Archive pour coronavirus eugénisme nouvel ordre mondial

Le peuple américain se réveille et défie la dictature sanitaire et les vaccins chimériques

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, politique et social, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , on 7 avril 2021 by Résistance 71

 

 

 

Les vraies raisons pour lesquelles des millions d’Américains vont défier les obligations autour de la COVID et des vaccins

 

Brandon Smith

 

Mars 2021

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-vraies-raisons-pour-lesquelles-des-millions-damericains-vont-defier-les-obligations-autour-de-la-covid-19-et-des-vaccins

 

Je soupçonne qu’une grande partie du public est au moins partiellement consciente lorsqu’elle est poussée ou attirée dans une façon spécifique de penser. Nous avons certainement eu assez d’expériences avec des institutions qui ont essayé de gérer nos pensées au fil des ans. Les gouvernements et les grands médias en particulier ont fait de la fabrication du consentement du public leur priorité absolue. C’est à cela qu’ils consacrent la majeure partie de leur temps, de leur argent et de leur énergie. Toutes les autres questions sont secondaires.

Les médias ne rapportent pas objectivement les faits et les preuves, ils déforment l’information pour planter un récit élaboré dans l’esprit de leurs téléspectateurs. Mais le public n’est pas aussi stupide qu’il semble le croire. C’est probablement la raison pour laquelle la confiance dans les médias a chuté de 46 % au cours des dix dernières années, atteignant cette année un niveau historiquement bas de 27 %.

À l’exception des pics de la saison pré-électorale, les grands médias, de CNN à Fox, en passant par CBS et MSNBC, sont confrontés à des chiffres d’audience désastreux, avec seulement 2 à 3 millions de téléspectateurs aux heures de grande écoute. Il y a de nombreux commentateurs sur YouTube qui ont une plus grande audience que cela. Et si vous passez au crible les bribes de vidéos des médias « main stream » dit MSM sur YouTube, vous trouverez peu de visites et une majorité de personnes ne visitent leurs chaînes uniquement que pour se moquer d’eux.

Les MSM s’efforcent maintenant d’expliquer l’effondrement de son empire, tout en débattant des moyens de se sauver de l’oubli. Le pouvoir du « quatrième pouvoir » n’est qu’une façade, une illusion créée par la fumée et les miroirs. En résumé : Personne (sauf peut-être les gauchistes extrêmes) n’aime les médias corporatifs ou les journalistes et propagandistes activistes.

On pourrait penser que les magnats des médias et les journalistes l’auraient compris depuis le temps. Je veux dire, s’ils acceptaient cette réalité, ils ne se battraient pas autant avec l’idée que personne ne les écoute lorsqu’il s’agit des obligations autour de la Covid-19 et des vaccins. Pourtant, les journalistes s’en plaignent sans cesse ces derniers temps.

En fait, la moitié des reportages que je vois ces jours-ci ne sont pas des analyses factuelles des événements, mais des journalistes corporatifs qui interviewent d’autres journalistes de ces mêmes médias et se plaignent les uns les autres de ce que les Américains sont « trop ignorants » ou « trop conspirationnistes » pour comprendre que les journalistes sont les grands prêtres oints de l’information.

En fait, je trouve cette situation fascinante en tant qu’observateur de l’oligarchie et bien versé dans les mécanismes de la propagande. Le récit fondamental de la culture de contrôle est qu’il y a des « experts » que l’establishment choisit, et puis il y a tous les autres. Les « experts » sont censés pontifier et dicter leur conduite, tandis que tous les autres sont censés se taire, écouter et obéir.

Les élitistes des médias se voient dans le rôle des « experts » et le public dans celui des acolytes dévoués, un fidèle troupeau de moutons. Mais que se passe-t-il lorsque tout le monde commence à ignorer les bergers ?

L’autre jour, je suis tombé sur cette interview révélatrice diffusée par CBS News, concernant un sondage réalisé auprès des Américains, qui montre qu’au moins 30 % d’entre eux refuseront catégoriquement de se faire vacciner contre la Covid-19. L’interview est, pour une raison ou une autre, réalisée par un autre journaliste de The Atlantic qui ne semble pas avoir de références médicales et qui ne comprend pas les données relatives à la Covid-19.

Il convient de noter tout de suite que la discussion elle-même n’aborde jamais les faits réels concernant le virus, la pandémie, les confinements, les mandats ou les vaccins. L’establishment ne cesse de nous dire « d’écouter la science », mais ensuite ils rejettent la science quand elle n’est pas en accord avec leur agenda. Quand les médias dominants vont-t-ils enfin reconnaître des faits comme ceux-ci :

1) Selon de nombreuses études officielles, dont une étude de l’American College of Physicians, le ratio de fatalité de l’infection (ou taux de mortalité) de la Covid-19 n’est que de 0,26% pour toute personne ne vivant pas dans une maison de retraite. Cela signifie que 99,7 % des personnes qui ne sont pas en maison de retraite survivront au virus si elles le contractent.

2) Les patients des maisons de retraite représentent plus de 40 % de tous les décès dus au Covid aux États-Unis. Il s’agit principalement de personnes qui étaient déjà malades et souffraient de multiples pathologies préexistantes lorsqu’elles ont contracté la Covid-19.

3) Les données hospitalières du gouvernement fédéral provenant du ministère de la santé et des services sociaux indiquent que la capacité des lits d’hôpitaux est amplement suffisante aux États-Unis et que c’est le cas depuis l’année dernière. Les patients Covid n’occupent qu’environ 13% des lits d’hospitalisation au niveau national. Les informations diffusées dans les médias sur la surcapacité des hôpitaux due à la Covid-19 sont donc inexactes ou carrément mensongères.

4) Des études internationales, dont une étude danoise publiée par l’American College of Physicians, ont prouvé que le port de masques ne fait AUCUNE différence significative dans la propagation ou le taux d’infection de la Covid-19. Il est intéressant de noter que les États américains où le port du masque est le plus imposé ont également enregistré les taux d’infection les plus élevés.

5) En mars 2020, le chef du NIAID, le Dr Anthony Fauci, a déclaré ceci à propos du port du masque lors d’une interview dans l’émission 60 Minutes :

« À l’heure actuelle, aux États-Unis, les gens ne devraient pas se promener avec des masques…. il n’y a aucune raison de se promener avec un masque. Lorsque vous êtes au milieu d’une épidémie, porter un masque pourrait faire en sorte que les gens se sentent un peu mieux, et il pourrait même bloquer une gouttelette, mais il ne fournit pas la protection parfaite que les gens imaginent, et souvent il y a des conséquences involontaires – les gens continuent à tripoter les masques et ils se touchent le visage. »

6) Sur Twitter, en février 2020, le Surgeon General américain s’est exprimé sur le port de masque :

« Sérieusement, arrêtez d’acheter des masques ! Ils ne sont PAS efficaces pour empêcher le grand public d’attraper le #Coronavirus, mais si les prestataires de soins de santé ne peuvent pas les obtenir pour soigner les patients malades, cela les met en danger, ainsi que nos communautés ! »

Le Surgeon General et Fauci ont par la suite changé d’avis sur le port du masque lorsqu’il ne convenait plus au récit de contrôle, et sont maintenant de fervents partisans de l’application du port obligatoire du masque. Les données scientifiques continuent de montrer que le port du masque n’empêche en rien la propagation de la Covid-19.

7) Les vaccins Covid de Pfizer et Moderna sont fabriqués à l’aide d’une toute nouvelle technologie qui a fait l’objet de tests limités. Le NIAID a effectué des tests minimaux sur des souris, mais ces souris n’étaient PAS d’un type normalement susceptible de contracter la Covid-19 comme le sont les humains. Ces tests étaient totalement inadéquats, mais les vaccins à ARNm ont tout de même été autorisés à être utilisés par les humains.

8) Les nouveaux vaccins ne contiennent pas le virus qui déclenche la Covid-19, comme le ferait un vaccin classique. Au lieu de cela, les chercheurs de Moderna et de Pfizer ont utilisé une nouvelle technique pour fabriquer de l’ARN messager (ARNm), qui est similaire à l’ARNm présent dans le SARS-Cov-2. En théorie, l’ARNm artificiel agira comme des instructions qui inciteront les cellules humaines à fabriquer une protéine présente à la surface du virus. Cette protéine devrait théoriquement déclencher une réponse immunitaire protectrice. L’ensemble des efforts déployés pour le vaccin de la Covid-19 a été essentiellement un raccourci géant. Ce n’est pas un avantage, car les effets à long terme de tout vaccin, d’un an à cinq ans, puis à dix ans, devraient être compris avant qu’il ne soit injecté à des êtres humains.

9) Plusieurs professionnels de l’industrie médicale, dont l’ancien vice-président de Pfizer, ont signé une pétition mettant en garde contre les nouveaux vaccins à ARNm. Ils affirment que des tests beaucoup plus poussés sont nécessaires avant d’exposer les humains, et ils préviennent que les vaccins peuvent provoquer de graves réactions auto-immunes, voire l’infertilité.

10) De nombreux sondages montrent également qu’au moins 30 à 50 % des professionnels de la santé, y compris les infirmières et les médecins, prévoient également de refuser les vaccins. Ces personnes risquent de perdre leur emploi, mais elles n’accepteront pas pour autant le vaccin. C’est dire à quel point les vaccins à ARNm peuvent être potentiellement dangereux ; la santé à long terme est plus importante que les risques à court terme.

Lorsque tous ces faits sont pris en compte, ainsi que de nombreux autres que je n’ai pas la place de mentionner ici, il n’est pas si farfelu que des millions d’Américains soient sceptiques à l’égard des obligations médicales et de la vaccination par rapport à la Covid-19.

Pourquoi devrions-nous nous inquiéter de nous faire vacciner contre un virus auquel 99,7% de la population survivra sans difficulté ? Pourquoi devrions-nous autoriser les fermetures économiques, les passeports médicaux ou la recherche invasive des contacts, et encore moins une pandémie à laquelle moins de 0,3 % de la population est sensible ? En outre, pourquoi devrions-nous nous porter volontaires pour être les cobayes d’une nouvelle technologie vaccinale sans savoir quelles en seront les conséquences à long terme ?

Même si la Covid-19 représentait un danger légitime, aucune crise ne justifie que l’on abandonne nos libertés civiles pour y répondre.

Le récit de base de l’establishment est le suivant : « La Covid-19 est une menace existentielle pour le public, par conséquent, nous sommes justifiés de priver les gens de leurs libertés, de leur économie et de leur vie privée. C’est pour le plus grand bien du plus grand nombre. La vaccination est infaillible et ne peut être remise en question. Les « experts » sont infaillibles et ne peuvent être remis en question. Ce n’est pas votre corps et ce n’est pas votre choix. Votre corps est la propriété du gouvernement et si vous ne prenez pas volontairement des injections de n’importe quel cocktail expérimental que nous vous donnons, alors nous continuerons à éroder vos libertés jusqu’à ce que vous cédiez et vous soumettiez. Puis, une fois que vous vous serez soumis, vos libertés ne vous seront cependant pas rendues ».

Ce n’est pas vraiment un argument convaincant pour beaucoup de gens.

Les médias comme CBS mentionnent rarement la question générale du contrôle et de l’oppression liés à la réponse à la pandémie, tout comme ils n’abordent jamais les faits qui vont à l’encontre de leur message. Ce qu’ils feront, c’est déformer la situation afin d’obtenir la conformité. Le journaliste de The Atlantic l’admet dans l’interview ci-dessus, affirmant que les médias, en particulier, doivent modifier leur message pour mieux inciter les gens à se faire vacciner. En d’autres termes, les gens sont plus faciles à manipuler lorsqu’ils sont amenés à penser qu’il y a plus à gagner en se soumettant qu’en se rebellant.

