 2020–Rancourt : « Masques faciaux, mensonges, foutus mensonges, et fonctionnaires de la santé publique : « Un ensemble croissant de preuves ». ResearchGate (3 août 2020). DOI : 10.13140/RG.2.2.25042.58569
  8. 2020–Rancourt : « Mortalité toutes causes confondues lors de la COVID-19 : Pas de fléau et une signature probable d’homicide de masse par la réponse du gouvernement », par Rancourt, DG (2 juin 2020) ResearchGate. DOI: 10.13140/RG.2.2.24350.77125
  9. 2020–Rancourt : D. G. Rancourt, Marine Baudin, Jérémie Mercier. « Évaluation de la virulence du SRAS-CoV-2 en France, à partir de la mortalité toutes causes confondues 1946-2020 ». ResearchGate (20 août 2020). DOI: 10.13140/RG.2.2.16836.65920/1  (Version en français)
  10. Ibid note 6
  11. Ibid note 7
  12. 2020–Chaudhry : Chaudhry, Rabail et autres (2020) « Une analyse au niveau national mesurant l’impact des actions du gouvernement, de la préparation du pays et des facteurs socio-économiques sur la mortalité COVID-19 et les résultats sanitaires associés ». EClinicalMedicine, Volume 25, 100464 (21 juillet 2020 – The Lancet)
  13. 2020–De Larochelambert : De Larochelambert Q, Marc A, Antero J, Le Bourg E et Toussaint J-F (2020). « Covid-19 Mortalité : Une question de vulnérabilité parmi les nations confrontées à des marges d’adaptation limitées ». Frontiers in Public Health 8:604339. doi : 10.3389/fpubh.2020.604339 (19 novembre 2020 – frontiersin.org)
  14. 2020–AIER : « Les confinements ne contrôlent pas le coronavirus : Les preuves ». AIER Staff. Institut américain de recherche économique. 19 décembre 2020
  15. Ibid note 8
  16. Ibid note 9
  17. 2020–Yam : Kai Chi Yam, Joshua Conrad Jackson, Christopher M. Barnes, Jenson Lau, Xin Qin, Hin Yeung Lee. « L’augmentation des cas de COVID-19 est associée au soutien des dirigeants mondiaux ». Actes de l’Académie nationale des sciences. Oct 2020, 117 (41) 25429-25433 ; DOI : 10.1073/pnas.2009252117
  18. 2020–Abbasi : Abbasi, Kamran (rédacteur en chef). « Covid-19 : politisation, « corruption » et suppression de la science ». Journal médical britannique. BMJ 2020 ; 371 :m4425.
  19. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 – Potentiel de « variolation » dans l’attente d’un vaccin ». 29 octobre 2020. N Engl J Med 2020 ; 383:e101. DOI : 10.1056/NEJMp2026913
  20. 2020–Rasmussen : Angela L. Rasmussen et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.
  21. 2020–Brosseau : Lisa M. Brosseau et al. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (critique de Gandhi et al.)
  22. Ibid note 19
  23. Ibid note 20
  24. Ibid note 21
  25. 2020–Gandhi : Monica Gandhi et George W. Rutherford. « Masquage facial pour la Covid-19 ». The New England Journal of Medicine, nejm.org, 19 novembre 2020. (réponse de Gandhi et al.)
  26. Ibid note 7
  27. 2020–IHME : IHME COVID-19 Forecasting Team, Reiner, R.C., Barber, R.M. et al. « Modélisation des scénarios COVID-19 pour les États-Unis ». Nature Medicine (2020). doi
  28. 2020 — Magness : Phillip W. Magness. « Les arguments en faveur de l’obligation du port de masques reposent sur des données erronées ». Wall Street Journal (11 novembre 2020)
  29. 2020 : Corman Victor M, Landt Olfert, Kaiser Marco, Molenkamp Richard, Meijer Adam, Chu Daniel KW, Bleicker Tobias, Brünink Sebastian, Schneider Julia, Schmidt Marie Luisa, Mulders Daphne GJC, Haagmans Bart L, van der Veer Bas, van den Brink Sharon, Wijsman Lisa, Goderski Gabriel, Romette Jean-Louis, Ellis Joanna, Zambon Maria, Peiris Malik, Goossens Herman, Reusken Chantal, Koopmans Marion PG, Drosten Christian. « Détection de nouveaux coronavirus en 2019 (2019-nCoV) par RT-PCR en temps réel ». Euro Surveill. 2020;25(3):pii=2000045. doi
  30. 2020–Borger : Borger, Pieter et al « Rapport d’examen Corman-Drosten et al Eurosurveillance 2020 – L’examen externe par les pairs du test RT-PCR pour détecter le SRAS-CoV-2 révèle 10 failles scientifiques majeures au niveau moléculaire et méthodologique : conséquences pour les résultats faussement positifs ». Consortium international des scientifiques en sciences de la vie (ICSLS). 27 novembre 2020
  31. 2020–Singanayagam : Singanayagam Anika, Patel Monika, Charlett Andre, Lopez Bernal Jamie, Saliba Vanessa, Ellis Joanna, Ladhani Shamez, Zambon Maria, Gopal Robin. « Durée de l’infectiosité et corrélation avec les valeurs seuils du cycle RT-PCR dans les cas de COVID-19, Angleterre, janvier à mai 2020 ». Euro Surveill. 2020;25(32):pii=2001483. doi
  32. 2020–Jaafar : Jaafar R, Aherfi S, Wurtz N, Grimaldier C, Hoang VT, Colson P, Raoult D, La Scola B. « Corrélation entre 3790 échantillons positifs au qPCR et des cultures cellulaires positives, y compris 1941 isolats de SRAS-CoV-2 ». Clin Infect Dis. 2020 Sep 28:ciaa1491. doi : 10.1093/cid/ciaa1491. Epub avant impression. PMID : 32986798 ; PMCID : PMC7543373 – academic.oup.com
  33. Ibid note 17
  34. 2020–Meyerowitz : Eric A. Meyerowitz, Aaron Richterman, Rajesh T. Gandhi, et al « Transmission du SRAS-CoV-2 : Un examen des facteurs viraux, des hôtes et de l’environnement ». Ann Intern Med. – Epub avant impression 17 septembre 2020. doi:10.7326/M20-5008 – acpjournal.org
  35. Ibid note 7
  36. 2020–CBC : La presse canadienne : « Santé Canada rappelle plus de 50 désinfectants pour les mains dans une liste évolutive ». (5 août 2020) – cbc.ca
  37. 2009–OMS : « Ventilation naturelle pour la lutte contre les infections dans les établissements de santé – Lignes directrices de l’OMS 2009 ». Éditeurs : James Atkinson, Yves Chartier, Carmen Lúcia Pessoa-Silva, Paul Jensen, Yuguo Li et Wing-Hong Seto, pp 106, 2009, ISBN : 978 92 4 154785 7 – OMS
  38. 2007–Li : Li Y, Leung GM, Tang JW, Yang X, Chao CY, Lin JZ, Lu JW, Nielsen PV, Niu J, Qian H, Sleigh AC, Su HJ, Sundell J, Wong TW, Yuen PL. « Rôle de la ventilation dans la transmission aérienne d’agents infectieux dans l’environnement bâti – une étude systématique multidisciplinaire ». Air intérieur. 2007 Feb;17(1):2-18. doi : 10.1111/j.1600-0668.2006.00445.x. PMID : 17257148
  39. Ibid note 8
  40. Ibid note 9
  41. Ibid note 38
  42. Ibid note 6
  43. Ibid note 7
  44. Ibid note 6
  45. Ibid note  7
  46. 2020–Letizia : Letizia AG, Ramos I, Obla A, Goforth C, Weir DL, Ge Y, Bamman MM, Dutta J, Ellis E, Estrella L, George MC, Gonzalez-Reiche AS, Graham WD, van de Guchte A, Gutierrez R, Jones F, Kalomoiri A, Lizewski R, Lizewski S, Marayag J, Marjanovic N, Millar EV, Nair VD, Nudelman G, Nunez E, Pike BL, Porter C, Regeimbal J, Rirak S, Santa Ana E, Sealfon RSG, Sebra R, Simons MP, Soares-Schanoski A, Sugiharto V, Termini M, Vangeti S, Williams C, Troyanskaya OG, van Bakel H, Sealfon SC. « Transmission du SRAS-CoV-2 parmi les recrues dans la Marine pendant la quarantaine ». N Engl J Med. 2020 Dec 17;383(25):2407-2416. doi : 10.1056/NEJMoa2029717. Epub 2020 11 nov. PMID : 33176093 ; PMCID : PMC7675690. (11 novembre 2020) – nejm.org
  47. 2018–Brown : « L’ONA remporte un deuxième arbitrage contre les hôpitaux sur la politique des vaccins ou des masques » (13 septembre 2018), Canadian Lawyer Magazine – canadianlawyermag.com
  48. Ibid note 6
  49. Ibid note 7
  50. 2020–Bundgaard : Bundgaard H, Bundgaard JS, Raaschou-Pedersen DET, von Buchwald C, Todsen T, Norsk JB, Pries-Heje MM, Vissing CR, Nielsen PB, Winsløw UC, Fogh K, Hasselbalch R, Kristensen JH, Ringgaard A, Porsborg Andersen M, Goecke NB, Trebbien R, Skovgaard K, Benfield T, Ullum H, Torp-Pedersen C, Iversen K. « Efficacité de l’ajout d’une recommandation sur les masques à d’autres mesures de santé publique pour prévenir l’infection par le SRAS-CoV-2 chez les porteurs de masques danois : un essai contrôlé randomisé ». Ann Intern Med. 2020 Nov 18:M20-6817. doi : 10.7326/M20-6817. Epub avant impression. PMID : 33205991 ; PMCID : PMC7707213. – acpjournals.org
  51. 2020–Fikenzer : Fikenzer S, Uhe T, Lavall D, Rudolph U, Falz R, Busse M, Hepp P, Laufs U. « Effets des masques chirurgicaux et des masques FFP2/N95 sur la capacité d’exercice cardio-pulmonaire ». Clin Res Cardiol. 2020 Dec;109(12):1522-1530. doi : 10.1007/s00392-020-01704-y. Epub 2020, 6 juillet. PMID : 32632523 ; PMCID : PMC7338098 – springer.com
  52. 2020–Borovoy : Boris Borovoy, Colleen Huber, Maria Crisler. « Masques, fausse sécurité et dangers réels, Partie 2 : Défis microbiens des masques ». Primary Doctor Medical Journal. Novembre 2020 – pdmj.org
  53. 2020–Arvin : Arvin AM, Fink K, Schmid MA, Cathcart A, Spreafico R, Havenar-Daughton C, Lanzavecchia A, Corti D, Virgin HW. « Une perspective sur le renforcement potentiel du SRAS-CoV-2 dépendant des anticorps ». Nature. 2020 Aug;584(7821):353-363. doi : 10.1038/s41586-020-2538-8. Epub 2020 13 juillet. PMID : 32659783 – nature.com
  54. 2020–Wehenkel : Wehenkel C. 2020. « Association positive entre les décès dus au COVID-19 et les taux de vaccination contre la grippe chez les personnes âgées dans le monde ». PeerJ 8:e10112  – doi 

= = =

Lecture complémentaire:

Notre page « Coronavirus, guerre contre l’humanité »

 


Faites-leurs confiance… Ils ne vous veulent que du bien !

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

L’ancien directeur de la recherche en pneumologie du labo Pfizer demande un arrêt immédiat des études sur le vaccin pour raison de sécurité… Sait-il quelque chose qu’on ne dit pas sur la stérilisation par exemple ?

Posted in actualité, altermondialisme, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 8 décembre 2020 by Résistance 71

Dépeuplement ? Les docteurs Wordarg et Yeadon demandent l’arrêt immédiat de toutes les études sur le vaccin COVID-19 qu’ils considèrent dangereuses [pour les personnes servant de cobayes]

M.K scarlett

5 décembre 2020

Source de l’article en français:
https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

Le 1er décembre 2020, l’ancien directeur de la recherche en pneumologie de Pfizer, le Dr Michael Yeadon, et le pneumologue et ancien directeur du département de santé publique, le Dr Wolfgang Wodarg, ont déposé une demande auprès de l’Agence européenne des médicaments — responsable de l’approbation des médicaments à l’échelle de l’Union européenne — pour la suspension immédiate de toutes les études sur le vaccin Sras-CoV-2, et en particulier l’étude BioNtech/Pfizer sur le BNT162b (numéro EudraCT 2020-002641-42). 

répondre aux importantes préoccupations en matière d’innocuité, préoccupations exprimées par un nombre croissant de scientifiques de renom à l’encontre du vaccin et du protocole d’étude. 