Le système de passeport médical est la personnification de la fausse incitation. Les médias présentent l’idée que personne ne sera « forcé » de prendre les vaccins ; mais ce qu’ils ne mentionnent pas, c’est que sans le vaccin, ils n’obtiendront pas de passeport médical, et sans passeport médical, ils seront coupés de l’économie normale. Vous pouvez ne pas être vacciné, mais vous serez puni par la pauvreté et l’absence d’accès jusqu’à ce que vous cédiez.

Ma question est la suivante : pourquoi se soucient-ils tant du fait que les gens ne veulent pas ou ne font pas confiance au vaccin ? Pourquoi sont-ils si obsédés ? Si le cocktail d’ARNm fonctionne réellement et ne constitue pas un danger pour la santé, alors ils devraient être parfaitement à l’abri de l’infection. L’idée que les personnes qui refusent sont un danger pour les autres est absurde.

Si l’on commence à parler de « mutations » potentielles qui contournent les protections vaccinales, alors pourquoi prendre un vaccin ? Si les mutations sont réellement une menace et ne sont pas entravées par les vaccins actuels, alors prendre un vaccin maintenant est inutile.

Et, pourquoi ces tentatives constantes de division du public ? CBS et The Atlantic utilisent un stratagème évident pour affirmer que les Américains noirs et bruns ont des raisons différentes de refuser d’obtempérer par rapport aux conservateurs apparemment blancs. Pourquoi supposent-ils que les noirs et les bruns ne sont pas conservateurs ou que nous n’avons pas de nombreux intérêts en commun ? Cela n’est jamais expliqué ou soutenu.

Enfin, comme toujours, les médias cherchent à faire passer pour des « fous du complot » tous ceux qui ne sont pas d’accord avec l’ordre du jour dominant, présentant des arguments fallacieux tout en ignorant tous les arguments légitimes en faveur de la liberté. La RÉALITÉ de la conspiration existe, et aucun de ces journalistes ne survivrait à un débat sur un pied d’égalité avec ceux d’entre nous qui font partie des médias alternatifs lorsqu’il s’agit de la Covid-19 et des vaccins.

La mentalité de harcèlement des médias et du gouvernement à l’égard des personnes sceptiques sur les restrictions de la Covid-19 et des vaccins est troublante. Ils agissent davantage comme des ex-copines délaissées de psychopathes que comme des personnes soucieuses de sauver des vies. Cela me faire dire qu’ils ont peur. Leur programme est incertain, et ils ont des doutes. C’est une bonne chose.

Au fond, la Covid-19 est un non-sujet qui a été gonflé en une crise aux proportions épiques par le biais de la narration et de la vérification sélective des faits. Des millions de personnes dans le monde meurent chaque année d’une myriade de maladies, dont certaines sont aussi infectieuses que la Covid-19. Nous n’arrêtons pas nos vies, ne portons pas de couches sur nos visages, ne nous injectons pas de cocktails non testés modifiant les cellules et ne sacrifions pas nos libertés pour autant. La vie, la liberté et la poursuite du bonheur continuent. Ceux qui souhaitent nous priver de notre autodétermination dans ces domaines sont la vraie menace pas la Covid-19.

= = =

Lecture complémentaire :

Notre page « Coronavirus, guerre contre l’humanité »

Notre page « COVID-19 du mythe aux stats et des stats au scandale »

 

Dictature sanitaire et technotronique : liste (non exhaustive) de vidéos de médecins et scientifiques anti-vaccination

Posted in 3eme guerre mondiale, actualité, altermondialisme, coronavirus CoV19, crise mondiale, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 4 avril 2021 by Résistance 71

Liste non-exhaustive de vidéos de médecins anti-vaccins

Anonyme

4 avril 2021

Note de Résistance 71 : Certaines de ces vidéos ont sans doute déjà été censurées, nous invitons les lecteurs à sauvegarder celles qui peuvent encore l’être pour futur référence, la guerre de l’info et la censure font rage. Ce blog en est une victime parmi des centaines d’autres. Si l’internet permet de toucher une plus vaste audience, rien ne remplace le contact de proximité et la dissémination de l’information de bouche à oreille, sous le manteau ou au grand jour… Il est IMPOSSIBLE de faire taire à 100% une dissidence, tout pouvoir autoritaire, toute coercition la plus soft soit-elle contient en elle-même sa résistance. Il ne fait aucun doute pour nous que la voix de la raison prévaudra en tout et avec elle, l’humanité dans sa forme achevée émancipée de la dictature étatico-marchande et sa énième mutation en cette entité de gouvernance mondiale supranationale nommée « Nouvel Ordre Mondial » par l’oligarchie en place.
Messieurs/dames de la pourriture et de la dégénérescence marchande, rendez-vous, vous êtes cernés !

1. Dr. Nancy Banks – http://bit.ly/1Ip0aIm

2. Dr. Russell Blaylock – http://bit.ly/1BXxQZL

3. Dr. Shiv Chopra – http://bit.ly/1gdgh1s

4. Dr. Sherri Tenpenny – http://bit.ly/1MPVbjx

5. Dr. Suzanne Humphries – http://bit.ly/17sKDbf

6. Dr. Larry Palevsky – http://bit.ly/1LLEjf6

7. Dr. Toni Bark – http://bit.ly/1CYM9RB

8. Dr. Andrew Wakefield – http://bit.ly/1MuyNzo

9. Dr. Meryl Nass – http://bit.ly/1DGzJsc

10. Dr. Raymond Obomsawin – http://bit.ly/1G9ZXYl

11. Dr. Ghislaine Lanctot – http://bit.ly/1MrVeUL

12. Dr. Robert Rowen – http://bit.ly/1SIELeF

13. Dr. David Ayoub – http://bit.ly/1SIELve

14. Dr. Boyd Haley PhD – http://bit.ly/1KsdVby

15. Dr. Rashid Buttar – http://bit.ly/1gWOkL6

16. Dr. Roby Mitchell – http://bit.ly/1gdgEZU

17. Dr. Ken Stoller – http://bit.ly/1MPVqLI

18. Dr. Mayer Eisenstein – http://bit.ly/1LLEqHH

19. Dr. Frank Engley, PhD – http://bit.ly/1OHbLDI

20. Dr. David Davis – http://bit.ly/1gdgJwo

21. Dr Tetyana Obukhanych – http://bit.ly/16Z7k6J

22. Dr. Harold E Buttram – http://bit.ly/1Kru6Df

23. Dr. Kelly Brogan – http://bit.ly/1D31pfQ

24. Dr. RC Tent – http://bit.ly/1MPVwmu

25. Dr. Rebecca Carley – http://bit.ly/K49F4d

26. Dr. Andrew Moulden – http://bit.ly/1fwzKJu

27. Dr. Jack Wolfson – http://bit.ly/1wtPHRA

28. Dr. Michael Elice – http://bit.ly/1KsdpKA

29. Dr. Terry Wahls – http://bit.ly/1gWOBhd

30. Dr. Stephanie Seneff – http://bit.ly/1OtWxAY

31. Dr. Paul Thomas – http://bit.ly/1DpeXPf

32. Many doctors talking at once – http://bit.ly/1MPVHOv

33. Dr. Richard Moskowitz – censored

34. Dr. Jane Orient – http://bit.ly/1MXX7pb

35. Dr. Richard Deth – http://bit.ly/1GQDL10

36. Dr. Lucija Tomljenovic – http://bit.ly/1eqiPr5

37. Dr Chris Shaw – http://bit.ly/1IlGiBp

38. Dr. Susan McCreadie – http://bit.ly/1CqqN83

39. Dr. Mary Ann Block – http://bit.ly/1OHcyU

40. Dr. David Brownstein – http://bit.ly/1EaHl9A

41. Dr. Jayne Donegan – http://bit.ly/1wOk4Zz

42. Dr. Troy Ross – censored

43. Dr. Philip Incao – http://bit.ly/1ghE7sS

44. Dr. Joseph Mercola – http://bit.ly/18dE38I

45. Dr. Jeff Bradstreet – http://bit.ly/1MaX0cC

46. Dr. Robert Mendelson – http://bit.ly/1JpAEQr

47. Dr Theresa Deisher https://m.youtube.com/watch?feature=youtu.be&v=6Bc6WX33SuE

48. Dr. Sam Eggertsen-7a4dd71dafbb1404bfd494dae3fe02fd-b-mail-icon_video-link.gifhttps://m.youtube.com/watch?v=8LB-3xkeDAE

Lire notre page « Coronavirus, guerre contre l’humanité »

Apprenez plus sur la dictature technotronique sur Résistance 71

Vaccination mondiale et dictature technotronique véritables objectifs de « l’opération COVID » (Dr Pascal Sacré)

Posted in actualité, altermondialisme, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , on 27 février 2021 by Résistance 71

Excellente analyse du Dr Sacré comme à son habitude. Nous attirons particulièrement l’attention des lecteurs sur les notes  sources de l’article qui valent d’être lues à elles seules. Si après tout ça certains disent encore qu’ils ne « savent » pas ou ne « savaient » pas, la faute leur en incombe car l’information montrant l’escroquerie de cette « crise sanitaire »est partout. L’objectif est le verrouillage de la grille de contrôle de la dictature technotronique du paradigme oligarchique post-capitalisme.
Qu’on se le dise !
~ Résistance 71 ~

La vaccination mondiale : le véritable objectif de l’opération COVID

“Entre dépeuplement planifié et cynisme financier, l’humanité doit se réveiller”

Dr. Pascal Sacré

22 février 2021

url de l’article original:
https://www.mondialisation.ca/la-vaccination-mondiale-le-veritable-objectif-de-loperation-covid-19/5653966

La vaccination contre le SARS-CoV-2, le virus responsable de la maladie COVID-19, a été lancée dans le monde alors que les essais cliniques ne sont ni complets ni terminés.

Pour la première fois dans l’histoire de la médecine, des produits qui sont toujours en phase d’évaluation des effets secondaires et de l’efficacité sont injectés à des êtres humains sans que ceux-ci ne soient correctement informés et sans obtenir leur consentement éclairé, sous couvert d’urgence et de déclarations des autorités sanitaires influencées par des firmes pharmaceutiques comme en témoigne ce document de l’Agence Européenne du Médicament (EMA-AEM) [1].

Même la revue Prescrire, après son article partial et critique en défaveur de l’ivermectine [2] -voir la réponse du docteur Gérard Maudrux [3], sur le vaccin ADN d’Astra Zeneca et Oxford le souligne :

  • Le niveau de preuves des données est globalement faible, entre autres parce que les essais ne se sont pas déroulés comme prévu, et que les données d’efficacité clinique rendues publiques ne portent que sur environ la moitié des participants aux essais.
  • Dans les essais, la diminution relative du risque d’être atteint d’une maladie covid-19 a été d’environ 70 % dans les groupes vaccin ChAdOx1 nCoV19, avec une incertitude autour de l’ampleur de l’efficacité plus grande qu’avec les deux vaccins à ARNm déjà autorisés. Une réduction de la fréquence de covid-19 grave est vraisemblable mais non démontrée.
  • 36 % des participants avaient au moins un facteur de risque de covid-19 grave autre que l’âge, mais l’incertitude autour de l’ampleur de l’efficacité chez eux est encore plus grande que pour l’ensemble des participants. Seulement 6 % environ des participants étaient âgés de 65 ans ou plus.
  • Les effets indésirables connus du vaccin ChAdOx1 nCoV19 sont surtout des réactions locales et systémiques très fréquentes. Il existe encore de nombreuses inconnues inhérentes au faible recul d’utilisation, notamment de ce vecteur viral chez les êtres humains.

Des niveaux de preuve globalement faibles, de nombreuses inconnues inhérentes au faible recul d’utilisation.

Toute mise sur le marché d’un produit, d’un médicament, à fortiori d’un vaccin destiné à des personnes non malades, nécessite plusieurs phases d’évaluation, étalées sur plusieurs années, principe de précaution court-circuité dans cette crise avec tous les dangers que cette précipitation peut engendrer.

Le principe de précaution violé

Quoi qu’en disent, sans preuves, les firmes productrices des vaccins nouvelle génération (ARNm ou ADN avec vecteur viral modifié génétiquement), l’introduction d’ARNm ou d’ADN avec vecteur viral dans nos cellules comporte le risque potentiel de modifier notre ADN. La sécurité génétique de cette technique n’a pas pu être évaluée puisque plusieurs décennies seraient nécessaires pour le faire.

Ces « vaccins géniques » au mécanisme d’action très particulier exposent l’humanité à des risques inconnus, non maîtrisés, en opposition totale avec le principe de précaution pourtant si cher à nos autorités sanitaires.

Le principe de précaution est à la base de la plupart des mesures liberticides imposées par nos gouvernements : port du masque obligatoire même en rue, distances sociales, fermeture des lieux publics tels que restaurants ou bars, interdiction de se rassembler ou de manifester, fermeture des cinémas, des piscines et des parcs de loisirs.

Pour les vaccins, le principe de précaution est violé, bafoué.

Délai normal de mise sur le marché d’un vaccin

Ce qui suit est encore plus vrai avec les coronavirus comme le SARS-CoV-2.

La journaliste Céline Deluzarche, dans un article sur Futura Sciences (Futura Santé) du 19 mars 2020 revu le 15 juin, le dit :

« Coronavirus : les dangers d’un vaccin élaboré à la hâte.

Face à l’urgence, les scientifiques appellent à accélérer les procédures de tests et à se passer des habituels essais sur les animaux. Une stratégie louable mais qui pourrait s’avérer au mieux, contre-productive, au pire causer des morts.

Normalement, obtenir un vaccin efficace, non toxique et utilisable prend entre 15 et 20 ans. Il faut d’abord mettre au point une formule possédant les prérequis chimiques et pharmaceutiques, mener des études d’immunogénicité chez l’animal, évaluer la toxicité du vaccin  chez l’animal, puis chez l’Homme, et enfin, tester son efficacité à grande échelle. » [4]

« Jusqu’à la crise COVID-19, un essai vaccinal suivait un parcours long nécessitant de nombreuses années, (de 9 à 12 ans, en moyenne 10) pour arriver à la commercialisation. Il comprenait de multiples phases aux objectifs précis avant de passer à la suivante, chaque étape apportant des informations complémentaires. Beaucoup de candidats-vaccins étaient abandonnés (comme pour le SIDA où deux candidats ont été éliminés car ils augmentaient paradoxalement le risque d’attraper la maladie). » [5]

Pour avoir l’autorisation de mise sur le marché d’un médicament ou d’un vaccin, les essais doivent franchir plusieurs étapes ou phases. 

Ces étapes et ce délai sont la clé de la sécurité du produit.

La phase préclinique consiste à faire des tests sur animaux : cette étape préclinique animalière est très importante pour la sécurité.

Depuis le code de Nuremberg (1947), les essais sur l’homme doivent être précédés d’expériences sur les animaux. Les vaccins produits en laboratoire sont donc d’abord testés chez l’animal. Cette étape indispensable ne préjuge pas des résultats chez l’homme mais permet d’éliminer des médicaments très toxiques et de préciser les organes susceptibles d’en souffrir.

Chez le chat, le vaccin contre le coronavirus responsable de la péritonite virale féline a été abandonné à cause de l’aggravation de la maladie par la vaccination, ce risque est connu depuis 30 ans [6-7].

Ce sont les essais sur des animaux qui ont mis en évidence le risque d’anticorps facilitants des candidats vaccins contre les précédents coronavirus SARS et MERS.

Chez les macaques vaccinés contre le SARS-COV-1, les infections post vaccinales ont été marquées par l’aggravation de la pathologie pulmonaire. Lors d’essais de vaccins contre le coronavirus du MERS, les lapins ont développé des anticorps mais leur pathologie pulmonaire s’est aggravée. Ces complications inattendues ont conduit au rejet des candidats vaccins contre les précédents coronavirus. [8]

Cette complication est appelée VAED.

Avec les vaccins, « le plus gros problème est la crainte d’un ADE (Antibody-Dependant Enhancement, facilitation de l’infection par le vaccin, médiée par les anticorps induits par la vaccination) : facilitation de la pénétration du virus dans les cellules par le récepteur du fragment Fc des immunoglobulines » [9-10]

Le 5 mars 2020, devant le congrès états-unien, Peter Hotez (expert vaccinal – Peter Hotez, Wikipédia) met en garde contre la facilitation de l’infection par les anticorps, et sa relation avec la vaccination :

« Il faut être très prudent et aller doucement avec les essais cliniques, les essais sur animaux ont montré la facilitation » !

Peter Hotez nous conseille la plus grande prudence :

« Un vaccin n’est pas anodin : il s’agit le plus souvent d’un virus désactivé ou affaibli, et peut dans certains cas aggraver la maladie qu’il est censé prévenir. Peter Hotez, doyen de l’École nationale de médecine tropicale du Baylor College of Medicine et qui a travaillé sur l’épidémie de SRAS en 2003, a ainsi constaté que certains animaux vaccinés développaient des symptômes encore plus graves lorsqu’ils étaient exposés au virus en raison d’un affaiblissement du système immunitaire. C’est ce que l’on appelle une « facilitation de l’infection par des anticorps » (Antibody-Dependent Enhancement ou «ADE en anglais) » 

Vaccination COVID et VAED

Pour le VIDAL, organe de référence médical français, la question est posée :

Vaccins contre la COVID-19 : doit-on s’inquiéter du risque de maladie aggravée chez les personnes vaccinées ? [11]

Malgré 30 ans d’efforts, aucun vaccin efficace n’a jamais été mis au point pour aucune des nombreuses souches de coronavirus.

« À ce jour, il n’y jamais eu de vaccin efficace contre les coronavirus, en raison de la nature de ces virus. En plus, les tentatives passées de créer un vaccin anti-coronavirus ont eu comme seul résultat des personnes vaccinées avec un plus grand risque de maladie sévère et de décès une fois à nouveau exposées à une autre souche du virus. » [12-13]

La phase pré-clinique, animale, a été laissée de côté par les firmes et la vaccination, lancée sans s’assurer de l’absence de VAED.

Prétextant l’urgence de la crise actuelle ou le manque d’animaux adéquats, le développement très rapide de plusieurs vaccins n’a été possible que parce que de nombreuses expériences animales ont été ignorées.

Les vaccins de la société pharmaceutique allemande BioNTech et de la société américaine Moderna ont été testés sur des singes seulement après avoir été injectés à des centaines de sujets humains.

Après la phase pré-clinique sur les animaux, le produit doit traverser la phase I (évaluation de la toxicité à court terme chez l’humain et du taux d’anticorps produits), la phase II (en moyenne 4 ans) qui doit confirmer l’absence de danger, l’efficacité et déterminer la dose optimale et le schéma d’administration, et enfin la phase III (durée 3 à 5 ans) sur un groupe représentatif de la population cible, comportant des milliers de personnes. Le succès de la phase III fournit le dossier indispensable à l’autorisation de mise sur le marché, analysé par des experts indépendants des firmes pour le compte de l’Agence du médicament.

Tout ceci explique pourquoi cette mise sur le marché prend normalement plusieurs années, dans l’intérêt de la population qui va recevoir ce médicament ou ce vaccin.

Il faut être sûr de l’efficacité ET d’un danger acceptable au regard des risques de la maladie ciblée.

Cela permet surtout de pouvoir informer correctement la population afin qu’elle fournisse un consentement éclairé au traitement ou à la vaccination.

La mise sur le marché en moins d’un an des vaccins COVID n’a été obtenue qu’au prix de la diminution de la sécurité par suppression ou allègement de nombreuses étapes des essais, et non des moindre, les essais sur les animaux.

Ceci est d’autant plus vrai en matière de vaccins contre les coronavirus, comme l’ont montré les tentatives désastreuses de vaccination contre le SRAS-CoV-1 et le MERS.

En matière de vaccination contre le COVID, les firmes PFIZER-BioNTech, Astra Zeneca, Moderna ont court-circuité ou bâclé toutes les étapes qui permettent de s’assurer de la sécurité :

  • Absence ou diminution considérable des essais sur les animaux.
  • Regroupement des phases II et III ne permettant pas d’utiliser les résultats des phases II pour concevoir convenablement les phase III.
  • Durée de suivi des sujets des essais totalement insuffisante, ne permettant d’avoir aucune estimation sérieuse de la durée de l’immunité éventuelle et des éventuelles complications (les narcolepsies causées par les vaccins anti grippe H1N1 de 2009 ne sont apparues qu’après plusieurs mois).
  • Autorisation de mise sur le marché alors que les résultats définitifs des essais phase III ne sont ni publiés, ni obtenus et que la durée moyenne de leur suivi ne permet pas d’estimer leurs complications à moyen terme, ni leurs effets chez les personnes âgées à forte comorbidité qui sont trop peu représentées. [14]
  • La phase 3 (hors essai officiel) se déroule donc actuellement, comme le détaille Pfizer, dans sa publication sur clinicaltrials.gov : première analyse en aout 2021 et fin de l’essai en janvier 2023.

« Le miracle de la commercialisation en moins d’un an de prétendus vaccins, salué unanimement par les médias, ne consacre en fait que l’abandon quasi-total des mesures de sécurité élaborées depuis 70 ans pour nous protéger des catastrophes médicamenteuses.

L’allègement des essais est d’autant plus critiquable que certains vaccins utilisent des techniques nouvelles. » [15]

Le but d’un vaccin est de diminuer (au mieux de supprimer) la mortalité et de supprimer la transmission de la maladie dans la population. Or ces critères ont été négligés par les firmes dans leur conception des essais au profit d’une négativation de tests PCR seuls dont la non-fiabilité est maintenant reconnue unanimement [16].

De toute façon, la capacité d’interrompre la transmission du virus par les vaccins (immunité stérilisante) n’est pas étudiée dans les essais cliniques, comme le dit l’éditorialiste du British Medical Journal Peter Doshi [17] :

Le monde a parié sur la production de vaccins comme solution à la pandémie, mais les essais ne visent pas à répondre aux questions que beaucoup pourraient se poser.

Peter Doshi a montré que les essais cliniques « randomisés » ne montreront pas si les vaccins sont capables d’éviter les formes graves chez les personnes fragiles ni s’ils auront un effet sur la mortalité globale.

Les essais cliniques sont conçus pour déterminer si les futurs vaccins seront capables d’éviter une maladie bénigne ou même asymptomatique, pas pour éviter une maladie grave ou le décès par COVID-19. Les essais ne montreront pas que les vaccins peuvent éviter la transmission interhumaine.

Précautions bafouées par les médecins vaccinateurs

Le font-ils exprès ? Savent-ils ce qu’ils font ?

La vaccination n’est pas un traitement, mais une prévention dont l’efficacité dépend de la bonne santé du système immunitaire de la personne vaccinée. Si ce système immunitaire (immunités spécifiques à mémoire via les lymphocytes B producteurs d’anticorps et les lymphocytes T) est compromis, non seulement la vaccination sera inutile, mais aussi potentiellement dangereuse, pouvant provoquer la maladie qu’elle est censée prévenir !

Avant de vacciner, il est conseillé d’évaluer le statut immunitaire de la personne : sérologies anticorps, mesure des taux de lymphocytes par un laboratoire spécialisé.

Les médecins ou autres personnes qui vaccinent sont-ils en mesure d’informer correctement leurs patients en droit d’être informés avant de donner leur consentement éclairé à tout traitement, toute prévention ?

Ces vaccinateurs connaissent-ils les études sur les effets toxiques des adjuvants, aluminium, nanoparticules, poly-éthylènes glycols (PEG) ou autres ?