Les pétitionnaires demandent d’une part qu’un séquençage dit de Sanger soit utilisé en raison du manque patent d’études sérieuses quant au test PCR. C’est la seule façon de faire des déclarations fiables sur l’efficacité d’un vaccin anti-Covid-19. Sur la base des nombreux tests PCR de qualité très variable, ni le risque de maladie ni l’éventuel bénéfice d’un vaccin ne peuvent être déterminés avec une certitude suffisante, et c’est la raison pour laquelle les tests du vaccin sur des humains sont en soi contraires à l’éthique. 

En outre, ils exigent qu’il soit exclu, par exemple au moyen d’expérimentations animales, que des risques déjà connus par des études antérieures — qui proviennent en partie de la nature des coronavirus — puissent se concrétiser. Les préoccupations portent en particulier sur les points suivants : 

  • La formation d’anticorps dits « non neutralisants » peut entraîner une réaction immunitaire exagérée, surtout lorsque la personne testée est confrontée après la vaccination au vrai virus « naturel ». Cette amplification dite aggravation dépendante des anticorps, l’ADE, est depuis longtemps connue grâce à des expériences avec des vaccins anti-coronavirus chez les chats, par exemple. Au cours de ces études, tous les chats qui avaient initialement bien toléré la vaccination sont morts après avoir attrapé le virus « naturel ».
  • On s’attend à ce que les vaccins produisent des anticorps contre les protéines Spike du Sras-CoV-2. Cependant, ces protéines Spike contiennent également des protéines analogues à la syncytine, qui sont essentielles pour la formation du placenta chez les mammifères tels que l’homme. Il faut absolument exclure qu’un vaccin contre le Sras-CoV-2 puisse déclencher une réaction immunitaire contre la syncytine-1, sous peine de provoquer une stérilité de durée indéterminée chez les femmes vaccinées.
  • Les vaccins à ARNm de BioNTech/Pfizer contiennent du polyéthylène glycol (PEG). Il se trouve que 70 % des personnes développent des anticorps contre cette substance — cela signifie que de nombreuses personnes peuvent, suite à cette vaccination, développer des réactions allergiques, potentiellement mortelles.
  • La durée beaucoup trop courte de l’étude ne permet pas une estimation réaliste des effets sur le long terme. Comme dans les cas de narcolepsie après la vaccination contre la grippe porcine, des millions de personnes en bonne santé seraient exposées à un risque inacceptable si une autorisation d’urgence était accordée et que la possibilité d’observer les effets sur le long terme de la vaccination ne devait qu’advenir ensuite. Néanmoins, BioNTech/Pfizer a apparemment soumis une demande d’approbation d’urgence le 1er décembre 2020.

APPEL À L’AIDE : Wodarg et Yeadon demandent au plus grand nombre possible de citoyens européens de cosigner leur pétition en envoyant à l’Agence européenne des médicaments le mail préparé ICI. 

Source de l’article initialement publié en anglais le 1er décembre2020 : 2020news.de 

====

Additif de M.K Scarlett de Sott.net

Considérons la possibilité que ce « vaccin » anti-Covid — notamment celui de BioNTech/Pfizer, mais ce n’est peut-être pas le seul, les données sont à ce jour trop partielles — cache une volonté de dépopulation… 

Tout d’abord, après quelques recherches, il s’avère que, selon cette étude publiée en avril 2014 sur le Journal of Assisted Reproduction and Genetics, la syncytine-1 est également présente dans le sperme. Ce ne serait donc pas seulement les femmes qui seraient stérilisées, mais aussi les hommes. 

EN PLUS de supprimer toute responsabilité qui pourraient incomber aux fabricants de vaccins, il est fait usage de tests PCR largement considérés comme inadéquats. En outre, ils exercent une forte pression sur les populations pour les inciter à se faire vacciner. 

Pourquoi ? 

S’agirait-il — sous couvert de lutter contre un coronavirus — de concrétiser ce qui est gravé sur les Guidestones en Géorgie ? 

Il n’existe à ce jour aucune données sur l’efficacité du vaccin chez les enfants et les femmes enceintes. Et pour cause, ces deux catégories n’ont pas participé aux essais. Pas encore… Le 2 décembre, Selon l’article de Nature du 3 décembre, Moderna a dévoilé ses plans pour tester son vaccin chez les enfants. 

La Grande-Bretagne est le premier pays à avoir autorisé l’usage du vaccin contre le Covid-19 mis au point par Pfizer et BioNtech, et son gouvernement précise que ce vaccin n’est pas destiné aux femmes enceintes ou aux femmes « qui prévoient de tomber enceintes » :

« Il n’existe pas encore de données sur l’innocuité des vaccins Covid-19 pendant la grossesse, qu’elles proviennent d’études sur l’homme ou sur l’animal. Étant donné le manque de preuves, la JCVI privilégie une approche de précaution et ne conseille pas actuellement la vaccination Covid-19 pendant la grossesse. 

Il convient de conseiller aux femmes de ne pas se présenter pour la vaccination si elles sont enceintes ou prévoient de l’être dans les trois mois suivant la première dose. 

Des données sont attendues qui alimenteront les discussions sur la vaccination pendant la grossesse. Le JCVI les examinera dès qu’elles seront disponibles. »

Donc, et selon Wodarg et Yeadon, dans le cadre d’une grossesse existante, le vaccin composé de syncytine-1 attaquerait le placenta et provoquerait rapidement une fausse couche. Des vaccins de l’OMS/Gates ont déjà produit ces effets aux femmes d’Amérique latine : « Quand Bill Gates stérilisait des millions de femmes à coups de seringue ». 

Pourquoi ne veulent-ils pas — à ce stade — que les femmes enceintes soient vaccinées ? Il peut bien sûr exister tout un tas de bonnes raisons de ne pas le faire, et d’ailleurs, les femmes enceintes ne font en général pas partie des essais vaccinaux. Toutefois, est-il possible que ce soit parce que les fausses couches se produiraient tellement rapidement qu’il pourrait devenir par trop évident que le « vaccin » en serait la cause ? Le fait de ne pas vouloir — au début — inclure dans leurs programmes de vaccination des femmes qui sont enceintes ou veulent tomber enceintes leur permettrait-il d’enterrer la vérité sur les effets réels du vaccin, suffisamment longtemps pour que la majorité de la population l’accepte ? 

Beaucoup de questions, mais peu de réponses. À ce stade, on ne peut que conjecturer en prenant en compte notre connaissance des desiderata d’une élite mondialiste psychopathe.

= = =

Notre page « Coronaviru, guerre biologique contre l’humanité »


Vaccination… bien public ou imposture ?

Historique des opérations faux-drapeau en cette aube du bio-terrorisme étatico-capitaliste (vidéo James Corbett)

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , on 21 novembre 2020 by Résistance 71

Résistance 71

21 novembre 2020

Dernière vidéo pédagogique en date du toujours excellent James Corbett sur un historique des attentats faux-drapeau et l’aube du terrorisme biologique. Documentaire de 29min, succint mais dense, direct à l’essentiel comme on l’aime, qui vient à point nommé dans ce « nouveau normal » imposé par la situation des plus orwelliennes de cette ère « coronavirus », où les gouvernements oligarchiques sous contrôle du gros business transnational nous ont présenté le nouveau croquemitaine en date :


Bébert Corona

A voir et diffuser sans aucune modération (durée : 29 minutes)

https://odysee.com/@corbettreport:0/bioterrorism:4

Video + transcript (en anglais):
https://www.corbettreport.com/bioterror/


création labo

A lire notre page « Coronavirus et guerre biologique contre l’humanité »

et aussi :
COVID 19_version finale 2020_08_25
Bill-la-piquouze-Gates-et-son-empire-mondial-de-la-sante
Masque_Non-au-muselage-sanitaire
COVID_19_Synthèse_de_points_indiscutables_pour_mieux_débattre_
La_dissonance_cognitive
Bas le masque ! Tract
Dossier_special_CoV19_ingenierie_sociale_et_dictature_technotronique
HistoriqueCartelPharmaceutique
SARS-CoV_UCN


Eugénisme en action…

Reprise 4 : Les conséquences anthropologiques désastreuses de la « crise » planétaire coronavirus qui engendre la dictature sanitaire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, démocratie participative, guerres hégémoniques, guerres imperialistes, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, société des sociétés, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , , , , , , , , , on 2 septembre 2020 by Résistance 71

Analyse particulièrement intéressante de Paye et Umay sur les conséquences anthropologiques de cette crise fabriquée et entretenue du coronavirus, montrant par là même l’étendue de l’ingénierie sociale en cours. rien n’arrive par hasard, toute cette fange a été planifiée et mise en place depuis des années.
Il est impératif que nous commencions à nous unir et à mettre en place notre monde alternatif, celui de la société des sociétés de notre humanité réalisée.
Pour ceux qui en doutait encore: le CoV19 nous montre une fois pour toute qu’il n’y a pas de solution au sein du système et ne saurait y en avoir !… Depuis le temps qu’on le dit ! De plus cette analyse vient en complément de notre analyse en date du 15 juillet courant sur « Le masque comme rituel de passage vers un Nouvel Ordre Mondial »
transmettez toute cette littérature sans aucune modération, il est plus que grand temps que nous nous liguions contre l’oligarchie qui nous impose toujours plus avant la décadence de son système obsolète et criminel.
A bas l’État, à bas la marchandise, à bas l’argent et à bas le salariat !
Qu’on se le dise !
~ Résistance 71 ~

 


Le corona-reset du capitalisme ?…

 

Coronavirus * une mutation anthropologique

 

Jean-Claude Paye et Tülay Umay

 

16 août 2020

 

url de l’article original:

https://www.mondialisation.ca/coronavirus-une-mutation-anthropologique/5648374

 

La notion d’état d’urgence juridique nous est familière. Elle fait partie de notre vie depuis une vingtaine d’années, que l’état d’urgence ait été déclaré comme en France ou qu’il résulte simplement d’une transformation constante du droit pénal détruisant, au nom de la « lutte contre le terrorisme », l’essentiel des libertés collectives et individuelles. Ce processus, ayant pour objet la suppression de l’État de droit, a été nommé « état d’urgence permanent ».

A cette transformation, au niveau du droit, s’ajoute aujourd’hui une notion « d’état d’urgence sanitaire ». Ici, dans l’état d’urgence sanitaire, le droit n’est pas suspendu, ni même supprimé, il n’a plus lieu d’être. Le pouvoir ne s’adresse plus à des citoyens, mais seulement à des malades ou à des porteurs potentiels de virus. 

Lorsque le droit est suspendu dans l’état d’urgence ou supprimé dans le cadre de la dictature, sa place demeure, même si elle reste inoccupée. Dans « l’état d’urgence sanitaire », c’est sa place même qui disparaît. Le droit n’est plus simplement suspendu ou refoulé, mais expulsé. Forclos, il est simplement placé hors discours, comme s’il n’avait jamais existé. 

Renoncer à nos libertés.

La « lutte antiterroriste »  a permis de supprimer la plupart des libertés publiques et privées, en s’attaquant à des actes concrets, mais surtout à des intentions attribuées à la personne poursuivie, si celles-ci ont « pour objectif de faire pression sur un gouvernement ou une organisation internationale ». La lutte antiterroriste enregistre la fin du politique (1). 

Aux Etats-Unis et en Grande-Bretagne,  la notion de guerre s’est introduite dans le droit pénal par le biais de la lutte contre le terrorisme, Il permet au pouvoir exécutif de désigner, comme ennemis, ses propres ressortissants et ses opposants politiques. Cette lecture redéfinit la notion de guerre. Elle lui donne un caractère asymétrique, celle d’une « lutte à mort » entre un Etat et des personnes désignées comme ennemis. Ils peuvent ainsi  s’attaquer aux libertés constitutionnelles des citoyens, mais aussi à leur Habeas Corpus, à leur capacité de disposer de leur corps (2).

Ici, dans la « lutte contre le coronavirus », le corps n’est pas saisi, son effacement doit être consenti par les individus. De leur propre initiative, ils doivent renoncer à ce qui fait d’eux des hommes, à tout rapport social, à toute relation avec l’autre. Ils doivent participer aux mesures de distanciation, de limitation stricte des contacts, accepter l’interdiction de ce qui peut faire lien : rejeter les évènements pouvant constituer l’image d’un « nous », bien sûr les manifestations politiques, mais aussi culturelles ou même sportives. 

La quotidienneté se réduit à une prescription sacrificielle. Tous les individus sont à la fois passifs et actifs, héros et victime. Ils se soumettent à l’autorité et tout en adoptant, de leur propre chef, des mesures absurdes et dégradantes. Ils veillent à la participation de tous dans le port du masque et les mesures de distanciation. Ils constituent des individus « en marche » dans leur sacrifice.

La « guerre contre le coronavirus » s’inscrit bien dans un processus en cours depuis une vingtaine d’années. Cependant, ici, ce n’est pas seulement la personne juridique, ainsi que le droit de disposer de son corps, qui sont directement confisqués, mais l’existence même de  l’individu social, son devenir et son rapport à l’autre. Les droits politiques des citoyens ne sont pas démantelés, dans le sens où ils n’ont pas à intervenir dans une crise sanitaire. Ils sont simplement forclos. 

Renoncer à notre vie !

En fusionnant guerre et paix, dans le cadre de la «  guerre contre le terrorisme », le pouvoir exige un renoncement  permanent à nos libertés. Dans la « guerre contre le coronavirus, » il nous est demandé un abandon de notre vie à des dieux obscurs, réclamant toujours plus de sacrifices (3).  Il s’agit notamment  d’accepter un vaccin présentant tous les dangers. Nous devons nous confiner et supprimer tout rapport social.  Un vaccin ne pouvant, par nature, faire face à un virus mutant, sa fonction est autre. Les bénéfices extraordinaires, que pourra en tirer l’industrie pharmaceutique, ne sont que l’aspect secondaire de la question. L’aspect principal réside dans le contrôle de notre existence, mais surtout dans la possibilité offerte au capital, grâce à l’introduction de puces, de  modeler notre corps et notre psychisme selon ses intérêts, selon les besoins de la production et de la domination politique. La mise en place d’un transhumanisme, d’une mutation anthropologique est la question principale à laquelle nous devons aujourd’hui faire face. La guerre contre le coronavirus n’est qu’un élément de cette stratégie globale, économique, politique et anthropologique.

La volonté politique de s’approprier du vivant humain, pour en faire une marchandise, doit reposer sur l’assentiment des populations. L’affaire du coronavirus s’inscrit dans la fabrication du consentement des individus à leur propre destruction en tant qu’êtres humains. C’est aussi à travers cette question qu’il nous faut lire l’adoption par l’Assemblée nationale française du projet de loi sur la bioéthique (4) qui s’inscrit dans ce projet de mutation anthropologique. Outre la mesure emblématique de l’ouverture de la PMA aux couples de lesbiennes et aux femmes célibataires, il prévoit une réforme de la filiation. En parallèle, il autorise l’autoconservation des ovocytes et la recherche sur les cellules souches embryonnaires. L’ensemble de ces réformes rencontre les objectifs biopolitiques de la lutte contre le coronavirus, la création d’un homme nouveau qui n’a plus rien d’humain.

Une guerre contre la « personne ».

La « guerre contre le coronavirus » fusionne maladie et guerre. Le citoyen est, ou ne peut, que devenir un malade, à qui  la dite « science,  à travers ses représentants médiatiques et politiques, doit dire comment se comporter. La responsabilité, au niveau de la lutte contre la maladie, serait moins collective qu’individuelle. « Solidaire, je suis chez moi », est l’injonction inscrite par une campagne d’affichage en Belgique. Elle exige un engagement ritualisé de sa propre personne, un engagement de caractère monadique, coupé de tout rapport avec l’autre. Ce combat contre un invisible est particulier, puisqu’il s’agit d’abord de rendre les armes, de s’abandonner à sa propre destruction en  « vivant avec » et, enfin, de jouir de celle-ci. 

Cette guerre contre le coronavirus n’est plus seulement celle de tous contre tous, la guerre  théorisée par Thomas Hobbes, mais aussi celle de l’individu contre lui-même. Elle exige non seulement le sacrifice de nos droits et de notre corps, comme l’avait déjà initié la lutte antiterroriste, notamment dans la destruction de l’Habeas Corpus des citoyens, mais encore l’abandon de l’entièreté de nos vies.  La « guerre contre le coronavirus » anticipe ainsi la nouvelle réorganisation de la production capitaliste, dont elle doit favoriser la mise en place. Comme nous le montre la généralisation du télé-travail pour « faire face à l’épidémie », l’ensemble du temps de vie devient temps de travail.

Dans cette mutation politique, économique et sociale il n’y a plus de référence au droit. Ce dernier est placé hors champ. Il fait place au sacrifice, à l’abandon de soi ritualisé aux injonctions mortifères, à travers le port du masque, la distanciation et les ablutions répétées. Les droits de soigner et d’être soigné sont abolis. Les citoyens sont confinés, afin de favoriser la transmission de la maladie. Les médicaments permettant de soigner sont retirés et interdits à la vente. Chaque moment de notre existence se réduit au discours d’une mobilisation permanente contre une épidémie qui, dans les faits, n’est pas combattue

Forclusion du droit et forclusion du sujet.

Les mesures généralisées de confinement, prises dans le cadre de la « pandémie », s’inscrivent dans une remise en cause du droit des citoyens de disposer de leur corps. Cependant, il ne s’agit pas d’une saisie du corps, afin de l’enfermer, mais bien de sa forclusion (5). En droit, la forclusion est « l‘effet que la Loi attache à une échéance, à une prescription ou à une péremption ».(6)

Ainsi, les individus ne sont plus en mesure de faire valoir leur libertés, le temps d’exercice de celles-ci étant dépassé. Leur droits sont forclos. Le droit comme signifiant est aussi forclos, enfermé dehors, non seulement oublié, mais perçu comme n’ayant jamais existé. Le droit et les libertés qui lui sont attachées n’ont plus cours dans une situation « d’urgence sanitaire ». L’interrogation sur le bien fondé des dispositions, de confinement ou de distanciation, ne peut exister, l’individu devant se comporter comme si la question n’avait pas de lieu pour être posée. 

Ce mécanisme juridique qui forclos le droit, qui le met hors de la vie politique et sociale, « si loin que l’on ne peut le retrouver,»(7) trouve aussi un écho dans la démarche psychanalytique. La notion de « forclusion » développée par Jacques Lacan signifie « clore dehors« , ou « fermer dehors« .  Pour le sujet, ce qui est rejeté dans la psychose n’aura jamais été. Lacan le formule  ainsi : « Par là on ne peut dire que fut proprement porté un jugement sur son existence, mais il en fut aussi bien que si elle avait jamais existé. » La forclusion traduit alors le retrait d’un signifiant hors de l’univers symbolique d’un sujet, celui du « Nom du Père »(8), signifiant, non seulement « oublié », mais perçu comme n’ayant jamais eu de réalité. 

Le concept de « Nom du Père » condense, en lui, toute une série de significations: la loi, le nom, la généalogie, la filiation (9). Le symbolique, comme structure, façonne et fonde la réalité humaine. C’est cette dimension symbolique qui, ici, dans la guerre contre le coronavirus, n’a pas lieu d’être (10). 

S’il y a forclusion du Nom du Père, ou échec de la métaphore paternelle, cela veut dire que l’acceptation par les individus de mesures absurdes et dommageables à leur intégrité mentale et à leur santé physique, tel le port du masque, le confinement ou la distanciation sociale, résulte dans le fait qu’ils se placent dans la position d’être le « phallus imaginaire » de la mère symbolique, de la figure étatique. Ils se posent comme des infans, placés dans une relation duelle avec cette puissance maternelle. Faute de ne pouvoir inscrire le réel, le sujet est constamment pris par celui-ci. Ne pouvant penser le réel, il devient son déchet.

Le masque comme effacement du visage.

Le port obligatoire du masque efface le visage et, dès lors, intime à l’individu de renoncer à son humanité. Dans la « pandémie » du coronavirus, cette obligation supprime tout vis à vis. La dissimulation du visage est un signe d’altération de la personnalité. Elle entraîne une rupture de l’individu dans ses rapports avec ses proches, une néantisation des rapports sociaux. Le port du masque entraîne un retrait, un isolement qui remet en cause la notion même d’individu, puisque celle-ci procède de l’extérieur, dans le vis à vis d’autrui (11).

Déjà pour les romains,  le masque, porté par les acteurs, « est une puissance sortie des ténèbres, de l’invisible et de l’informe, du monde où il n’y a plus de visage »(12). Il traduit l’impossibilité de toute relation. Chez les romains et dans notre société, « s’exposer comme visage est un lieu significatif du rapport au politique, du rapport à l’autre : individu ou groupe »(13). 

Le port du masque, comme effacement du visage, est donc suppression du vis à vis, du rapport à l’autre.  Il est aussi  perte de la face par rapport au pouvoir. Il traduit la fin du politique, de toute possibilité de confrontation.

En effet,  avoir un visage, c’est ce qui répond, dans le registre imaginaire, à avoir un nom dans le registre symbolique .  Avoir un visage, c’est advenir comme personne. Le visage est ce qui montre et dissimule le sujet dans son rapport au semblable. Le visage, pour tout sujet, est le dehors. Il est le masque qui sert de leurre dans les relations humaines.

Le porteur du masque « coronavirus » est quant à lui sans visage, il est donc exclu du jeu des semblants. Il renvoie à  une image béante, dont le porteur ne peut s’absenter. Il s’inscrit dans la transparence. Il n’est que ce qu’il montre : l’enfermement dans le réel, la fusion avec le regard du pouvoir. Si bien que le porteur du masque n’est plus une personne, mais devient simplement personne : « nobody ». La perte de la face induit ainsi un passage de la personne à la non-personne (14).

Le masque : une mutation anthropologique. 

Au début, le port du masque n’était pas conseillé par l’OMS. Il l’a ensuite recommandé. Maintenant que la maladie est quasiment éradiquée, cette contrainte devient impérative dans nombre de pays, comme en Belgique (15) où il ne fait pas l’objet d’une loi. Il y est donc illégal, tout comme les mesures de confinement ou de distanciation. En France (16), le confinement  a été imposé, malgré des erreurs de procédure, donc en dehors des règles imposées par un Etat de droit. Le droit est forclos, le discours, des médias et des forces politiques gouvernementales ou locales, le réduise à un impératif catégorique. Ce qui est recherché c’est une adhésion sans restriction. Par l’exhibition de leur soumission et la stricte observation ritualisée des injonctions paradoxales du gouvernement, les populations donnent du sens au non-sens, conférant ainsi un caractère sacrificiel aux injonctions du pouvoir. 

La stricte observance des individus donne chair à la démesure, à des commandements absurdes et dangereux. Ces rituels se détachent de plus en plus de toute justification, qu’elles soient juridiques ou médicales. Les individus doivent accepter les distanciations et l’injonction de se voiler le visage, comme des actes de soumission pure et appelant à de nouveaux renoncements. Pour les populations, il ne s’agit plus simplement de rester passif face à un discours déréalisant, comme celui de la lutte contre le terrorisme, mais d’être « en marche », de participer activement à sa propre néantisation.

Le porteur du masque exprime ainsi son consentement à la création d’un « homme nouveau, » libéré de ses contraintes anthropologiques et symboliques. L’homme masqué est le porteur d’une nouvelle anthropologie, car mettre un masque c’est renoncer à avoir un corps et ne plus avoir un corps c’est ne plus être sexué. C’est être ni homme, ni femme. Les mesures imposées au niveau de la gestion du coronavirus s’inscrivent dans un changement de société qui détruit tout ordre symbolique. L’homme masqué est en phase avec l’homme, ni-homme et ni-femme des réformes sur la procréation, ainsi qu’avec le mi-homme et mi-machine des lois sur la bio-éthique.

Jean-Claude Paye, Tülay Umay

Notes

1Jean-Claude Paye, La fin de l’État de droit. De l’état d’exception à la dictature, La Dispute, Paris 2004 et « Pas de droit en Etat d’urgence », Libération, le 18 mars 2004, https://www.liberation.fr/tribune/2004/03/18/pas-de-droit-en-etat-d-urgence_472895 

2Jean-Claude Paye, « Royaume Uni, menaces sur l’Habes-corpus », Le Monde, le 13 avril 2005,  https://www.lemonde.fr/idees/article/2005/04/13/royaume-uni-menaces-sur-l-habeas-corpus-par-jean-claude-paye_638494_3232.html et « Le modèle anglais », Université de Caen Normandie, CRDF, no 6, 2007, p. 71-8 https://www.unicaen.fr/puc/html/ecrire/revues/crdf/crdf6/crdf0606paye.pdf 

3Jean-Daniel Causse, « Le christianisme et la violence des dieux obscurs, liens et écarts », AIEMPR, XVIIe congrès international, Religions et violence ?, Strasbourg, 2006, p.4.