« Des vaccins sont à l’étude pour les effets secondaires possibles qu’ils peuvent provoquer. Afin de fournir de nouvelles informations, une méthode d’investigation par microscopie électronique a été appliquée à l’étude des vaccins, visant à vérifier la présence de contaminants solides au moyen d’un microscope électronique à balayage environnemental équipé d’une microsonde à rayons X. Les résultats de cette nouvelle enquête montrent la présence de particules micro et nanométriques composées d’éléments inorganiques dans les échantillons de vaccins qui ne sont pas déclarées parmi les composants et dont la présence indûment est, pour le moment, inexplicable. Une partie considérable de ces contaminants particulaires a déjà été vérifiée dans d’autres matrices et signalée dans la littérature comme non biodégradable et non biocompatible. » [18]

Les nanoparticules traversent le placenta [19].

Les nanotubes pénètrent dans les poumons [20].

Les nanoparticules bouchent les vaisseaux sanguins et capillaires [21].

Les nanoparticules endommagent l’ADN [22].

Il y a des risques d’allergies graves et de maladies auto-immunes liées à la présence de PEG (polyéthylène glycol) utilisés dans les nanoparticules vectrices des vaccins à ARNm [23].

Il existe des anticorps contre les PEG chez 72% des Américains [24]. Cet adjuvant peut provoquer des maladies auto-immunes et c’est une molécule très toxique [25].

Le risque de maladies auto-immunes notamment neuronales est très sérieux du fait notamment du mimétisme entre épitopes de la protéine Spike et certaines protéines neuronales humaines [26].

Les médecins vaccinateurs connaissent-ils la recombinaison ?

Ce risque est indépendant du vecteur utilisé, plasmides, nanoparticules ou virus génétiquement modifié.

Les VIRUS oint une grande capacité à échanger des fragments de leur matériel génétique respectif dès que les génomes des virus sont de même nature, ADN ou ARN, et qu’ils partagent des séquences de gènes qui se ressemblent.

Ces virus recombinants peuvent être beaucoup plus virulents que le virus d’origine et peuvent donc aggraver la situation.

Le phénomène de recombinaison a été démontré chez des plantes transgéniques dans le génome desquelles un gène viral avait été volontairement introduit.

Exemple de virus recombinant : H1N1, recombinant 3 souches de virus de la grippe, porcine, humaine et aviaire.

Les médecins vaccinateurs connaissent-ils le risque de cette vaccination COVID avec la grippe ou du COVID avec la vaccination antigrippale ?

La vaccination antigrippale est fortement suspectée de favoriser les infections à coronavirus chez l’adulte ! [27]

Cela a été montré également chez l’enfant [28]. 

Et le risque de maladie déclenchée par la vaccination (VAED) a également été documenté pour le vaccin antigrippal [29].

Effets secondaires graves voire décès déjà documentés

La FDA (USA) a signalé à la suite de la vaccination COVID la survenue d’effets secondaires, indésirables graves appelés effets systémiques de grade III, c’est-à-dire empêchant l’activité quotidienne et nécessitant une intervention médicale [30].

Le CDC (haute autorité de santé aux USA) a rassemblé les réactions indésirables au vaccin Pfizer entre le 14 et le 18 décembre 2020 au Royaume-Uni et a recensé presque 3% d’effets secondaires graves. 3%  :  c’est énorme ! Pour contrer une maladie qui a un taux de mortalité de seulement 0,23%, pour l’ensemble de la population ! [31]

L’Agence norvégienne du médicament établit un lien entre plusieurs décès et les effets secondaires du vaccin ARNm.

Selon le médecin en chef de l’autorité sanitaire, « les effets secondaires courants des vaccins à ARNm, tels que la fièvre et les nausées, ont pu entraîner la mort de certains patients fragiles ». Le gouvernement norvégien est préoccupé par le décès de 29 personnes âgées qui ont été soumises au vaccin COVID-19 de Pfizer.

La Norvège a émis le 15 janvier 2021 une alerte après la constatation de 29 décès après vaccin Pfizer chez des personnes âgées en Ehpad. Selon l’Institut norvégien de santé publique :

« Pour les personnes les plus fragiles, même des effets secondaires relativement légers peuvent avoir des conséquences graves. »

« Pour ceux qui ont une durée de vie restante très courte de toute façon, les avantages du vaccin peuvent être marginaux ou non pertinents ».

L’Institut norvégien de santé publique a ajouté depuis de nouveaux conseils de prudence sur la vaccination des personnes âgées fragiles.

Des experts en santé de Wuhan, en Chine, ont notamment appelé la Norvège et d’autres pays à suspendre l’utilisation des vaccins COVID-19 à base d’ARNm produits par des sociétés telles que Pfizer, en particulier chez les personnes âgées.

L’Administration australienne des produits thérapeutiques recherchera « des informations supplémentaires, à la fois auprès de la société, mais aussi auprès du régulateur médical norvégien », a déclaré Hunt. Le ministère australien des Affaires étrangères contactera également son homologue norvégien à ce sujet [32-33].

En Espagne, après « vaccination génétique », 7 morts et 100% des résidents infectés dans une maison de retraite espagnole avec le « vaccin » expérimental à ARNm de Pfizer [34].

De très nombreux témoignages apparaissent de soignants dans différents pays (USA, Suisse, France, Pays -Bas, Italie) qui s’étonnent de l’augmentation brutale de la mortalité des résidents d’Ehpad après vaccination.

24 morts dans une maison de retraite aux USA suite à la vaccination en pleine flambée épidémique : les décès ont commencé à se produire 7 jours après le début de la campagne de vaccination (80% des résidents et 50% du personnel a été vacciné). Il n’y avait pourtant eu aucun décès dû au Covid dans les maisons de retraite de la région ! [35]

Comme souligné et prouvé dans les points précédents, vacciner en pleine période épidémique comporte les risques de recombinaison virale avec virus recombinants plus virulents (variants) comme nous le verrons plus loin avec les cas d’Israël ou de la Grande-Bretagne, d’interférence virale et de VAED (aggravation de l’infection par la vaccination).

Malgré ces données, les pays continuent à vacciner à tour de bras !

Floride, décès d’un médecin, attribué au vaccin par un expert [36].

Les responsables de la santé publique et les porte-parole de l’industrie aiment à dire que les risques de blessures graves liés à la vaccination sont de « un sur un million ».

Le ministère de la santé a prétendu, en 2010, que le VAERS (Vaccination Adverse Effects Reporting System) avait recueilli « moins de 1% des effets graves » dus aux vaccins.  Les taux réels de blessures dues aux vaccins obligatoires étaient en réalité plus de 100 fois supérieurs à ce que le ministère de la santé avait dit au public ! [37]

Dans la vaccination anti-COVID, au cours de la première semaine de distribution des vaccins, les Américains ont pris 200 000 doses de vaccins COVID et ont signalé 5 000 effets « graves » (c’est-à-dire des journées de travail manquées ou une intervention médicale nécessaire).

Cela représente un taux de blessure de 1 sur 40 piqûres. 

Cela signifie que les 150 piqûres nécessaires pour éviter un cas bénin de COVID causeront des blessures graves à au moins trois personnes. 

L’analyse de l’étude de 2010 du HHS a révélé que le risque réel d’événements indésirables graves était de 26/1000, soit un sur 37 [38].

Déjà 132 décès déclarés dans Eudravigilance seulement 26 jours après l’autorisation de mise sur le marché du vaccin Pfizer [39].

Les autorités masquent la vérité.

Réactions allergiques graves documentées

Des allergies sévères sont causées par les vaccins ARNm [40-41].

Que se passe-t-il en Israël, en Grande Bretagne et à Gibraltar, champions de la vaccination génétique ?

Les médias glorifient Israël, le champion de la lutte anti-COVID-19 par le vaccin Pfizer.

La mortalité en Israël continue d’augmenter, contrairement à ce que dit le Parisien (francesoir.fr)

Depuis le 20 décembre, en un peu plus d’un mois, près de 30% de la population (plus de 3 millions de personnes) auraient été vaccinées. Mais le succès d’une vaccination ne se juge pas d’après le nombre de vaccinés mais uniquement d’après l’évolution de l’épidémie qu’elle est censée prévenir. Or depuis cette date, les nombres quotidiens de morts attribuées au COVID-19 explosent passant d’une moyenne de 15 pendant la semaine précédant la vaccination à 56 cette dernière semaine de janvier 2021, suggérant ainsi que la première injection du vaccin serait susceptible d’aggraver l’évolution de la maladie (VAED).à

Vaccination en Grande-Bretagne

La Grande-Bretagne a choisi principalement le vaccin d’Astra Zeneca peu testé également et a réussi à vacciner plus de 6 millions de personnes. Mais après 58 jours de vaccination, la mortalité quotidienne moyenne lissée sur 7 jours a doublé, passant d’un peu moins que 500 durant la semaine précédant la vaccination à 1070 dans la dernière semaine de janvier.

La Grande-Bretagne a commencé la vaccination dans la première semaine de décembre 2020 en vaccinant prioritairement les personnes les plus âgées et aurait atteint dans ce groupe d’âge une couverture vaccinale de plus de 75%. 

Depuis, la mortalité quotidienne des britanniques de plus de 80 ans a considérablement augmenté et dépasse maintenant celle de mars.

Après presque un an d’épidémie, Gibraltar ne comptait que 15 décès attribués au COVID-19. En 3 semaines de vaccination, le nombre total de morts a été multiplié par 5 !

Immunité juridique pour les fabricants de vaccins

Les commandes de vaccins engendrent des bénéfices pour les actionnaires de l’entreprise et un coût pour le public. Mais le plus grave est la mise en danger des populations qui paient pour cela !

Les fabricants de vaccin ont exigé et obtenu de ne pas pouvoir être poursuivis pour complications vaccinales même en cas de défectuosité de leurs produits.

Aux USA, les fabricants de vaccins sont protégés de toute poursuite légale en cas de dommages causés par les vaccins, ce coût sera supporté par l’état, donc ses contribuables [42].

En Europe, les fabricants de vaccins font pression sur l’UE pour obtenir une protection juridique [43].

Astra Zeneca organise son exemption juridique [44].

L’Union Européenne (UE) indemnisera les laboratoires en cas d’effets secondaires inattendus [45].

Vaccins obligatoires ?

D’après l’OMS et le Conseil de l’Europe, les vaccins ne devraient pas être obligatoires, et dans le même temps, des gouvernements parlent ouvertement d’imposer un passeport vaccinal avec discrimination certaine des non-vaccinés :

Le courrier du soir Covid-19 : le vaccin sera obligatoire pour obtenir un travail, voyager, aller au resto ou assister à un événement, 20 aouts 2020 [46].

Pourtant, d’autres gouvernements plus avisés et qui protègent vraiment leurs populations ont décidé de faire un moratoire sur ces vaccinations aux effets inconnus, grevées d’effets secondaires et décès de par le monde, dont on nous dit qu’elles ne sont pas destinées à nous protéger des formes graves ni de la contagion et pour lesquelles toutes les étapes de sécurité ont été court-circuitées, foulant au sol le principe de précaution le plus élémentaire.

Le Premier ministre thaïlandais déclare qu’il n’y aura pas de vaccination pour les Thaïlandais

Le premier ministre thaïlandais a déclaré dimanche qu’il ne permettrait pas aux Thaïlandais d’être utilisés comme cobayes pour tester l’efficacité des vaccins Covid-19. Tous les vaccins déployés en Thaïlande doivent être sans danger [47].

De même, Madagascar et les Suédois refusent ces vaccins [48-49].

Y avait-il vraiment urgence ?

L’urgence est pourtant toute relative, avec un taux de mortalité (IFR-Infection Fatality Rate) dans toute la population mondiale, selon l’OMS, de 0,23%, soit un taux de survie au COVID-19 de 99,77% ! [50]

L’argument pour justifier une mise sur le marché à la hâte d’un vaccin anti-COVID est l’ampleur de la pandémie COVID-19 ayant imposé l’arrêt de toute l’économie jusqu’à ce qu’un vaccin soit disponible.