4« Loi bioéthique : l’Assemblée adopte le projet de loi en deuxième lecture », Le Monde avec AFP, le 1ier août 2020,

https://www.lemonde.fr/societe/article/2020/08/01/loi-bioethique-l-assemblee-adopte-le-projet-de-loi-en-deuxieme-lecture_6047874_3224.html 

5La forclusion désigne le “défaut d’inscription dans l’inconscient de l’épreuve normative de la castration” . Dans la psychose la castration est rejetée par le moi qui se  comporte comme si elle n’était jamais advenue,  NASIO, J.-D., (1988), Enseignement de 7 concepts cruciaux de la psychanalyse. Paris, Payot, 1992, p. 223. 

6Serge Baudro, https://www.dictionnaire-juridique.com/definition/forclusion.php 

7Solal Rabinovitch, « Enfermés dehors »,,http://epsf.fr/wp-content/uploads/2016/05/Solal_Enferme%C4%97s-dehors.pdf 

8 Forclusion du Nom du Père, ou échec de la métaphore paternelle, cela veut dire que le patient reste coincé dans une position d’être le phallus imaginaire de la mère. Et il y est tellement identifié que cette position devient du réel pour lui.

9 Ibidem.

10La définition de la forclusion, carnets2psycho, https://carnets2psycho.net/dico/sens-de-forclusion.html  

11Françoise Frontisi-Ducroux, Du masque au visage, Champs Flammarion, p.68.

12Françoise Frontisi-Ducroux,Op.Cit., p.38.

13Dario Morales, « Le sujet sans visage », Ecole de la Cause Freudienne, https://www.causefreudienne.net/le-sujet-sans-visage/ 

14Ibidem, p.215.

15Nicolas Thirion, « Pourquoi l’arrêté ministériel est illégal », La Libre, le 6 août 2020, https://www.lalibre.be/debats/opinions/pourquoi-l-arrete-ministeriel-covid-est-illegal-5f2bec38d8ad586219049846 

16L’avocat Me Brusa établit l’illégalité des amendes pour “non port du masque”, Covidinfos.net, le 24 juillet 2020, https://covidinfos.net/experts/lavocat-me-brusa-etablit-lillegalite-des-amendes-pour-non-port-du-masque-document-juridique-telechargeable/1297/ 

Jean-Claude Paye et Tülay Umay sont sociologues.

= = =

Notre page « Coronavirus, guerre biologique contre l’humanité »

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir !

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 


Vers la société des sociétés

Reprise 3 : Coronavirus et complotisme… Qui est qui dans cette affaire ? (Dr Pascal Sacré)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, N.O.M, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , on 1 septembre 2020 by Résistance 71

 

 

COVID-19 Qui est complotiste ?

 

Dr Pascal Sacré

 

13 août 2020

 

url de l’article original:

https://www.mondialisation.ca/covid-19-qui-est-complotiste/5648303

 

Afin de nous trouver sur la même longueur d’ondes, il me faut définir ce mot.

Complotiste : défenseur d’une théorie du complot. 

C’est comme de dire, raciste : défenseur d’une théorie du racisme.

Nous n’allons pas loin, avec ça.

Un synonyme est conspirationniste.

Qu’est-ce qu’une théorie du complot ou de la conspiration ?

Ce qui est sûr, c’est que ces mots sont péjoratifs, mauvais. 

Personne n’aime cette étiquette : « complotiste », « théoricien de la conspiration ».

Depuis le 11 septembre 2001, ce mot déjà ancien [1] est utilisé pour disqualifier toute personne qui tient des propos contraires aux versions officielles. 

Analysons cette phrase car chaque mot est important.

Par officielles, beaucoup veulent dire : gouvernementales. 

Ce n’est pas tout à fait ça.

Si vous dites que Donald Trump, pourtant président officiel et chef élu du gouvernement des USA, raconte des conneries, a utilisé les Russes pour être élu [2] ou veut annuler les prochaines élections américaines [3], toutes théories du complot contre lui, contre Trump, tous les journalistes occidentaux vous applaudiront. Ils ne vous traiteront pas de conspirationniste même si, selon la définition, c’est ce que vous êtes en diffamant ainsi.

Dans le cas du COVID-19 de 2020, si vous dites que tous les docteurs (et il n’y en a pas deux, dix ou cent, mais des milliers à travers le monde) qui disent que l’hydroxychloroquine soigne le COVID-19 sont des fous échappés d’un asile d’aliénés [4], une fois encore, les journalistes vous féliciteront. En tout cas, même sans preuve de ce que vous avancez, personne ne vous traitera de théoricien du complot.

Pourtant, c’est une théorie et c’est dirigé contre des docteurs diplômés, officiels. 

En faisant cela, vous accusez des médecins [5] dont certains travaillent à l’Université ou dans des

hôpitaux reconnus, depuis des dizaines d’années, tels que le professeur d’épidémiologie Harvey Risch [6] de la Yale School of Public Health, le professeur Didier Raoult,  directeur de l’Institut Hospitalo-Universitaire Méditerranée infection à Marseille, le docteur Christian Perronne [7], professeur des universités-praticien hospitalier français, spécialisé dans le domaine des pathologies tropicales et des maladies infectieuses émergentes et ancien président de la commission spécialisée « Maladies transmissibles » du Haut Conseil de la santé publique, en plus de nombreux médecins moins connus mais tout aussi fiables et sérieux, médecins de famille, de terrain, généralistes ou spécialistes [8 à 13].

Vous êtes un fameux « théoricien conspirationniste » si vous pensez que tous ces docteurs diplômés mentent ou veulent vous manipuler, Dieu saurait pourquoi.

Pourtant, personne ne vous traitera de ça.

La vérité, c’est que vous serez étiqueté « complotiste » si et seulement si vous tenez des propos contraires aux versions officielles des personnes, institutions, gouvernements adoubés, reconnus.

Adoubés, reconnus par qui ?

  1. Par les institutions internationales (Organisation Mondiale du Commerce, Organisation Mondiale de la Santé, Fond Monétaire International, Forum économique mondial, Organisation des Nations-Unies, Commission Européenne, Agence européenne du Médicament…). 
  2. Par des relais nationaux qui rendent compte à ces institutions internationales et ce, dans tous les domaines importants, sanitaires, médicaux, éducatifs, médiatiques, économiques… [14]

Tout cela forme un système cohérent, transnational, supranational, animé de buts communs et utilisant un langage précis et étudié.

Il faut bien saisir que ce système est indépendant des hommes politiques et survit aux changements électoraux. Il se perpétue, quoi qu’il arrive, non pas au travers d’un président, d’une personne en particulier, mais au travers de ces institutions qui traversent tous les scandales [15 à 18] et toutes les attaques sans prendre une égratignure.

Qui dirige ce système ? 

Je ne vous répondrai pas ici d’abord parce que c’est un autre travail qui mériterait un article à part entière et ensuite, parce que de nombreux chercheurs ont déjà brillamment cerné ce sujet [19 à 22].

Donc, être président, chef de gouvernement, médecin diplômé et représenter une autorité valable et sérieuse ne suffisent pas pour vous protéger de toute contestation en arguant que le contestataire serait un complotiste.

Non.

Pour cela, pour bénéficier de cette protection, il faut appartenir à ce système, parler son langage et poursuive ses buts.

Ainsi, Anthony Fauci aux propos pourtant critiquables et contradictoires [23] ne sera jamais traité de complotiste. 

Le professeur Harvey Risch, oui.

Ainsi, les journaux qui affirment que le Remdesivir est efficace dans le COVID-19, contrairement à l’hydroxychloroquine, ne seront jamais qualifiés de complotistes.

Ceux qui disent le contraire, études et médecins à l’appui, oui. 

Le problème, c’est que Trump a dit qu’il était pour l’hydroxychloroquine aussi, et cela, c’est le discrédit à tous les coups.

On dit que le Remdesivir a prouvé son efficacité face au Covid-19, dans un journal belge du 11 août 2020 [24]. 

Les mots sont importants. 

Le mot « prouvé », en l’occurrence, est faux. 

Mais qui s’en apercevra, si vous n’êtes ni docteur, ni au fait des études en question ?

En attendant, un mensonge passe comme une évidence, une vérité.

Un seul traitement par le Remdesivir rapportera 2500 $ par patient à la firme Gilead [25].

L’hydroxychloroquine, rien ou quasi.

Les termes « complotisme » ou « théorie de la conspiration » n’ont rien à voir avec la vérité ou avec la crédibilité, cela a à voir avec le conformisme aux idées dominantes, dictées par le système qui poursuit implacablement ses buts.

Un autre mot important est le mot « théorie ». Théories de la conspiration. 

Cela sous-entend des divagations sans fondements, sans preuves.

Pourtant, de nombreuses affirmations étiquetées « théories de la conspiration » n’ont rien de théorique.

Il est rare d’avoir une preuve formelle au moment de son affirmation. Celle-ci peut découler de recherches, de réflexions, de présomptions.

En médecine légale ou en sciences criminelles, vous n’aurez pas toujours de preuves irréfutables mais un faisceau de présomptions solides (mobile, faits indirects et cohérents) qui suffit à condamner un accusé, selon la loi.

Prenons la « théorie conspirationniste » selon laquelle l’industrie pharmaceutique ferait pression pour discréditer l’hydroxychloroquine et privilégier ses produits coûteux, les antiviraux comme le Remdesivir ou les vaccins.

Ce serait bien d’avoir une preuve irréfutable de cela mais je vois mal un dirigeant de cette industrie écrire un tel aveu puis le laisser traîner afin qu’il tombe entre les mains d’un journaliste honnête. Ce serait vraiment suicidaire, vous ne trouvez pas ? Et de toute façon, on discréditerait ce dirigeant, ou ce journaliste, jusqu’à ce que leur parole soit sans valeur.

Par contre, comme on le ferait dans n’importe quelle enquête policière, y a-t-il un faisceau de présomptions solides ?

1) Cette industrie a-t-elle un mobile ?

Oui.

Cette industrie a un fameux mobile pour faire cela : l’argent.

Il ne s’agit pas de milliers ou de centaines de milliers d’euros qui pousseraient pas mal de gens à commettre des meurtres, mais de milliards d’euros [26-27].

2) Cette industrie a-t-elle les moyens de faire cela ?

Oui.

On le sait grâce au témoignage de personnes de l’intérieur, comme John Virapen ex-PDG d’Eli Lilly & Company en Suède [28], ou d’anciens rédacteurs en chef de grandes revues médicales comme Marcia Angell [29] (New England Journal of Medicine) ou Richard Horton [30] (Lancet).

3) Celle industrie l’a-t-elle déjà fait ?

Oui.

Il y a des cas avérés, prouvés qui illustrent la corruption de médecins par l’industrie pharmaceutique, comme celui de l’anesthésiste Scott Reuben ayant falsifié des données concernant l’efficacité de l’antidépresseur Effexor (venlafaxine), produit par la firme Wyeth (fusionnée avec Pfizer) dans les douleurs neuropathiques et postopératoires [31].

Et ce n’est qu’un exemple [32]. Plus récemment, vous avez le Lancet-Gate: « Mensonges scientifiques sur le coronavirus » et corruption des grandes sociétés pharmaceutiques.

Même lorsque les preuves sont là, avez-vous déjà vu un journaliste qui avait accusé quelqu’un de « théoricien du complot » faire son mea culpa, s’excuser de sa méprise et rétablir la réputation du « théoricien » en question ? Et surtout, rétablir la vérité ?

Pour seul exemple, je vais prendre l’histoire des bébés koweïtis arrachés à leur couveuse et jetés à terre par les soldats irakiens pour justifier l’intervention américaine en Irak en 1990. Le président Georges Bush senior s’en est servi à plusieurs reprises, dans plusieurs discours enflammés. 

C’était un mensonge [33]. 

Nous le savons. 

Pourtant, quiconque qui l’aurait su ou compris, et l’aurait dit à ce moment aurait été traité de « théoricien du complot » de connivence avec Saddam Hussein.

Pour la petite histoire et vous démontrer que ces techniques n’ont pas cessé en 1991 ou après la preuve de ce mensonge, la firme malhonnête derrière ce mythe est la même firme qui a aidé en 2020 l’Organisation Mondiale de la Santé (OMS) à faire croire à la pandémie COVID-19 et à faire respecter ses diktats : la firme Hill & Knowlton [34].

Alors, qu’est-ce que ça veut dire, complotiste, et qui l’est vraiment ?

On le voit, ça ne veut rien dire.

C’est une étiquette péjorative, mauvaise, qui ne vous sera pas donnée si vous mentez, ou si vous critiquez une personne ou un gouvernement qui justement dérange le système.

Elle vous sera donnée si ce que vous dites, même si c’est vrai, plausible, prouvé, va à l’encontre du discours autorisé du système.

Vérifiez par vous-même.

Critiquez les docteurs qui défendent l’usage de l’hydroxychloroquine dans le COVID-19, et vous ne serez pas accusés de complotisme. 

Vous serez écoutés, approuvés.

Critiquez Anthony Fauci ou les conseils de sécurité nationaux contre le COVID-19, alors oui, vous serez accusés de complotisme, et même de tous les maux.

Très souvent, cela n’a rien à voir avec des théories.

Les faits avancés sont parfois prouvés, très souvent étayés de nombreux arguments solides et plausibles.

Les mots sont très importants. Ne sous-estimez pas leur importance. Ce sont eux qui dirigent nos pensées.

Je le sais en tant que docteur, mais également en tant que passionné de communication à visée thérapeutique.

Comme les tous premiers médecins de l’Antiquité, je sais que les mots peuvent guérir.

Ils peuvent aussi rendre dociles ou malades.

« Complotiste », « conspirationniste », « théoricien du complot » ne servent qu’à couper court à tout débat.

Qu’à faire rejeter la personne que le système dominant veut discréditer, pour que cette personne ne soit plus écoutée.

C’est cela qui est dangereux ; pas les « théories du complot ».

Ce qui est vraiment dangereux est de ne même pas vouloir débattre et d’exclure des idées, des personnes et des opinions sous prétexte qu’elles dérangent.

C’est cela qui sème les graines d’une société totalitaire ; pas les théories du complot.

C’est en refusant tout débat, toute discussion et en brandissant ce genre d’expression disqualifiante, que le pire vient.

Notes :

[1] Théorie du complot, Wikipédia

[2] Ingérence : comment la Russie a biaisé la campagne de 2016 au profit de Trump

[3] Comment Trump pourrait saboter l’élection pour la remporter

[4] Hydroxychloroquine: Goliath contre David, acte I : les détracteurs

[5] Covid-19 – Hydroxychloroquine, David contre Goliath, acte II : les supporteurs

[6] L’hydroxychloroquine agit chez les patients à haut risque, et dire le contraire est dangereux, Harvey Risch M.D., Ph.D., professeur d’épidémiologie à la Yale School of Public Health.

[7] Christian Perronne : “À Garches, nous avons de bons résultats avec l’hydroxychloroquine”, 15 avril 2020, Fervent défenseur du traitement à l’hydroxychloroquine et à l’azithromycine, pour le Pr Christian Perronne la question de son efficacité ne se pose plus. Chef du service infectiologie de l’hôpital Raymond-Poincaré de Garches, il le constate tous les jours depuis le début de l’épidémie : le traitement du Pr Raoult soigne et réduit considérablement les passages en réanimation.

[8] Riposte à la covid-19 : la saine colère du Dr BELLATON, Source : page Facebook de Silviane Le Menn, 20 avril 2020.

[9] Coronavirus : le bilan très positif d’un praticien lorrain qui prescrit l’hydroxychloroquine, le Républicain Lorrain, Philippe Marque, 6 avril 2020. Le bilan est plus que positif : « J’ai utilisé ce protocole sur une dizaine de patients hospitalisés, qui ont donc un Covid-19 déjà relativement inquiétant, et je n’ai eu ni décès ni aucune évolution vers un stade grave nécessitant une réanimation. »

[10] Un médecin mosellan constate l’efficacité d’un protocole à base d’azithromycine, le Républicain Lorrain, Thierry Fedrigo, 11 avril 2020. Deux médecins mosellans et l’une de leurs consœurs belges semblent avoir mis au point une combinaison médicamenteuse efficace contre le coronavirus. Tablant sur l’azithromycine sans recourir à l’hydroxychloroquine prônée par l’infectiologue Didier Raoult, ils ont constaté une chute nette des hospitalisations de leurs patients traités.

[11] Un médecin néerlandais soigne les patients atteints de coronavirus, mais le gouvernement néerlandais n’est pas content, Amari Roos, 10 avril 2020

[12] Des médecins algériens attestent de l’«efficacité quasi totale» de l’hydroxychloroquine contre le Covid-19, 27 avril 2020. Les chefs de services de maladies infectieuses d’un hôpital à Blida et d’un autre à Alger affirment que le protocole à base d’hydroxychloroquine, suivi dans le traitement des patients atteints du coronavirus, donne un résultat positif « quasi-total »

[13] Après l’Algérie, le Maroc encense l’efficacité de l’hydroxychloroquine contre le Covid-19, 1 mai 2020. Le protocole thérapeutique à base d’hydroxychloroquine et d’azithromycine utilisé contre le Covid-19 « a donné des résultats positifs » au Maroc, a déclaré le ministre de la Santé, précisant que les « effets secondaires sont minimes ».

[14] Ordres nationaux tels que l’Ordre des Médecins, l’Ordre des Pharmaciens, Hautes Autorités de Santé, Sciensano en Belgique…

[15] Agence européenne du médicament : des experts sous influence ?, 12 décembre 2017.

[16] Covid-19: les conseillers du pouvoir face aux conflits d’intérêts, paru le 31mars 2020, écrit par Rozenn Le Saint et Annton Rouget.

[17] Coronavirus : des liens troubles entre labos et conseils scientifiques, Valeurs actuelles, 3 avril 2020.

[18] L’Assemblée parlementaire du Conseil de l’Europe va enquêter sur l’OMS et le scandale « pandémique », Mondialisation.ca,  F. William Engdahl, 6 janvier 2010

[19] Anthony C Sutton : économiste, historien et écrivain britannique. Sutton fut chercheur à Stanford au sein de la fondation Hoover de 1968 à 1973. Il enseigna l’économie à l’UCLA. Il étudia à Londres, Göttingen et UCLA et fut titulaire d’un doctorat en sciences de l’Université de Southampton, en Angleterre. En 1972, au sein de la Hoover Institution à Stanford : Wall Street et l’ascension de Hitler , Wall Street et la révolution bolchévique

[20] Carroll Quigley : historien américain et professeur d’histoire à l’Université de Georgetown de 1941 à 1976. Quigley est né à Boston où il étudie par la suite et où il décroche deux diplômes et un doctorat d’histoire de la proche et très réputée université Harvard. À l’Université de Georgetown  : Tragedy and Hope: A History of the World in Our Time

[21] Pierre Hillard :  essayiste français, docteur en science politique : La marche irrésistible du nouvel ordre mondial , Chroniques du mondialisme

[22] Michael Parenti, historien, politologue et critique culturel américain. Il a enseigné dans des universités américaines et étrangères. À lire absolument : L’Horreur impériale

[23] Lancet-Gate: « Mensonges scientifiques sur le coronavirus » et corruption des grandes sociétés pharmaceutiques., Mondialisation.ca, Prof Michel Chossudovsky, 15 juillet 2020. Le Dr Anthony Fauci, conseiller de Donald Trump, présenté comme « le meilleur expert américain en maladies infectieuses », a joué un rôle clé dans le salissage du remède HCQ qui avait été approuvé des années plus tôt par le CDC, ainsi que dans la légitimation du Remdesivir de Gilead.

[24] Le remdesivir, médicament qui a prouvé son efficacité face au Covid-19, 11 août 2020.

[25] Le traitement au remdesivir coûtera 2.340 dollars, selon Gilead, 29 juin 2020

[26] COVID-19 : au plus près de la vérité. Vaccins., Mondialisation.ca, Dr Pascal Sacré, 2 août 2020

[27] COVID-19: au plus près de la vérité – Hydroxychloroquine (HCQ), Mondialisation.ca, Dr Pascal Sacré, 29 juillet 2020

[28] Médicaments effets secondaires : la mort, les laboratoires nous trompent. John Virapen, le cherche midi éditions, 2014

[29] La vérité sur les compagnies pharmaceutiques, comment elles nous trompent, comment les contrecarrer, Marcia Angell, MD, ancienne rédactrice en chef du New England Journal of Medicine, traduction en français, les éditions le mieux-être, 2005.

[30] COVID-19 : le côté obscur de la science révélé, Mondialisation.ca, Dr Pascal Sacré, 26 mai 2020

[31] Top Pain Scientist Fabricated Data in Studies, Hospital Says, 11 Mars 2009

[32] Du Nujol au Tamiflu : la guerre menée par l’industrie pharmaceutique contre nos santés, Mondialisation.ca, Dr Pascal Sacré, 16 juin 2010

[33] l’affaire des Couveuses de la Mort et le début de la Guerre du Golfe

[34] COVID 19 – Contrat de l’OMS avec la société de relations publiques Hill & Knowlton

= = =

Notre page « Coronavirus : guerre biologique contre l’humanité »

 


Dictature sanitaire outil du N.O.M

Coronavirus SRAS-CoV-2 ou CoV19… Une expérience d’ingénierie sociale planétaire… Son but ? Puçage, eugénisme et dictature technotronique (Résistance 71 )

Posted in 11 septembre, 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé, santé et vaccins, sciences et technologies, société des sociétés, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , on 6 avril 2020 by Résistance 71

 

 

“La propagande ne cessera jamais d’exister. Les esprits intelligents doivent comprendre qu’elle leur offre l’outil moderne dont ils doivent se saisir à des fins productives, pour créer de l’ordre à partir du chaos.”

(Dernier paragraphe du livre d’Edward Bernays “Propaganda, comment manipuler l’opinion en démocratie”, 1928)

Bernays a tout dit en un paragraphe conclusif qui résume ce petit bouquin de 109 pages, ce qui nous amène à dire une chose néanmoins : oui la propagande existera toujours… en société étatico-capitaliste. Elle est un instrument essentiel de sa survie, mais dans une société des sociétés ayant aplati non pas la “courbe des stats du corona” mais la pyramide du pouvoir en dissolvant de nouveau le pouvoir en son corps social, elle n’aura absolument plus aucune raison d’être. L’affirmation de Bernays ne tient que dans le paradigme illusoire de la division et du chaos fabriqués. Notons au passage également que la devises “Ordo ab Chao” est la devise… du Nouvel Ordre Mondial. Bernays, neveu de Sigmund Freud, et comme tant d’autres scientifiques, faisait partie du sérail. Un grand esprit ayant malheureusement mis son talent au service de la pourriture élitiste, mort au grand âge de 104 ans. On ne peut pas comprendre le monde d’aujourd’hui sans étudier ces esprits de l’ombre œuvrant ou ayant œuvré pour l’idéologie de la domination. Connaître son ennemi dans ce monde de folie pure, c’est déjà 50% au moins de la victoire…
Si la crise du coronavirus est réelle, elle n’en est pas moins surgonflée à des fins propagandistes et de contrôle social. Pas convaincu(e)s ?… Lisez la suite et tous les liens corollaires. Nous ne détenons pas la vérité. Nous ne sommes que des poteaux indicateurs, parfois des techniciens de surface, on dépoussière c’est tout.

~ Résistance 71 ~

 

 

La grande expérience d’ingénierie sociale planétaire : le coronavirus SRAS-CoV-2

 

Résistance 71

 

6 avril 2020

 

Le monde tel qu’on le connaît est virtuellement à l’arrêt. Des milliards de personnes dans le monde entier sont sous les effets d’un confinement plus ou moins drastique selon les pays. Au delà de la tragédie pour les familles des personnes décédées, il n’y a plus un endroit sur terre qui ne soit pas affecté d’une manière ou d’une autre par cet évènement : le déferlement d’une nouvelle maladie, jusqu’ici inconnue, se propageant par contagion due à un nouveau coronavirus, le SRAS-COV-2, une espèce dite mutante proliférant chez une espèce de chauve-souris chinoise et qui serait passée de l’animal à l’humain via un marché de grossistes alimentaires de la ville de Wuhan en Chine en novembre 2019. C’est ce que nous dit du moins la “version officielle” des faits supposés.

Le virus dont la période d’incubation est de deux semaines ou plus (ce qui est très long pour un coronavirus), provoque une forte fièvre, des troubles aigus de la respiration et est particulièrement dangereux d’après les statistiques officielles, pour les populations plus âgées (moyenne d’âge des décès en Italie est de 78 ans), les patients souffrant de maladies multiples (plus de 50% des victimes décédées en Italie et positives au CoV19 avaient 3 ou plus maladies annexes comme facteurs de co-morbidité) même si des personnes plus jeunes sont infectées et décèdent en bien moins grand nombre. En Italie, le point chaud européen pour la maladie selon les “statistiques”, le taux de mortalité des patients qui n’ont été infectés que par le CoV19 et rien d’autre est de 1,7%, cela ne représentant que 12% environ des décès imputés au même virus. 