Pourtant, toutes les prévisions catastrophiques ont été revues à la baisse [51].

Les projections de décès faites par l’Imperial College de Londres (Neil Fergusson) en l’absence de confinement étaient très exagérées [52].

Les chercheurs qui ont écrit dans le UK Telegraph le 16 mai dernier l’ont qualifié de « l’erreur logicielle la plus dévastatrice de tous les temps ». Ils ont écrit que « nous virerions n’importe qui pour avoir développé un code comme celui-ci » et que la question était « pourquoi notre gouvernement n’a pas obtenu un second avis avant d’avaler la prescription d’Imperial » [53].

N’y avait-t-il rien d’autre à faire ?

D’autres solutions plus naturelles, moins dangereuses, pour lesquelles nous disposons de dizaines d’années de recul sur les éventuels effets secondaires, existent, rendant encore plus relative cette notion d’urgence vaccinale avec des produits expérimentaux, dont les phases d’évaluation (efficacité et dangers) ne sont pas terminées, vaccinations grevée de dangers graves pour la santé humaine, en particulier en matière de coronavirus !

Beaucoup de médecins soutiennent ces solutions alternatives :

  • Ivermectine [54] associée à un antibiotique
  • Antibiotique (Azithromycine) [55]
  • Hydroxychloroquine [56] associée à un antibiotique [57]
  • Vitamine D3 [58]
  • Vitamine C [59]
  • ZINC [60] 
  • Sélénium [61]
  • Artemisia Annua [62]
  • Mélatonine [63]
  • Colchicine [64]

Pour certains de ces produits, le nombre de références et de preuves d’efficacité et surtout de sécurité est impressionnant, et les tentatives des autorités pro-vaccinales et des médias écrits et parlés qui répètent leurs mantras comme des perroquets sont de plus en plus ridicules. Cela ne serait que risible, si ces dénis et mensonges n’entraînaient pas autant de morts et de maladies évitables.

Epilogue

L’humanité est l’objet d’une expérimentation à grande échelle.

Tout cet article, références à l’appui, montre que :

  • L’urgence sanitaire utilisée comme prétexte à une telle prise de risque avec nos santés, nos libertés et nos patrimoines génétiques ne tient pas la route, avec un taux de survie spontanée au COVID-19 (en ne faisant rien) de 99,77 % pour toute la population. Le taux de survie et la qualité de survie seraient encore plus élevés en permettant aux médecins de prescrire les traitements efficaces dont l’ivermectine.
  • Les vaccins, surtout les formes génétiques, ADN et ARNm, préparées en moins d’un an en court-circuitant toutes les étapes de sécurité habituelles dont les essais sur animaux, et sans attendre un recul indispensable, sont de petites bombes à retardement dans nos cellules, et les effets secondaires graves, les décès déjà rapportés montrent que le remède est pire que le problème.
  • Des solutions alternatives, efficaces et surtout plus sûres, existent. Seulement elles ne rapportent rien aux firmes pharmaceutiques qui ont déjà empoché des milliards de dollars et d’euros, et ce n’est rien à côté des milliards de dollars que les maladies auto-immunes et autres fléaux engendrés par ces vaccins préparés à la hâte leur promettent, tout en ayant fait attention à échapper à toute poursuite pénale pour tous les dommages que leurs vaccins ne manqueront pas de causer. C’est déjà commencé.

Humanité ! Est-ce vraiment ce que tu veux ?

Sinon, il faut se réveiller.

Dr Pascal Sacré

Le 21 février 2021

Notes (sources) :

[1] Ce que disent les documents sur les vaccins anti-Covid-19 volés à l’Agence européenne des médicaments : https://www.lemonde.fr/planete/article/2021/01/16/vaccins-ce-que-disent-les-documents-voles-a-l-agence-europeenne-des-medicaments_6066502_3244.html

[2] https://www.prescrire.org/Fr/203/1845/60820/0/PositionDetails.aspx 

[3] https://www.francesoir.fr/opinions-tribunes/livermectine-victime-dattaques-malhonnetes 

[4] https://www.futura-sciences.com/sante/actualites/coronavirus-coronavirus-dangers-vaccin-elabore-hate-80089/

[5] https://www.mondialisation.ca/insuffisances-methodologiques-des-essais-des-vaccins-anti-covid-19/5653363 

[6] Vennema, H. et al. Early death after feline infectious peritonitis virus challenge due to recombinant vaccinia virus immunisation. J. Virol. 64,1407–1409 (1990).

[7] Hohdatsu, T & al, A study on the mechanism of antibody-dependent enhancement of feline infectious peritonitis virus infection in feline macrophages by monoclonal antibodies. Arch. Virol. 120, 207–217 (1991).

[8] https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3335060/ , 2012, PloS One

Immunization with SARS Coronavirus Vaccines Leads to Pulmonary Immunopathology on Challenge with the SARS Virus

[9] Molecular Mechanism for Antibody-Dependent Enhancement of Coronavirus Entry, Journal of Virology

[10] SARS vaccines : where are we ?, Expert Rev Vaccines 2009 Jul ; 8(7) :887-98. Doi : 10.1586/erv.09.43.

[11] https://www.vidal.fr/actualites/26105/vaccins_contre_la_covid_19_doit_on_s_inquieter_du_risque_de_maladie_aggravee_chez_les_personnes_vaccinees/

[12] https://fort-russ.com/2020/05/were-conspiracy-theorists-right-bill-gates-supported-moderna-inc-prepares-mid-stage-trials-for-covid-19-vaccine/ , 8 mai 2020

[13] https://pubmed.ncbi.nlm.nih.gov/31607599/ , Vaccine, 10 janvier 2020, Influenza vaccination and respiratory virus interference among Department of Defense personnel during the 2017-2018 influenza season.

[14] https://blogs.bmj.com/bmj/2021/01/04/peter-doshi-pfizer-and-modernas-95-effective-vaccines-we-need-more-details-and-the-raw-data/ 

[15] https://www.mondialisation.ca/insuffisances-methodologiques-des-essais-des-vaccins-anti-covid-19/5653363

[16] PCR : Un tribunal portugais juge que les tests PCR sont « peu fiables » et les quarantaines « illégales » (profession-gendarme.com). Texte intégral du jugement en portugais publié : sur :http://www.dgsi.pt/jtrl.nsf/33182fc732316039802565fa00497eec/79d6ba338dcbe5e28025861f003e7b30

http://www.francesoir.fr/opinions-tribunes/les-implications-capitales-de-la-jurisprudence-portugaise-concernant-les-tests-pcr

[17] Will covid-19 vaccines save lives ? Current trials aren’t designed to tell us  

BMJ  2020

https://www.bmj.com/content/371/bmj.m4037

[18] https://medcraveonline.com/IJVV/new-quality-control-investigations-on-vaccines-micro–and-nanocontamination.html  New Quality-Control Investigations on Vaccines : Micro- and Nanocontamination, par Antonietta M Gatti et Stefano Montanari, 23 janvier 2017

[19] https://www.santelog.com/actualites/grossesse-et-pollution-les-microparticules-traversent-le-placenta :  GROSSESSE et POLLUTION : Les microparticules traversent le placenta

[20] https://www.futura-sciences.com/sante/actualites/enfant-nanotubes-carbone-trouves-poumons-petits-parisiens-60199/ : Des chercheurs de l’université de Paris-Saclay ont trouvé des nanotubes de carbone dans les cellules des voies respiratoires d’enfants asthmatiques vivant en région parisienne. Ces nanotubes pourraient provenir d’émissions de gaz d’échappement et entrer dans les poumons de chacun d’entre nous.

[21] https://www.futura-sciences.com/sante/actualites/medecine-pollution-air-fait-mal-coeur-26390/#xtor=RSS-8 : La pollution de l’air modifie le diamètre des microvaisseaux et augmente ainsi les risques de maladies cardiovasculaires.

[22] https://changera.blogspot.com/2014/04/les-nano-particules-endommagent-ladn.html : Les nanoparticules dans les produits de consommation courante et leurs actions sur l’ADN pouvant mener au cancer !

[23] https://www.sciencemag.org/news/2020/11/fever-aches-pfizer-moderna-jabs-aren-t-dangerous-may-be-intense-some

[24] https://pubmed.ncbi.nlm.nih.gov/27804292/

[25] Szabó, G., Jr., Kiss, A. and Trón, L. (1982), Permeabilization of lymphocytes with polyethylene glycol 1000. Discrimination of permeabilized cells by flow cytometry. Cytometry, 3 : 59-63. https://doi.org/10.1002/cyto.990030113,Shiraishi K, Yokoyama M. Toxicity and immunogenicity concerns related to PEGylated-micelle carrier systems : a review. Sci Technol Adv Mater. 2019 ;20(1):324-336. Published 2019 Apr 15. Doi :10.1080/14686996.2019.1590126

[26] Lucchese G, Flöel A. Molecular mimicry between SARS-CoV-2 and respiratory pacemaker neurons. Rev. 2020 ;19(7) :102556. Doi : 10.1016/j.autrev.2020.102556

Lucchese, G., Flöel, A. SARS-CoV-2 and Guillain-Barré syndrome : Molecular mimicry with human heat shock proteins as potential pathogenic mechanism. Cell Stress and Chaperones 25, 731–735 (2020). https://doi.org/10.1007/s12192-020-01145-6

[27] https://peerj.com/articles/10112/ : Positive association between COVID-19 deaths and influenza vaccination rates in elderly people worldwide

https://www.ncbi.nlm.nih.gov/pubmed/31607599 : Influenza vaccination and respiratory virus interference among Department of Defense personnel during the 2017-2018 influenza season

[28] https://www.ncbi.nlm.nih.gov/pubmed/22423139 : Increased risk of non influenza respiratory virus infections associated with receipt of inactivated influenza vaccine Benjamin J. Cowling & al.

[29] https://www.aimsib.org/2020/09/27/vaccin-anti-grippal-et-facilitation-de-linfection-par-les-anticorps/

[30] Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials : https://www.fda.gov/media/73679/download 

[31]

https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-19/05-COVID-CLARK.pdf

[32] https://lesakerfrancophone.fr/effets-secondaires-du-vaccin-pfizer

[33] https://www.mondialisation.ca/de-plus-en-plus-de-deces-decoulent-de-la-reussite-du-vaccin-pfizer/5653321

[34] https://twitter.com/pacharlotte3/status/1356609473054453760

[35] https://www.syracuse.com/coronavirus/2021/01/covid-19-outbreak-at-auburn-nursing-home-infects-137-residents-kills-24.html

[36] https://www.nytimes.com/2021/01/12/health/covid-vaccine-death.html

[37] https://childrenshealthdefense.org/defender/death-by-coincidence/

Comment les nombreux effets secondaires graves et les décès suite au vaccin sont masqués malgré les rapports dans les fichiers de recueil

Par Robert F Kennedy Jr

[38] https://childrenshealthdefense.org/defender/thousands-covid-vaccine-injuries-13-deaths-reported-december/

[39] https://www.francesoir.fr/opinions-tribunes/chronique-ndeg48-deja-132-deces-declares-dans-eudravigilance-seulement-26-jours 

[40] https://jamanetwork.com/journals/jama/fullarticle/2775646

Allergic Reactions Including Anaphylaxis After Receipt of the First Dose of Pfizer-BioNTech COVID-19 Vaccine, 21 janvier 2021, Tom Shimabukuro & al.