De par le monde les chiffres sont aussi sauvages qu’une horde de mustangs dans les grandes prairies, on nous parle de taux de mortalité allant de 0,98% en Corée du Sud à 10% en Italie, en passant par un 4% en Chine et 2% en France et 1,7% aux USA et soudainement bien plus, tout cela pour un même virus.

Il est important à notre sens de toujours prendre ces chiffres avancés avec les pincettes qui s’imposent dans la mesure où il y a autant de critères d’analyse de données qu’il y a de pays semble t’il…

Quoi qu’il en soit, il y a 3 façons de concevoir l’origine de cette maladie :

  • Le CoV19 est une occurence naturelle. Les virus existent, naissent, meurent (question intéressante: un virus est-il un être vivant ?…), mutent et font partie de la nature. Les conditions de passage d’un tel virus de l’animal à l’humain existaient à Wuhan comme ailleurs. Cela s’est déjà produit à maintes reprises dans l’histoire humaine, ceci n’est qu’une anecdote supplémentaire, un blip sur le radar de l’histoire de la planète et accessoirement de l’humanité.
  • Le CoV19 est le résultat d’une recherche en manipulation génétique de laboratoire médical. Sa “fuite” vers l’extérieur est le résultat d’un accident. Il semblerait que le virus ait pu “s’échapper” du laboratoire P4 (niveau 4 en biohazard sécurité) de la ville de Wuhan, point de départ de la pandémie.
  • Le CoV19 est le résultat d’une recherche en manipulation génétique à des fins d’armement biologique militaire américain ayant impliqué le développement du virus dans des laboratoires universitaires sous financement militaires, notamment à l’université de Caroline du Nord entre 2006 et 2015 et sa mise sous forme d’armement militaire dans les laboratoires externes du Pentagone comme en Ukraine et en Géorgie. Le virus a ensuite été volontairement lâché sur le marché de Wuhan, impliquant ainsi la Chine.

L’une de ces trois versions est correcte. Nos lecteurs auront compris au fil de nos traductions et publications que nous pensons la 3ème version être la bonne, ceci n’engage bien entendu que nous, mais nous sommes loin d’être les seuls à le penser et le dire. 

Bien des pistes mènent à ce nouveau “faux-drapeau”, véritable attaque contre l’humanité et il ne fait nul doute que si celle-ci sort enfin de ce cauchemar, “l’affaire du CoV19” aura ses analystes en profondeur de la même manière que les évènements du 11 septembre 2001 ont les leurs. Ce seront sans doute du reste, les mêmes… amenant les réflexions et les analyses pertinentes, les trolls d’usage et toutes les histoires de couverture possible et imaginables de la part des gouvernements, si toutefois ceux-ci survivent ce marasme à venir.

Ceci est une perspective envisageant ce qui a pu se passer en amont et à l’instant de la mise en marche de l’évènement. Regardons un peu les causes directes de celui-ci et ici, un parallèle avec le 11 septembre est particulièrement judicieux semble t’il…

Quelle que soit l’idée que chacun puisse avoir sur l’origine des attentats du 11 septembre, il est indéniable que cet évènement a eu des répercussions mondiales depuis près de 20 ans maintenant. Une “guerre contre le terrorisme” fabriquée qui a embarqué l’occident conquérant, emmené par l’empire anglo-américano-sioniste, dans un “choc des civilisations” préalablement planifié par certains idéologues, choc soi-disant “inévitable” entre le monde occidental et le monde musulman. Il y a eu un monde d’avant le 11 septembre et un monde après le 11 septembre 2001.  Il en sera de même pour le coronavirus CoV19.

Le 11 septembre a vu la création internationale du croquemitaine barbu islamo-fasciste. Médias à la botte, agences de “relations publiques”, think-tanks, gouvernements et autres lobbies de la pensée ont mis les bouchées doubles pour faire croire qu’un barbu islamiste se cachait sous chaque plumard en occident. Que l’ennemi barbichu si envieux de nos “libertés”  ne rêvaient que de nous éparpiller aux quatre vents ou de nous égorger, que nous devions porter le fer chez l’ennemi si on ne voulait pas vivre bientôt sous la charia, l’empire se lançant dans une vaste campagne d’anéantissement de régimes politiques de fait hostiles aux diktats anglo-américains, de leur redécoupage du monde et sur la manne pétrolière et gazière. Nous parlons ici dans l’ordre chronologique  de l’Afghanistan (2001 à aujourd’hui), de l’Irak (2003 à aujourd’hui), du Soudan (2005 à aujourd’hui, bien que la guerre au Soudan dure depuis 1983 en fait et s’articule en plusieurs épisodes), de la Libye (2011 à aujourd’hui), de la Syrie (2011 à aujourd’hui), l’Iran étant la dernière cible et le plus gros morceau de la région à faire tomber sous l’effet domino impérialiste.

Dans les pays occidentaux, plusieurs vagues d’attentats supplémentaires (faux-drapeaux ou pas selon ce que l’on adhère ou pas aux version officielles…) ont forcé des législations liberticides dont le Patriot Act de 2001 après le 11 septembre aux Etats-Unis est le modèle de tous. Tout ceci a forcé des changements de comportements et d’attitudes dans les populations. En y regardant de plus près, on se rend vite compte que toutes ces lois et mesures liberticides n’influent en rien sur l’occurence ou non des actions terroristes qui ont toujours sporadiquement lieu, le plus souvent dans des moments de détresse des gouvernements posant toujours la question d’une “utilité concertée voire fabriquée” ?… Non, dans la très vaste majorité des cas, les lois liberticides, les états d’urgence proclamés ne font qu’aider les gouvernements à mieux contrôler les populations dans des périodes où ces mêmes gouvernements se livrent à des destructions sociales massives, livrant des nations entières et leurs services publics aux harpies du capitalisme financier ultralibéral transnational, suscitant gronde, fronde et rébellion chez les peuples opprimés et plus facilement matées sous couvert de lois martiales et d’états d’urgence. De plus, cela donne du grain à moudre pour les “experts” en ingénierie sociale qui possèdent maintenant un accès direct à de gigantesques terrains d’expériences sociales sur des populations manipulées et aux abois.

Reportons-nous maintenant à ce qui se passe en France et ailleurs sur la planète durant cette pandémie de coronavirus. La France, et une bonne partie du monde sont “confinées”. Tout ou presque s’est arrêté. On demande aux gens de rester chez eux, de ne sortir que sous autorisation (Ausweis bitte !… Brrrrr…), de dénoncer les “comportements déviants” en instituant une forme de “honte sociale” pour ceux ou celles qui prendraient tout ça trop à la légère. On nous impose des comportements de sécurité sanitaire étiquetés “distanciation sociale”, gardez vos distances avec cet autrui potentiellement malade, infecté, coupable… Vilipendez ceux qui ne respectent pas la distance de sécurité en attendant que la police du comportement fasse ce boulot pour laquelle elle sera créée. Dénoncez les comportements déviants ! Soyez de bons citoyens de ce “meilleur des mondes “ en marche et vous serez socialement récompensés. Surtout ne loupez pas un soir à 20h00 pile d’aller sur votre balcon applaudir les personnels sanitaires, ces nouveaux soldats au front, ces héros et experts dont nous n’oserions pas douter.

Toutes ces nouvelles normes induites, soi-disant “spontanées”, naissant de la nécessité et de l’urgence peuvent en fait être vues comme des caractéristiques, des rouages d’une gigantesque expérience d’ingénierie sociale planétaire. Nous sommes des rats de laboratoire. On nous a injecté avec une saloperie quelconque, on nous met dans des situations de stress exponentielles et on nous observe à la loupe, individuellement et collectivement tout en modifiant nos comportements. La question essentielle des ingénieurs menant cette expérience in vivo est celle-ci: Jusqu’où peut-on pousser le bouchon avant que ça se fissure, que trop soit trop ou que ça pète ? Pensons à cela comme à une expérience de Milgram à l’échelle planétaire… Vous savez cette expérience scientifique qui voyait des étudiants recrutés pour un projet bidon, administrer à la commande d’une autorité “experte”, des décharges électriques fictives sur un sujet (acteur faisant partie de l’équipe de test) lorsque celui-ci répondait mal à une question. Ils ont planté le décors, induit le stress (physique, le virus et psychologique, le confinement) et donnent des ordres qui seront de plus en plus drastiques, dans le même temps ils analysent les réponses. Qui obéit, qui se couche, qui se rebelle et pourquoi ? Comment ajuster le curseur pour que la vaste majorité des gens obéissent aux injonctions des autorités “expertes” ? Le but ? Analyser et perfectionner un système de contrôle planétaire pour les populations et mettre en place des rouages de contrôle social en maintenant les gens dans la peur constante, mais une peur ayant générée de nouvelles normes sociales acceptées de la vaste majorité. Il faudra ensuite gérer les “asociaux”, ce que faisait le goulag et les hôpitaux psychiatriques soviétiques. On y viendra, graduellement.

Tout cela n’a pas disparu, mais n’est qu’en mutation constante… comme un virus. L’État, le capitalisme et son diktat marchand ne sont que des virus, pire, des parasites qui drainent l’énergie et le bien-être de l’humanité. ls sont anti-humains par essence.

De la même manière qu’il y a un “avant” et un “après” 11 septembre 2001, il y aura un “avant” et un “après” CoV19… Ceci est en train d’être imprégné dans notre inconscient jour après jour, semaine après semaine d’obéissance servile aux “autorités” ordonnant le confinement.

Alors obéissance aveugle à la nouvelle norme sociale ou désobéissance, dissidence à cette ingénierie sociale bientôt associée à l’entité technotronique pour une dominance totale ? Il faudra bientôt choisir et plus tôt que beaucoup ne le croient.

Se préoccuper de sa santé et de celle d’autrui ne veut pas dire d’accepter la dictature technotronique sécuritaire et sanitaire et n’empêche en rien de rejoindre la résistance ! Une méga-crise économique va déferler sur le monde dans les mois à venir. Cette crise sanitaire du CoV19 a aussi été mise en place pour servir de bouc émissaire. Tout sera blâmé sur le virus et rien sur les pauvres oligarques d’un capitalisme moribond qui passeront de fait pour rien d’autre que des victimes à qui on garantira le sauvetage, une fois de plus alors que des millions seront à la soupe populaire ou son équivalent mortifère. 

Tout ceci servira à faire passer des mesures de contrôle encore plus draconiennes sur des peuples abasourdis, KO debout dans les cordes. L’effet rasoir à trois lames: le CoV19 prépare le terrain et commence le chaos voulu, la crise économique accentue ce chaos avec les résidus de la crise sanitaire, l’oligarchie arrive sur son cheval blanc avec sa solution toute prête à faire accepter par les gens, la dictature technotronique sans argent liquide et au contrôle social draconien, pour sauver l’humanité à coup de 5G, de nanotechnologie, d’IA, de puce RFID et de vaccins bouillons de culture pour gérer le bétail humain à l’échelle planétaire.

La véritable question est: Accepterons-nous tout ça au prétexte que, comme d’habitude, c’est “pour notre bien” ? Quand assez est-il assez ? En 1994, les peuples natifs du Chiapas mexicain, descendants des peuples Mayas ont clamé haut et fort leur ¡Ya Basta!

Ils continuent aujourd’hui 26 ans plus tard.  Notre tour est venu ! Tendons les mains et rejoignons le cercle de l’humanité vraie, celui de la société des sociétés. Devenons qui nous sommes, vraiment.

En 1990, lors de la crise d’Oka (au Québec) qui vit les Mohawks se révolter contre l’accaparement illégal de leurs terres sacrées (il s’agissait en l’occurence d’un site ancestral funéraire) pour agrandir un … club de golf, une mère de clan de la nation mohawk déclara ceci aux colons venus aux “nouvelles” et devant les caméras de la TV locale : “Regardez bien ce qui se passe ici, parce que quand ils en auront fini avec nous… ce sera votre tour !” Tous les peuples colonisés et opprimés savent quelque chose que nous refusons, bien à tort, de voir. Toutes les crises présentes et à venir donneront raison à cette ancienne… si nous ne faisons rien pour y mettre un terme une bonne fois pour toute.

Quelques saines lectures ci-dessous pour renforcer votre système immunitaire psychologique et vous aider à lutter contre le Nouvel Ordre Mondial dictatorial qui s’en vient avec ses bottes de sept lieux.