[41] Allergic Reactions Including Anaphylaxis After Receipt of the First Dose of Pfizer-BioNTech COVID-19 Vaccine — United States, December 14–23, 2020 : https://www.cdc.gov/mmwr/volumes/70/wr/mm7002e1.htm 

PDF à télécharger : https://www.cdc.gov/vaccines/acip/meetings/downloads/slides-2020-12/slides-12-19/05-COVID-CLARK.pdf 

[42] https://www.hrsa.gov/vaccine-compensation/index.html, The National Vaccine Injury Compensation Program (VICP) is a no-fault alternative to the traditional legal system for resolving vaccine injury petitions.

https://www.bclplaw.com/en-US/insights/immunity-from-liability-under-the-us-prep-act-for-medical-countermeasures-during-the-sars-cov-2covid-19-pandemic.html , 22 mai 2020

Key Points

  • HHS Declaration Provides Immunity : During a public health emergency, the Secretary of HHS can issue a Declaration providing broad tort immunity for “Covered Persons” engaging in “Recommended Activities” with “Covered Countermeasures.”
  • Covered Persons : The entities covered include, among others, manufacturers and distributors.

[43] 26 août 2020 https://www.ft.com/content/12f7da5b-92c8-4050-bcea-e726b75eef4d

[44] 30 juillet 2020 https://uk.reuters.com/article/us-astrazeneca-results-vaccine-liability/astrazeneca-to-be-exempt-from-coronavirus-vaccine-liability-claims-in-most-countries-idUKKCN24V2EN

[45] 29 aouts 2020 https://www.capital.fr/entreprises-marches/vaccins-contre-la-covid-lue-indemnisera-les-laboratoires-en-cas-deffets-secondaires-inattendus-1379072

[46] https://lecourrier-du-soir.com/covid-19-le-vaccin-sera-obligatoire-pour-obtenir-un-emploi-voyager-aller-au-resto-ou-assister-a-un-evenement-sportif-ou-culturel/ 

[47] Le Premier ministre thaïlandais déclare qu’il n’y aura pas de vaccination pour les Thaïlandais

[48] https://www.rfi.fr/fr/afrique/20201127-covid-19-%C3%A0-madagascar-le-gouvernement-refuse-les-vaccins-et-pr%C3%A9f%C3%A8re-les-rem%C3%A8des-locaux

[49] https://www.lematin.ch/story/echaudes-les-suedois-refusent-le-vaccin-du-covid-371594447544?utm_medium=Social&utm_source=Facebook&fbclid=IwAR0IHlw8J-voxhA3TdwD4dYlYaDix21nnF43Uh2RTcFEL4sX3zAyUO9Gk-s#Echobox=1606467567

[50] https://www.who.int/bulletin/online_first/BLT.20.265892.pdf

[51] https://www.newswire.ca/news-releases/new-cdc-data-on-covid-19-828847530.html

[52] https://www.nytimes.com/2020/03/17/world/europe/coronavirus-imperial-college-johnson.html : It wasn’t so much the numbers themselves, frightening though they were, as who reported them : Imperial College London. The report, which warned that an uncontrolled spread of the disease could cause as many as 510,000 deaths in Britain, triggered a sudden shift in the government’s comparatively relaxed response to the virus. American officials said the report, which projected up to 2.2 million deaths in the United States from such a spread, also influenced the White House to strengthen its measures to isolate members of the public.

[53] Neil Ferguson’s Imperial model could be the most devastating software mistake of all time (telegraph.co.uk) 

[54] IVERMECTINE

1- FLCCC Front Line Covid-19 Critical Care Alliance

https://covid19criticalcare.com/flccc-ivermectin-in-the-prophylaxis-and-treatment-of-covid-19/ 

https://covid19criticalcare.com/i-mask-prophylaxis-treatment-protocol/faq-on-ivermectin/

https://hughhewitt.com/video/dr-pierre-kory-of-the-flccc-alliance-on-the-therapeutic-value-of-ivermectin-in-treatment-of-covid/ 

https://covid19criticalcare.com/flccc-ivermectin-in-the-prophylaxis-and-treatment-of-covid-19/

https://b3d2650e-e929-4448-a527-4eeb59304c7f.filesusr.com/ugd/593c4f_8cb655bd21b1448ba6cf1f4c59f0d73d.pdf

https://covid19criticalcare.com/one-page-summary-of-the-clinical-trials-evidence-for-ivermectin-in-covid-19/

https://www.youtube.com/watch?v=MEk-VOufVGQ

https://youtu.be/n2MlliaLC0Ahttps://www.youtube.com/watch?v=blpV5QDJrn4                                        Dr Pierre Kory :  » Nous avons un traitement qui marche ! «

2- Dr Tess Lawrie  

https://www.researchgate.net/profile/Theresa_Lawrie 

https://www.e-bmc.co.uk/ 

Ivermectin reduces the risk of death from COVID-19 – a rapid review and meta-analysis in support of the recommendation of the Front Line COVID-19 Critical Care Alliance.

PDF : https://b3d2650e-e929-4448-a527-4eeb59304c7f.filesusr.com/ugd/593c4f_1b1399cb64514dc4bdcbef0cd15f7878.pdf 

Ivermectin is an essential drug to reduce morbidity and mortality from COVID-19 infection.  Placebo-controlled trials of ivermectin treatment among people with COVID-19 infection are no longer ethical and active placebo-controlled trials should be closed.

Baisse de 83% de la mortalité

Une médecin et chercheuse britannique, la Doctoresse Tess Lawrie, qui dirige une entreprise spécialisée dans l’évaluation indépendante de données médicales et qui est régulièrement mandatée par l’OMS, a repris et vérifié consciencieusement toutes les études présentées dans le rapport de la FLCCC pour publier sa propre méta-analyse, disponible sur son site (rapport) (EtD Framework).  

Elle arrive exactement aux mêmes conclusions : “Nous avons maintenant des preuves solides de l’existence d’un traitement efficace de la covid-19”.

3- Swiss Policy Research

https://swprs.org/who-preliminary-review-confirms-ivermectin-effectiveness/ 

Covid-19 : WHO-sponsored preliminary review indicates Ivermectin effectiveness

4 – https://www.youtube.com/watch?v=eu61dtsSLrk 

Dr. Andrew Hill’s Ivermectin meta-analysis, from University of Liverpool, England

https://www.researchgate.net/publication/348610643_Meta-analysis_of_randomized_trials_of_ivermectin_to_treat_SARS-CoV-2_infection 

5- https://c19ivermectin.com/

6-  https://ivermectine-covid.ch/quattend-on-pour-utiliser-livermectine-en-suisse-romande/

Un traitement efficace contre le Covid existe, selon un nombre croissant d’experts. Il réduit la mortalité de près de 80%, est bon marché et sans danger.

7-https://www.francesoir.fr/opinions-tribunes/un-traitement-efficace-existe-mais-il-est-ignore

8- https://nouvelle-page-sante.com/ne-renoncez-pas-trop-vite-a-livermectine/

9- https://www.tandfonline.com/doi/full/10.1080/10428194.2020.1786559

Continuous high-dose ivermectin appears to be safe in patients with acute myelogenous leukemia and could inform clinical repurposing for COVID-19 infection

Le Dr Kory et son collectif (FLCCC) ne sont pas les seuls à penser que l’ivermectine peut jouer un rôle déterminant dans la lutte contre la covid-19. Le Dr Thomas Borody, inventeur de la trithérapie contre le H. Pylori, la bactérie responsable des ulcères, l’affirmait également cet été à tous les médias qui voulaient bien l’écouter (c’est-à-dire quelques-uns seulement): l’ivermectine est une “vraie tueuse de coronavirus”.

Médicament sûr :

Kircik, LH, Del Rosso, JQ, Layton AM, Schauber J. Over 25 Years of Clinical Experience With Ivermectin : An Overview of Safety for an Increasing Number of Indications. J Drugs Derm 2016 ; 15 :325-332. 

Médicament essentiel :

World Health Organization. 21st Model List of Essential Medicines. Geneva, Switzerland. 2019. https://www.who.int/publications/i/item/WHOMVPEMPIAU2019.06.  Accessed 29 December 2020.

[55] ANTIBIOTIQUE – AZITHROMYCINE

https://papers.ssrn.com/sol3/Delivery.cfm/SSRN_ID3712423_code4425108.pdf?abstractid=3712423&mirid=1, PDF : The Role of Macrolide Antibiotics in the Prevention of Severe COVID-19 Disease Progression Via the Disruption of Bacteria/virus Co-Operation. The use of Azithromycin (ATM) to prevent the adverse effects of the COVID-19 represents a potential avenue for further research. This article reviewed the clinical evidence and specialised molecular research to describe the dual antiviral and antibacterial role of ATM, and the potential co-operation between mycoplasmas and SARS-CoV-2.

[56] HYDROXYCHLOROQUINE HCQ :

IN VITRO – https://pubmed.ncbi.nlm.nih.gov/32150618/   28 juillet 2020

In Vitro Antiviral Activity and Projection of Optimized Dosing Design of Hydroxychloroquine for the Treatment of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2)

Clinique :

Prof. Harvey Risch, Yale University : Early Outpatient Treatment of Symptomatic, High-Risk COVID-19 Patients That Should Be Ramped Up Immediately as Key to the Pandemic Crisis – PubMed (nih.gov)

The American Journal of Medicine : Pathophysiological Basis and Rationale for Early Outpatient Treatment of SARS-CoV-2 (COVID-19) Infection – The American Journal of Medicine (amjmed.com)

Un professeur d’épidémiologie de Yale recommande la généralisation du traitement Raoult aux Etats-Unis (covexit.com)

HCQ for COVID-19 : real-time analysis of all 248 studies (c19study.com) 

Covid-19 : Quel est le traitement standard ? Inclut-il l’hydroxychloroquine ? MAJ le 4/08/2020 (francesoir.fr)

Le petit livre blanc au sujet de l’hydroxychloroquine (francesoir.fr)

L’hydroxychloroquine, du rationnel scientifique au traitement des patients – YouTube 

Use of hydroxychloroquine in hospitalised COVID-19 patients is associated with reduced mortality : Findings from the observational multicentre Italian CORIST study – European Journal of Internal Medicine (ejinme.com) : European journal of internal medicine 25 août 2020, use of hydroxychloroquine in hospitalised COVID-19 patients is associated with reduced mortality : Findings from the observational multicentre Italia. HCQ use was associated with a 30% lower risk of death in COVID-19 hospitalized patients. Within the limits of an observational study and awaiting results from randomized controlled trials, these data do not discourage the use of HCQ in inpatients with COVID-19.  33 hôpitaux italiens rapportent une réduction de mortalité de 30% avec l’hydroxychloroquine dans une grande étude rétrospective bien menée.

Risk of hydroxychloroquine alone and in combination with azithromycin in the treatment of rheumatoid arthritis : a multinational, retrospective study – The Lancet Rheumatology : 1 million de patients traités à l’HCQ, pas d’effets secondaires cardiaques en usage de moins de 30 jours. En parallèle, le Lancet rapporte que l’HCQ n’accroît pas le risque cardiaque quand elle est prescrite pour moins de 30 jours, donc, il ne devrait plus y avoir de problème pour l’administrer en médecine de ville…pour les médecins qui y voient un bénéfice pour leurs patients.

Un argument pour l’utilisation de l’hydroxychloroquine pour la prophylaxie du SRAS-CoV-2 : Hydroxychloroquine : stop mensonges ! – Anthropo-logiques (tdg.ch)

Meta-analysis on chloroquine derivatives and COVID-19 mortality – October, 20, 2020 Update – IHU (mediterranee-infection.com) : META-ANALYSIS ON CHLOROQUINE DERIVATIVES AND COVID-19 MORTALITY – OCTOBER, 20, 2020 UPDATE.

En cas de conflit d’intérêts avec Gilead, 73 pour cent des articles affirment que l’hydroxychloroquine ne fonctionne pas, et s’il n’y a pas de conflit d’intérêts, 83 pour cent des articles concluent que l’hydroxychloroquine fonctionne.