Notre dossier “Coronavirus, CoV19”

« Coronavirus, l’oligarchie lance une guerre biologique contre les peuples » (Résistance 71 )

“Propaganda, comment manipuler l’opinion en démocratie”, E. Bernays

Que faire ? (Résistance 71)

Petits précis sur la société et l’État (Résistance 71 )

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir !

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 


Tout le pouvoir aux ronds-points !…

 

Coronavirus ou comment façonner le changement social par la terreur (James Corbett)

Posted in 3eme guerre mondiale, actualité, crise mondiale, guerres hégémoniques, guerres imperialistes, ingérence et etats-unis, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, police politique et totalitarisme, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 4 avril 2020 by Résistance 71

 


Les choses qu’on ne peut pas dire sur le CoV19…

 

Comme d’habitude, un James Corbett analytique, fin et pertinent. Nous partageons totalement son analyse, c’est pourquoi nous avons pris la peine de la traduire malgré sa longueur. Elle est du reste la meilleure que nous ayons lue sur le sujet du CoV19 et sa pandémie fabriquée.

Nous reviendrons sur ce qu’il analyse et avec un recul maintenant établi, avec ou sans confinement, nous analyserons la situation de cette affaire du coronavirus à l’aune de tout ce que nous avons dit, traduit et publié depuis 10 ans… Beaucoup à dire effectivement, nous le ferons le plus brièvement possible.

A suivre donc…

~ Résistance 71 ~

 

« La manipulation consciente, intelligente, des opinions et des habitudes organisées des masses joue un rôle important dans une société démocratique. Ceux qui manipulent ce mécanisme social imperceptible forment un gouvernement invisible qui dirige véritablement le pays. »
« L’Homme étant de nature grégaire, il se sent lié au troupeau, y compris lorsqu’il est seul chez lui, rideaux fermés. Son esprit conserve les images qu’y ont imprimées les influences sociales… »

~ Edward Bernays (neveu de Sigmund Freud), extraits de « Propaganda, comment manipuler les opinions en démocratie », 1928 ~

 

Les choses que vous ne pouvez pas dire au sujet du coronavirus

 

James Corbett

 

28 mars 2020

Source:

https://steemit.com/coronavirus/@corbettreport/the-things-you-cannot-say-about-coronavirus

 

~ Traduit de l’anglais par Résistance 71 ~

 

Avril 2020

 

Pssst. Vous là-bas.

Oui, vous….

Etes-vous intéressé de parler de… choses ? Vous savez, le genre de choses dont on n’a plus le droit de parler ?… Depuis le euh… huuuum, vous savez… “l’évènement” ? ”The Event« ?

Vous avez envie ? Super. Mais bon, vous avez sans doute remarqué que les choses sont un peu barjot dehors. Ainsi on vous arrachera probablement la tête si vous osez parler, suggérer, que les choses sont pas très ok avec le “nouveau normal”…

Il semblerait que les nouvelles normes sociales et tabous culturels qui se sont imposés ces dernières semaines ont aussi créé une sorte de crime de la pensée : certaines choses dont on ne doit pas parler de peur d’être virer de la “bonne” société polie… voire pire.

C’est pourquoi il est d’une importance vitale de parler de toutes ces choses qui nous préoccupent avant que ces crimes de la pensée socialement policés ne deviennent de véritables crimes. Je suis certain que vous savez que si ces nouvelles “normes sociales” ne sont pas opposées, si personne ou si peu ne manifeste haut et clair une forme de ressentiment et de dissidence, le faire sera bientôt impossible.

Permettez-moi donc d’exprimer mes propres crimes de la pensée ; mais soyez avertis : je peux vous assurer que vous trouverez au moins quelques unes de ces idées être offensantes. Vous serez en désaccord, peut-être même fortement, cela pourra même vous mettre en colère.

La véritable question est celle-ci : Qu’allez-vous faire avec ceux et celles qui manifestent une opinion avec laquelle vous n’êtes pas d’accord ? Allez-vous engager le dialogue avec ces personnes ? Ou allez-vous demander à des agents de l’État d’effacer leur discours et pensée de l’internet et les faire mettre en cage pour leurs crimes de la pensée ?…

Quoi qu’il en soit, j’ai déjà commis un crime de la pensée à de nombreuses reprises ces dernières semaines. Je ferai donc aussi bien de partager tout cela avec vous. Etes-vous prêts ? Allons-y…

1 – Nous avons rencontré l’ennemi… c’est nos voisins

Les gens s’imaginent que quand la tyrannie pratique va arriver, elle sera imposée et mise en place par la police et l’armée. Flash info : la tyrannie pratique est déjà là et elle est mise en place par vos voisins, Marcel Kronenbourg et Zézette Mamanfoot.

Vous voulez une preuve ? Toutes ces lignes de délation mises en place ville après ville, état après état, dans le monde entier pour aider les “bons citoyens” à cafeter sur leurs voisins ou collègues qui ne pratiquent pas la juste “distanciation sociale” ?

[NdT: Dans l’Allemagne nazie et la Russie soviétique stalinienne, la Gestapo et la GPU et autres “Directorats de la Sécurité Intérieure”, ne passaient pas leur temps à courir partout et à chercher les dissidents et opposants politiques… 75% du boulot était fait par la population, par délation, les services de répression ne faisaient essentiellement que centraliser les infos, analyser et procéder par recoupements, pour envoyer la meute de chiens au bon endroit… Rien n’a changé…]

Et oui. Ce ne sont plus justes ces gens qui hurlent par les fenêtres à Brooklyn. Maintenant, dès que vous voyez quelqu’un qui est à moins de 2 mètres de quelqu’un d’autre, c’est votre devoir de bon citoyen de ce “meilleur des mondes” et meilleur nouvel ordre mondial de les rapporter aux autorités de façon à ce que Big Brother s’en occupe. Restez persuadés qu’une carte électronique de “bon comportement social” est en train d’être concoctée pour chaque zone légale et le pouvoir de “qui de droit” établit une liste de qui est un bon citoyen et qui ne l’est pas (Good job, Minnesota!).

Dès le moment où nous sommes tous à 100% d’accord que l’idée que quelqu’un puisse physiquement approcher quelqu’un d’autre en cette période de coronavirus 2020 est mauvaise et puisse être accusé de tentative de meurtre ou même de meurtre pour leur acte de haine, est quand même le signe que peut-être, peut-être hein ? Entrons-nous en territoire plus que dangereux.. La Stasi de la distanciation sociale devenant les shériffs de notre nouveau cauchemar d’état policier me met mal à l’aise, mais dites que je suis fou…

2 – Les médecins sont les nouveaux soldats

Quand se sont produits les attentats du 11 septembre, il y a eu une augmentation notoire de la propagande glorifiant l’armée américaine. Cela ne veut pas dire qu’une telle propagande n’existait pas auparavant, mais ce n’était rien en comparaison de celle qui s’est mise en branle suite “au jour qui a tout changé”. Oui l’idolâtrie du héros de guerre ancien combattant est une des merveilles que l’Âge de la Terreur a mis en place.

Donc, si cette pandémie est le nouveau 11 septembre (NdT: avec toute la suspicion identique d’avoir été perpétrée par.. en fait la même clique du pouvoir profond), alors quel est le nouveau culte du héros ? Cela devrait être évident maintenant : les médecins sont les nouveaux soldats. Maintenant nous avons un “devoir” de respecter et de vénérer les braves soldats de la santé qui sont au front dans cette nouvelle guerre… sinon, faites face à toujours plus de discrimination et de mise à l’écart.

Vous avez peut-être remarqué ce phénomène des plus intéressant qui se répand dans le monde. J’appelle ça “le phénomène des applaudissements totalement spontanés de balcon”. Oui, oui, sorti de nulle part, tous les gens sous confinements ont décidé de montrer leur appréciation à tous ces vaillants docteurs et infirmières participant à cette lutte héroïque, en allant tous sur leur balcon à un temps donné pour les applaudir. Et non, ce phénomène spontané n’est pas apparu dans un ou deux pays, ou trois ou quatre, mais apparemment dans tous les pays du monde. Juste comme ça, hop d’un seul coup d’un seul. Un truc de l’esprit du temps (Zeitgeist) sans aucun doute…

Maintenant pardonnez-moi d’être hors circuit, mais comme vous le savez sans doue, la folie du coronavirus n’a pas encore vraiment gagné le Japon (NdT: James Corbett est un Canadien qui vit au Japon depuis plus de 15 ans), alors je ne sais pas vraiment comment les gens décident de la bonne heure pour aller applaudir sur leur balcon. C’est fait par vote ? Que se passe t’il si je suis quelques minutes en retard ? Est-ce que les gens vont penser que j’applaudis quelque chose d’autre ? Quelle est l’étiquette de comportement exactement pour tout ça ?…

Voici encore un de mes crimes de la pensée : je trouve ces effusions glauques et déconcertantes. Je trouve malsaine la glorification des médecins et des infirmier(e)s. Non pas parce que je pense que ce sont tous des charlatans, pas parce que je pense qu’ils sont tous pourris, pas parce que je ne suis pas reconnaissant de leur travail bien fait pour certain(e)s, pas parce que je ne reconnais pas l’énorme stress auquel ils sont soumis en ce moment ; mais parce que cette adoration socialement construite sera utilisée pour pousser un agenda similaire à celui que fut celui de l’adoration des bidasses et des héros de guerre, l’adoration des anciens combattants poussant un agenda militariste depuis l’après 11 septembre jusqu’à aujourd’hui.

Cette fois-ci, on nous demande de glorifier les médecins et les infirmières parce que ce sont ces mêmes experts dont l’autorité ne peut pas être mise en question qui vont vous piquer avec le vaccin. Vous savez… Le vaccin, celui qui mettra un terme à 18 mois ou plus de siège psychologique auquel nous sommes tous soumis.

Quoi ? Vous questionnez toujours les vaccins ? Vous osez toujours défier l’autorité de ces brave médecins et infirmières qui risquent leurs vies pour nous ? Vous ne pouvez pas dire ça, vous le révoltant théoricien du complot et de la pensée criminelle, oui vous ! Soyez honnête, vous savez que cette poussée extrême arrive. Ils sont en train de forcer le public à adhérer à tout ça avec toutes ces sessions d’applaudissement depuis les balcons, Sessions tout à fait “spontanées” il va sans dire. Alors, excusez-moi si je ne participe pas.

3 – Je ne crois pas un seul de ces chiffres qui sont rapportés au sujet de cette contagion

Je suis toujours sidéré par l’attention que porte des être humains autrement sains de corps et d’esprit aux derniers chiffres rapportés par cette agence sanitaire ou une autre au sujet de ce fléau du CoV19. Les gens parlent en termes techniques comme s’ils avaient étudié l’épidémiologie toute leur vie alors qu’en vérité ils ne font que régurgiter ce qu’ils ont vu sur CNN [ou autres merdia de masse] ou ce qu’ils ont entendu du dernier gouverneur Duschnock en charge lors de sa dernière conférence de presse.

Que devons-nous faire alors de toutes ces anomalies remarquées dans le taux de mortalité du CoV19 entre les différents pays ? Pourquoi le taux de mortalité de ce virus est-il de 10% en Italie alors qu’il est de l’ordre de 4% en Chine (NdT: et 0,98% en Corée par exemple et de l’ordre de 2% en France) et que veut dire ce que les “experts” assènent, de ces 70% de l’humanité qui seront infectés par le virus ?

Et pendant qu’on y est, pourquoi ne posons-nous pas quelques questions tout aussi pertinentes comme : De quelle couleur est la lièvre de Pâques ? Combien d’anges peuvent danser sur une tête d’épingle ? et surtout le fromage dont est fait la lune est-il si bon ?

Comme je l’ai démontré il y a quelques semaines, les méthodes de diagnostique de la maladie diffèrent tellement de pays à pays que faire des comparaisons entre ceux-ci n’est même pas comme comparer des pommes et des oranges, mais comme comparer des pommes et des orycteropus. Que dire d’un diagnostique d’un type particulier d’infection virale avec un CT Scan ? Comment peut-on faire confiance à des chiffres générés par de telles méthodes de diagnostique ?…

Tout ça rendrait le calcul d’un taux de mortalité pour cette maladie suffisamment problématique, mais pour empirer les choses, nous n’avons même pas un chiffre précis et sûr du nombre de personnes décédées du CoV19. Prenez l’exemple de l’Italie (10% si on prend le chiffre officiel, c’est ce qu’on nous dit), ce chiffre représenterait Ô combien la maladie est mortelle.