Influence of conflicts of interest on public positions in the COVID-19 era, the case of Gilead : https://www.sciencedirect.com/science/article/pii/S2052297520300627?via%3Dihub 

Étude frauduleuse du Lancet : Hydroxychloroquine : les auteurs de l’étude publiée par le Lancet ont tous un conflit d’intérêt… (entelekheia.fr)

Coronavirus : Pays où l’hydroxychloroquine est recommandée – IHU (mediterranee-infection.com), avec tous leurs protocoles de traitement

Résultats de terrain : Lorraine | Coronavirus. Chloroquine : le bilan très positif d’un praticien lorrain (estrepublicain.fr)

[57] HYDROXYCHLOROQUINE + ANTIBIOTIQUE

Azithromycin and Hydroxychloroquine Accelerate Recovery of Outpatients with Mild/Moderate COVID-19

PDF : https://www.journalajmah.com/index.php/AJMAH/article/view/30224/56706

https://fortunejournals.com/articles/revisiting-a-metaanalysis-shows-that-hydroxychloroquine-with-azithromycin-may-be-efficient-in-covid19-patients.html : Revisiting a Meta-analysis Shows that Hydroxychloroquine with Azithromycin may be Efficient in Covid-19 patients

[58] VITAMINE D3

In patients hospitalized with COVID-19, calcifediol treatment at the time of hospitalization significantly reduced ICU admission and mortality : https://papers.ssrn.com/sol3/papers.cfm?abstract_id=3771318# 

“Effect of calcifediol treatment and best available therapy versus best available therapy on intensive care unit admission and mortality among patients hospitalized for COVID-19 : A pilot randomized clinical study” – ScienceDirect

Vitamin D for COVID-19 : real-time analysis of all 65 studies (c19vitamind.com)

The role of vitamin D in the prevention of coronavirus disease 2019 infection and mortality : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7202265/

Vitamin D and Inflammation : Potential Implications for Severity of Covid-19 : https://pubmed.ncbi.nlm.nih.gov/32603576/

COVID-19 severity and mortality appear related to vitamin D deficiency : COVID-19 ’ICU’ risk – 20-fold greater in the Vitamin D Deficient. BAME, African Americans, the Older, Institutionalised and Obese, are at greatest risk. Sun and ‘D’-supplementation – Game-changers ? Research urgently required. | The BMJ

Coronavirus : le taux de vitamine D influerait sur les risques d’infection et de décès : Coronavirus : le taux de vitamine D influerait sur les risques d’infection et de décès (trustmyscience.com)

Vitamin D deficiency and co-morbidities in COVID-19 patients – A fatal relationship ? : Vitamin D deficiency and co-morbidities in COVID-19 patients – A fatal relationship ? (Nih.gov)

The mortality of COVID-19 (cases/ million population) shows a clear dependence on latitude. Below latitude 35, mortality decreases markedly. 

These comorbidities, together with the often concomitant vitamin D deficiency, increase the risk of severe COVID-19 events. Much more attention should be paid to the importance of vitamin D status for the development and course of the disease. Particularly in the methods used to control the pandemic (lockdown), the skin’s natural vitamin D synthesis is reduced when people have few opportunities to be exposed to the sun. The short half-lives of the vitamin therefore make an increasing vitamin D deficiency more likely. Specific dietary advice, moderate supplementation or fortified foods can help prevent this deficiency. In the event of hospitalisation, the status should be urgently reviewed and, if possible, improved : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7276229/pdf/main.pdf

Vitamin D deficiency and the COVID-19 pandemic : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7256612/

Analysis of vitamin D level among asymptomatic and critically ill COVID-19 patients and its correlation with inflammatory markers : https://www.nature.com/articles/s41598-020-77093-z 

Vitamin D insufficiency is prevalent in severe COVID-19 : https://www.medrxiv.org/content/10.1101/2020.04.24.20075838v1

Evidence that Vitamin D Supplementation Could Reduce Risk of Influenza and COVID-19 Infections and Deaths : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7231123/#B93-nutrients-12-00988

Vitamin D Supplementation Associated to Better Survival in Hospitalized Frail Elderly COVID-19 Patients : The GERIA-COVID Quasi-Experimental Study : https://www.mdpi.com/2072-6643/12/11/3377

[59] VITAMINE C 

La carence en vitamine C est fréquente dans les populations à risque (hommes seuls, personnes âgées, sans domicile fixe, troubles psychiatriques…) et sous-évaluée dans la population générale. : Carences en vitamine C – EM consulte (em-consulte.com) 

Vitamin C for COVID-19 : real-time analysis of all 4 studies (c19vitaminc.com) 

https://www.evms.edu/media/evms_public/departments/internal_medicine/EVMS_Critical_Care_COVID-19_Protocol.pdf 

Virologiste Anne-Mieke Vandamme KUL : fortes doses de vitamine C

La vitamine C aide-t-elle à résister au coronavirus COVID-19 ? : https://frankdelsaert.wordpress.com/2020/03/14/helpt-vitamine-c-weerstand-tegen-covid-19-coronavirus/ 

https://efsa.onlinelibrary.wiley.com/doi/pdfdirect/10.2903/j.efsa.2009.1226 

De la Vitamine C hautement dosée pour prévenir et traiter le COVID-19 ? (Pressenza.com)

Quercetin and Vitamin C : An Experimental, Synergistic Therapy for the Prevention and Treatment of SARS-CoV-2 Related Disease (COVID-19) : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7318306/ 

[60] ZINC

Rôles du zinc dans l’immunité

The immune system and the impact of zinc during aging – PubMed (nih.gov)

Oral zinc supplementation demonstrates the potential to improve immunity and efficiently downregulates chronic inflammatory responses in the elderly. These data indicate that a wide prevalence of marginal zinc deficiency in elderly people may contribute to immunosenescence.

https://academic.oup.com/advances/article/10/4/696/5476413 , dans cet article paru le 22 avril 2019, dans la revue internationale « Advances in Nutrition », intitulé « The Role of Zinc in Antiviral Immunity », il y est dit que le Zinc joue un rôle essentiel dans la santé humaine : « The role of zinc as an antiviral can be separated into 2 categories : 1) zinc supplementation implemented to improve the antiviral response and systemic immunity in patients with zinc deficiency, and 2) zinc treatment performed to specifically inhibit viral replication or infection-related symptoms. »

Traduction : « Le rôle antiviral du Zinc peut être séparé en deux catégories : 1) Le Zinc comme prévention : une supplémentation en Zinc pour améliorer la réponse antivirale et l’immunité systémique chez les patients déficitaires en zinc, et 2) Le Zinc comme traitement spécifique pour inhiber la réplication virale ou les symptômes liés à l’infection. » 

Carences en ZINC :

OLIGO-ELEMENTS – IBC – ULB % (ulb-ibc.be) PDF à télécharger. Page 3/6 :

➢ Déficits en zinc et sélénium liés aux habitudes alimentaires (aliments à densité calorique élevée pauvres en micronutriments) et à l’augmentation des besoins liée au stress oxydant et à l’inflammation.

➢ Si le déficit en zinc est important et si la couverture des besoins est difficile, le recours à des formes orales de zinc est parfois justifié.

➢ Déficit en zinc plus fréquent chez les personnes institutionnalisées : apports alimentaires insuffisants, polymédication fréquente (IEC/ARA II). Associé à une incidence accrue d’infections, un défaut de cicatrisation des plaies (escarres) et une dysfonction du système immunitaire.

The immune system and the impact of zinc during aging – PubMed (nih.gov) Immun Ageing. 2009 Jun 12 ;6 :9. Doi : 10.1186/1742-4933-6-9 : The immune system and the impact of zinc during aging.

 “The trace element zinc is essential for the immune system, and zinc deficiency affects multiple aspects of innate and adaptive immunity.

Many studies confirm a decline of zinc levels with age.

Even marginal zinc deprivation can affect immune function.

Consequently, oral zinc supplementation demonstrates the potential to improve immunity and efficiently downregulates chronic inflammatory responses in the elderly. These data indicate that a wide prevalence of marginal zinc deficiency in elderly people may contribute to immunosenescence.”

Zinc et infections respiratoires :

OMS | Supplémentation en zinc visant à améliorer les effets du traitement chez les enfants atteints d’infections respiratoires (who.int), 2011

Zinc contre infections virales (in vitro) :

Zn2+ Inhibits Coronavirus and Arterivirus RNA Polymerase Activity In Vitro and Zinc Ionophores Block the Replication of These Viruses in Cell Culture (nih.gov) Une expérience conduite in vitro indique que lorsque les limitations à la pénétration intracellulaire du Zn2+ étaient levées, celui-ci inhibe efficacement, à des doses équivalentes à 2.0 μmol/L, l’activité de synthèse de l’ARN viral par le complexe de réplication et de transcription multiprotéique du SARS-CoV, poussant certains auteurs à considérer le zinc comme une option thérapeutique chez les patients atteint par le SARS-CoV-2

Zinc contre COVID-19 :

Zinc for COVID-19 : real-time analysis of all 9 studies (c19zinc.com)

Zinc for the prevention and treatment of SARS-CoV-2 and other acute viral respiratory infections : a rapid review (nih.gov)

[61] SELENIUM

An exploratory study of selenium status in healthy individuals and in patients with COVID-19 in a south Indian population : The case for adequate selenium status : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7657009/ 

Selenium Deficiency Is Associated with Mortality Risk from COVID-19 : https://pubmed.ncbi.nlm.nih.gov/32708526/ 

Early Nutritional Interventions with Zinc, Selenium and Vitamin D for Raising Anti-Viral Resistance Against Progressive COVID-19 : https://pubmed.ncbi.nlm.nih.gov/32784601/ 

Selenium and selenoproteins in viral infection with potential relevance to COVID-19 : https://pubmed.ncbi.nlm.nih.gov/32992282/

Coronavirus : mise en évidence d’un lien entre les niveaux de sélénium et l’évolution de l’infection (trustmyscience.com) 

What about incorporating selenium in the therapeutic regimen of SARS-CoV-2 ? : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7744964/ 

[62] ARTEMISIA ANNUA :

L’Artemisia Annua (armoise annuelle) est un antipaludéen de la pharmacopée traditionnelle africaine et chinoise ayant une action contre le COVID.

Covid-19 : Quel sort pour l’Artemisia ? – Entelekheia.fr

Pas assez chère ? L’Artemisia, mal aimée de la lutte contre la malaria (entelekheia.fr)

Artemisia annua L. extracts prevent in vitro replication of SARS-CoV-2 : https://www.biorxiv.org/content/10.1101/2021.01.08.425825v1 

Artemisia annua : Trials are needed for COVID‐19 : https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7276816/

Artemisia Spp. Derivatives for COVID-19 Treatment : Anecdotal Use, Political Hype, Treatment Potential, Challenges, and Road Map to Randomized Clinical Trials : https://www.ajtmh.org/view/journals/tpmd/103/3/article-p960.xml?tab_body=fulltext 

Artemisia Annua Could Be Promising Treatment for COVID-19 : https://med.uky.edu/news/artemisia-annua-could-be-promising-treatment-covid-19 

Recent lab studies by chemists at the Max Planck Institute of Colloids and Interfaces (Potsdam, Germany) in close collaboration with virologists at Freie Universität Berlin have shown that extract from the medicinal plant Artemisia annua, also known as Sweet Wormwood, is active against SARS-CoV-2

[63] MELATONINE :

Melatonin is significantly associated with survival of intubated COVID-19 patients : https://www.medrxiv.org/content/10.1101/2020.10.15.20213546v1.full.pdf 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7574268/ 

Melatonin is significantly associated with survival of intubated COVID-19 patients, 18 octobre 2020 Preprint medRixv, Vijendra Ramlall & al

Complete version : https://www.medrxiv.org/content/10.1101/2020.10.15.20213546v1 

PDF : https://www.medrxiv.org/content/10.1101/2020.10.15.20213546v1.full.pdf 

Melatonin exposure after intubation is significantly associated with a positive outcome in COVID-19 and non-COVID-19 patients. Additionally, melatonin exposure after intubation is significantly associated with a positive outcome in COVID-19 patients requiring mechanical ventilation.