Mais il y a des problèmes avec ces chiffres. Comme l’a récemment révélé le professeur Walter Ricciardi, conseiller scientifique du ministre de la santé italien, “La façon dont nous codifions les décès dans notre pays est très généreuse dans le sens où toutes les personnes qui meurent à l’hôpital avec le coronavirus sont étiquetées comme décédées du coronavirus.

Alors combien de personnes rapportées “décédées du CoV19” ont-elles été effectivement enregistrées comme décédés du CoV19 ? Seulement 12%. Plus encore, d’après le rapport du gouvernement italien, la moitié de ceux qui sont décédés avaient trois autres maladies ou plus au moment de leur décès. Près de 80% avaient au moins deux autres maladies comme facteur de co-morbidité avec lesquelles ils/elles luttaient lorsque ces personnes sont décédées. Seulement 1,7% de tous ceux et celles qui sont morts n’avaient que le CoV19 comme maladie au moment de leur mort.

Mais pourquoi écouter le théoricien du complot James Corbett ou ces idiots conseillers sanitaires du gouvernement italien sur ce sujet ? Et bien, je ne suis pas le seul à être suspicieux de ces chiffres officiels. Il se trouve que le groupe de recherche “Our World in Data” a tenté d’enregistrer des chiffres du coronavirus et qu’ils ont arrêté d’utiliser les chiffres de l’OMS parce qu’ils “ont trouvé beaucoup d’erreurs dans les données publiées par l’OMS que nous avons compulsées dans leurs rapports de situation quotidiens”.

Et John Ioannides, dont les auditeurs du Corbett Report se souviennent avec son article devenu culte de 2005 « Why Most Published Research Findings Are False« — a récemment questionné le fait de savoir si la réponse actuelle à la crise du CoV19 est en fait “un fiasco en cours”, comme il observe : 

“Les données collectées jusqu’ici sur le nombre de personnes infectées et comment évolue l’épidémie sont pour le moins non fiables. Etant donné le peu de tests effectué, des morts et probablement la vaste majorité des infections dues au SRAS-CoV-2 ne sont pas dépistées. Nous ne savons pas si nous échouons à capturer ces infections par un facteur de 3 ou de 300. Trois mois après la première contagion, la plupart des pays, incluant les Etats-Unis, n’ont pas la capacité de tester un grand nombre de gens et aucun pays n’a de données fiables sur la prévalence du virus dans un échantillon représentatif pris au hasard d’une population.”

Après que soit passée cette folie actuelle, les gens vont voir cette acceptation aveugle du public de ces pratiques de la même façon que nous regardons l’acceptation aveugle des pratiques du passé comme les saignées et autres méthodes médicales bouffonnes des siècles derniers.

4 – Le décès d’une personne de 91 ans est une tragédie familiale et non pas un évènement de portée internationale

Ok, bon vous voulez toujours prendre sérieusement tous ces chiffres bidons ? Alors regardons le rapport italien sur les gens qui meurent AVEC (et non pas DU) le coronavirus CoV19. ( Italian report)

Le rapport nous dit que l’âge moyen de ceux qui sont décédés avec (et non pas du) CoV19 est de 78 ans. Pour mettre ce chiffre en perspective, l’espérance de vie moyenne en Italie et de 82,8 ans.

Cela veut dire que ceux qui meurent AVEC la maladie sont très proches de l’âge moyen d’espérance de vie et n’oublions pas non plus que la plupart souffraient d’autres maladies en plus du CoV19. Je me risque à dire qu’une panique similaire pourrait se produire avec n’importe quelle épidémie virale en circulation si cela était rapporté de la même façon que l’est celle du CoV19.

Comme nous commettons des crimes de la pensée ici, soyons clairs et nets : “Des personnes âgées malades avec de multiples complications meurent après avoir contracté une maladie respiratoire.” Ceci n’est pas une nouvelle. C’est un fait établi de la vie quotidienne.

Mais c’est devenu une info digne de ce nom. J’ai pris des notes sur la façon dont les merdias canadiens ont couvert cette panique de la pandémie et j’ai vu un segment de l’info nationale se concentrer au sujet d’une vieille dame de 91 ans dont a vie fut écourtée au contact du coronavirus dans une maison de retraite. Il était impliqué que la vie de cette dame “fut tragiquement  écourtée par le coronavirus et pour rendre pire les choses, sa fille ne fut pas autorisée à aller au service funéraire de sa mère parce que le Canada est en période de confinement. Je ne sais pas si c’est moi qui ai perdu contact avec la réalité ou si ce sont les autres, mais laissez moi répéter une fois de plus : ceci n’est PAS une info digne d’un journal télévisé, c’est un fait tragique quotidien.

Ne me faites pas dire ce que je n’ai pas dit… Bien entendu que ce type d’évènement est une tragédie pour la famille impliquée. Toutes mes condoléances vont à ceux qui doivent en souffrir en de telles circonstances. Mais ce n’est pas là-dessus qu’est suspendue l’existence même de notre civilisation. On n’arrête pas toute l’activité de production des êtres humains sur la planète, faisant s’effondrer l’économie, envoyant des millions et des millions de gens au chômage, mettant en place le confinement tout en commençant à parler de vaccination obligatoire, de passeports internes et autres abrogations des droits et libertés humaines essentiels, sur cette base.

En fait, si je devais mourir à l’âge de 78 ans à cause d’une maladie respiratoire virale, avec la cohorte de mes comparses du même âge, je peux garantir que je serai particulièrement furieux de savoir que les guignols du pouvoir utiliseraient ma mort pour mettre un terme aux libertés que j’ai passées ma vie à défendre. C’est écœurant.

Mais que dire de ces jeunes gens qui meurent de la maladie ?! allez-vous demander. Juste. Une fois de plus, en accord avec les rapports officiels (qui rappelons-le, ne devraient pas être crus…), il y a des gens de moins de 78 ans qui meurent aussi de la maladie, même si c’est en nombre bien moins important. Et d’après les “modèles” des “experts” (qui rappelons-le, ont évidemment raison sur tout…), il pourrait bien y avoir des centaines de milliers de morts supplémentaires avant que cette pandémie ne termine sa folle course.

Et bien, ceci m’amène à mon ultime crime de la pensée :

5 – L’idée que la maladie et la mort soient non naturelles ou évitables est anti-humain

Les gens meurent, point barre.

Des fois ils meurent dans des accidents de voitures, des fois ils meurent dans des incidents liés à leur boulot, des fois ils meurent de vieillesse, des fois ils meurent sous des circonstances plus que questionables, en essayant de faire la lumière sur une information sur laquelle le gouvernement et l’état profond ne sont pas confortables et oui, parfois ils meurent d’une maladie respiratoire pendant une pandémie virale.

Je vais aller plus loin : Notre mortalité fait de nous qui nous sommes. Les humains sont maudits et bénis de la connaissance de leur propre destinée. Personne n’en sortira vivant. Ainsi la question de savoir ce que nous faisons de notre vie devient absolument primordiale.

Mais de plus en plus, la mort est soustraite à la vie. Nos anciens sont envoyés dans des “maisons” pour s’éteindre ainsi nous n’avons pas à faire face à la réalité du vieillissement. L’industrie des pompes funèbres est proprette et aseptisée. La mort est devenue une abstraction. Quelque chose qui se passe quelque part, arrive aux autres gens, mais sûrement pas à nous.

Mais cette folie pandémique semble être fondée sur la notion que la maladie et la mort sont évitables. Que nous les avons sans aucun doute conquises, ou au moins qu’aucune nouvelle maladie ne pourra plus survenir (qu’elle soit fabriquée ou pas) pour déséquilibrer notre équilibre parfait avec la nature. Je veux dire que oui, bien des gens meurent de la grippe chaque année, mais ça ne compte pas. Ce n’est pas nouveau.

Cela ne veut pas dire que nous ne devrions pas travailler à guérir la maladie et à améliorer notre santé, bien au contraire. C’est juste que les crises d’hystérie actuelles semblent presque anti-humaines, comme si nous devrions être capables de transcender notre humanité mortelle.

CJ Hopkins, avec son humour caractéristique, montre du doigt l’absurdité de cette “guerre contre la mort” dans son dernier article en date :

“Nous ne pouvons pas laisser ces semeurs de zizanie russes, ces accélérationistes nazis et ces sympathisants du coronavirus nous induire en erreur. Ils veulent nous convaincre que la mort est certes triste et terrifiante, mais inévitable, naturelle. N’est-ce pas insensible et fou ? Non, nous devons fermer notre conscience à ce non-sens total. Des gens meurent ! Ce n’est pas normal ! La mort est notre ennemi ! Nous devons la vaincre ! Nous devons chasser la mort dans ses derniers retranchements et la neutraliser ! L’enfumer de son terrier et la pendre haut et court comme nous l’avons fait avec Saddam !…”

Je ne sais pas pourquoi considérer la mort comme partie intégrante de la vie devrait être considéré comme étant controversif. Je ne sais plus. J’ai peut-être pété un câble. Tout ce que je sais est que l’espace pour exprimer le désaccord sur ces sujets est en train de disparaître très rapidement. Il est temps pour ceux d’entre nous qui peuvent supporter le crime de la pensée de faire le cercle des chariots. La police de la pensée se rapproche dangereusement.

Alors peut-être que vous n’êtes pas d’accord avec moi. Peut-être avez-vous été offensé par ce que j’ai dit. Peut-être avez-vous vos propres crimes de la pensée que vous avez peur d’exprimer. Mais si nous ne nous engageons pas dans un dialogue au sujet de ces idées maintenant, quelles sont les chances que ces informations soient plus faciles à partager dans le futur ?…

Alors, quel est votre crime de la pensée ? Partagez-le avec la communauté dans les commentaires ci-dessous….

= = =

Notre dossier « Coronavirus, CoV19 »

« Coronavirus… création de laboratoires militaires »

 


Le nouveau visage de la tyrannie

Statistiques coronavirus et décès du gouvernement italien (PDF)

Posted in 3eme guerre mondiale, actualité, crise mondiale, documentaire, média et propagande, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , , on 30 mars 2020 by Résistance 71


Stats à l’intersection « mensonges » et « foutus mensonges »

 

Résistance 71

 

30 mars 2020

 

Ci-dessous en format PDF, les statistiques publiées par le gouvernement italien sur les décès de personnes positives au coronavirus. Notez que nous ne disons pas ici que ces personnes sont décédés DU coronavirus, mais qu’elles étaient effectivement infectées au moment de leur décès. Ceci a son importance vous allez voir pourquoi.

Lisez le document en entier. Il est en anglais mais simple à comprendre avec de nombreux graphiques.

En résumé :

Des gens malheureusement décédés en Italie, dans la vaste majorité en Lombardie, l’âge moyen des personnes décédées et testées positives au CoVD19 est de 78 ans avec un pic de décès dans le groupe d’âge 80-89 ans. 29% était de sexe féminin et donc 71% de sexe masculin. La plupart des personnes décédées étaient en parallèle affectées d’une ou plusieurs maladies chroniques ou non. Les statistiques sont les suivantes:

  • 74% de ces personnes souffraient d’hypertension artérielle
  • 30% souffraient de diabète
  • 47% souffraient de problèmes cardiaques divers
  • 23% souffraient de problèmes rénaux
  • 18% étaient des patients de cancer actif dans les 5 ans

De plus, des facteurs de co-morbidité, c’est à dire de plusieurs maladies ayant été causes de décès ne sont pas négligeables chez ces personnes décédées : 51% c’est à dire plus de 1 sur 2 !!… étaient sous un facteur 3 de co-mobidité, c’est à dire présentaient 3 maladies avec le coronavirus, 26% en facteur 2 et 21% avait 1 condition supplémentaire de co-morbidité. Au total donc, en Italie, des personnes décédées et positives au CoVD19 « Caroline du Nord », 98% présentaient des facteurs de co-morbidité allant de 1 à 3 !…

Alors des chiffres, oui… mais tous les chiffres et les bonnes analyses qui vont avec SVP et pas du buzz ne visant qu’à affoler les foules. Merci au gouvernement italien d’avoir publié ces statistiques. Elles aident grandement à comprendre qui si la maladie est certes un problème, on se fout aussi un peu (beaucoup ?…) de notre gueule quelque part…

Les Stats italiennes (PDF)
Italy_Report-COVID-2019_24_marzo_eng

Notre dossier « Coronavirus, CoVD19

MaJ: D’après des médecins italiens, les statistiques concernant les décès potentiellement liés au CoVD19 sont « arrangées ». de fait, seuls 12% des décès peuvent être imputés au virus, 88% des autres décès ayant de nombreux facteurs de co-mobidités. Info (en anglais) ici.