COVID-19 : La mélatonine est également incorporée dans les protocoles préventifs et thérapeutiques de la FLCCC Alliance et du professeur Paul Marik, aux USA.

I-MASK + : https://covid19criticalcare.com/i-mask-prophylaxis-treatment-protocol/i-mask-protocol-translations/ 

I-MATH + : https://covid19criticalcare.com/math-hospital-treatment/pdf-translations/ 

https://www.youtube.com/watch?v=bJZcDBTEGio  A master-class comprehensive review by Dr. Paul E. Marik (FLCCC Alliance) of the most current scientific insights into the origin, replication, transmission, infectivity, pathophysiology, and treatment of COVID-19.

[64] COLCHICINE :

https://www.icm-mhi.org/fr/salle-presse/nouvelles/linstitut-cardiologie-montreal-icm-annonce-que-letude-clinique-colcorona-patients-atteints-covid-19 

Étude COLCORONA

La colchicine, un médicament connu pour traiter la goutte, est évaluée comme traitement potentiel dans la lutte au coronavirus

= = =

Notre page « Coronavirus, guerre contre l’humanité » régulièrement mise à jour

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

Halte à la mascarade criminelle… Refuser en masse la thérapie génique « vaccinale » anti-COVID et les mesures « sanitaires » abusives de la population (PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , on 22 février 2021 by Résistance 71

Résistance 71

22 février 2021

Mise à jour de Jo sur ce PDF donnant les meilleurs arguments pour la désobéissance contre la dictature sanitaire en place et le refus de l’inoculation à la thérapie génique sauce Pfizer/BioNTech ~ Moderna ~ AstraZeneca.
Il est l’heure de foutre toute cette merdasse dictatoriale par dessus-bord et la remplacer par la société des sociétés des associations libres condérées en une Commune Universelle hors État, hors marchandise, hors argent et hors salariat.
Devenons enfin ce que nous sommes : des êtres vivants, souverains et libres.
Halte aux diktats ! Halte à l’escroquerie planétaire à la COVID et au Réchauffement Climatique Anthropique (RCA).

PDF à lire et diffuser sans aucune modération :
Refuser_la _therapie_genique_antiCOVID

Dernière galéjade du G7 impérialiste et eugéniste : Tout le pouvoir à Bill Gates !

Posted in 3eme guerre mondiale, actualité, colonialisme, coronavirus CoV19, crise mondiale, guerres hégémoniques, guerres imperialistes, ingérence et etats-unis, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , on 21 février 2021 by Résistance 71


G7: Tout le pouvoir à Bill « la piquouze »

Des trucs pareils… ça ne s’invente pas !… (Résistance 71 )

Le G7 donne le pouvoir à Bill Gates contre la COVID et relance la globalisation

Réseau Voltaire

20 février 2021

url de l’article original: https://www.voltairenet.org/article212266.html

Le G7 s’est réuni par visioconférence, le 19 février 2021, au niveau des chefs d’Etat. Pour la première fois, le président Biden y participait.

Le communiqué final, au ton ultra-volontariste, ne contient que deux annonces concrètes : 

  •  Le G7 participera à la « COVAX facility » pour garantir le distribution mondiale équitable de vaccins anti-Covid ; 
  • Le G7 relance la globalisation en mieux : elle sera désormais « équitable ».

Pour comprendre ce qui se cache derrière ce déluge de bonnes intentions, il faut savoir :

  •  La « COVAX facility » est la partie vaccins de l’ACT-A ; une initiative du G20 (24 avril 2020). Il s’agit d’un gropue multilatéral qui coordonne : 

• des gouvernements 

• l’OMS, qui est une organisation intergouvernementale 

• la Coalition pour les innovations en matière de préparation aux épidémies (CEPI), qui est une société privée ; 

• le Gavi – Alliance du Vaccin, qui est un partenariat des secteurs public et privé ; 

• enfin la Fondation Bill et Melinda Gates, qui est une société privée.

L’expression « COVAX facility » est mensongèrement traduite par « facilité COVAX » dans la version française du communiqué final du G7. Elle désigne en fait la capacité de produire des vaccins et de les homologuer d’un coup pour le monde entier. Pour les gouvernements ne disposant pas de grandes administrations d’homologation, cette coordination doit permettre de gagner du temps. Pour le secteur privé, elle doit « ouvrir les marchés ».

Cette coordination ne sera pas présidée par des États, mais par le Gavi, c’est-à-dire dans les faits par la Fondation Bill and Melinda Gates qui en est à l’origine et le contrôle. Elle n’a donc aucune légitimité démocratique. C’est la raison pour laquelle le président Trump avait refusé que les États-Unis y participent.

Il n’existe aucun moyen de vérifier à quoi exactement servira l’argent public versé à la « COVAX facility ». On assiste donc à la mise en place d’un gigantesque système de corruption, comme toujours sous le prétexte de l’urgence.

Les opinions publiques craignent que l’épidémie ne soit utilisée par de grands laboratoires pour s’enrichir de manière disproportionnée, pourtant ces grands laboratoires participeront aux prises de décision dans une coordination délibérément opaque.

Pour le moment, la « COVAX facility » ne travaille qu’avec deux laboratoires (AstraZeneca et Pfizer) ; deux sociétés qui ont déjà violé leurs contrats avec l’Union européenne.

  •  Dans la lignée de cette décision, le G7 a affirmé sa ligne multilatéraliste et globalisante.

• Le « multilatéralisme » se distingue ici de l’« inter-gouvernemental » en ce qu’il s’appuie sur des partenariats public/privé. Le G7 prend acte de l’évolution sociologique intervenue au cours de la crise sanitaire. Désormais des financiers détiennent des fortunes supérieures au budget annuel de bien des États. Les Exécutifs du monde occidental le reconnaissent et décident de partager leur autorité démocratique avec celle de ces multi-milliardaires.

Note de R71 : Nous le disons depuis plus de 10 ans… Ce que l’oligarchie appelle le “Nouvel Ordre Mondial” est la fusion  des états avec la grande entreprise transnationale, ce qui correspond à la définition du fascisme donnée par Mussolini, pour parvenir  à cette métamorphose finale du capitalisme en ce super fascisme supranational verrouillé dans une dictature technotronique mise en place par le secteur privé, en l’occurence ici les GAFAM et les Fondations de tout poil (Gates, Rockefeller, Soros, Ford, Carnegie etc) le tout sous étroit contrôle de la toute puissance financière. Tout ceci n’a jamais eu l’argent pour objectif. L’argent est un outil de corruption suprême qui permet d’acheter le pouvoir dans ce système fondamentalement corrompu depuis sa création. Les oligarques ne savent plus quoi faire de leur fric ! 10 générations ne pourraient pas tout dépenser. L’objectif est le pouvoir et le contrôle absolu sur tout ce qui est présent sur cette planète. Ils ne réussiront que si nous les laissons faire… Il suffit de dire NON ! En masse et c’est fin de partie our ces ordures !

• Au plan économique, la globalisation est une liberté de circulation des produits et des capitaux. C’est ce que le G7 vient de mettre en place pour les vaccins anti-Covid : ceux-ci n’auront plus besoin d’être homologués par chaque État, mais pourront l’être globalement pour tous par une autorité privée associant des États.

Le revers de la globalisation, c’est la disparition de la classe moyenne un peu partout en Occident et les émeutes qui s’en suivent. Aussi le G7 annonce-t-il une mondialisation « équitable » (sic). Or, nul n’est capable de dire ce que recouvre ce doux oxymore.

= = =

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

Les virus mutent… les confinements sont prévus pour durer ad vitam aeternam… Si nous les laissons faire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 19 janvier 2021 by Résistance 71

 

 


Le Pinocchiorona-21…22…23…24…25…26…27…x+1

 

« Des chercheurs qui cherchent on en trouve, mais des chercheurs qui trouvent, on en cherche ! »
~ Coluche ~

 

Les histoires de “mutations” de la COVID19 montrent que les confinements sont prévus pour durer éternellement

 

Brandon Smith

 

Décembre 2020

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-histoires-de-mutations-de-la-covid-19-montrent-que-les-confinements-sont-concus-pour-durer-eternellement

 

Depuis de nombreux mois maintenant, j’avertis que la conception des mesures de confinement de la pandémie est perpétuelle, ce qui signifie que les mesures de confinement sont censées durer éternellement. Nous pouvons le constater dans les commentaires des élites de l’establishment qui font pression pour obtenir ces contraintes ; leur argument le plus fréquent étant que les restrictions liées à la pandémie sont la « nouvelle normalité ». Cette affirmation est soulignée par des globalistes comme Gideon Lichfield du MIT dans son article « On ne va pas revenir à la normale« .

Dans cet article, il déclare :

En fin de compte, cependant, je prédis que nous allons rétablir la capacité de socialiser en toute sécurité en développant des moyens plus sophistiqués pour identifier qui est à risque de maladie et qui ne l’est pas, et en discriminant – légalement – ceux qui le sont.

… on peut imaginer un monde dans lequel, pour prendre un vol, il faudra peut-être être inscrit à un service qui suit vos déplacements via votre téléphone. La compagnie aérienne ne pourrait pas voir où vous êtes allé, mais elle recevrait une alerte si vous avez été à proximité de personnes infectées connues ou de points chauds de la maladie. Les mêmes exigences s’appliquent à l’entrée des grandes salles de spectacles, des bâtiments gouvernementaux ou des centres de transport public. Il y aurait des scanners de température partout, et votre lieu de travail pourrait exiger que vous portiez un moniteur qui surveille votre température ou d’autres signes vitaux. Si les boîtes de nuit demandent une preuve d’âge, elles pourraient à l’avenir exiger une preuve d’immunité – une carte d’identité ou une sorte de vérification numérique via votre téléphone, montrant que vous vous êtes déjà remis ou que vous avez été vacciné contre les dernières souches de virus.

Dans mon article « Vagues de mutilation : La tyrannie médicale et la société sans cash« , j’ai démantelé les arguments de Lichfield et expliqué pourquoi les contrôles que l’establishment tente de mettre en place ont été planifiés longtemps à l’avance. Le « grand reset » et la « quatrième révolution industrielle » sont en cours de développement depuis au moins 2014, date à laquelle ces termes ont été injectés pour la première fois dans les principaux médias économiques. Les idées de société sans cash, d’« économie de partage », de surveillance biométrique des masses, de scores de crédit social, etc. font toutes partie du programme globaliste depuis des décennies. Le coronavirus n’est pour eux qu’une crise utile à exploiter pour justifier les mesures draconiennes qu’ils ont toujours voulues.

Le plan était si prévisible que j’ai même souligné, au début de l’épidémie de coronavirus, que les confinements ne prendraient pas fin même si une vaccination efficace était mise au point, car il leur suffirait de déclarer qu’une « nouvelle mutation » du virus résistante aux traitements existants a été trouvée. Ou bien, ils pourraient concevoir un tout nouveau virus et le diffuser dans la population afin de maintenir la machine à reset en marche.

Il n’est pas surprenant qu’au moment où la nouvelle a été diffusée que les vaccins Pfizer et Moderna, à peine testés et très suspects, étaient mis à la disposition du public, des rapports ont commencé à faire état de mutations du coronavirus, « plus infectieuses« , trouvées dans des endroits comme le Royaume-Uni, l’Inde et l’Afrique du Sud.

Je ne suis pas sûr que les élites puissent être plus transparentes.

Prenez le vaccin Pfizer maintenant et vous pourriez recevoir un passeport d’immunité pendant quelques mois, puis il sera annulé à chaque nouvelle mutation du virus. Vous devez donc vous soumettre à des vaccinations sans fin, dont beaucoup n’ont pas encore été testées et sont potentiellement dangereuses. Comme l’ancien vice-président de Pfizer et d’autres professionnels de la santé l’ont mis en garde, ces vaccins sont comme la roulette russe et pourraient provoquer une réaction auto-immune qui conduirait à la stérilité ou à d’autres réactions nocives.

Les vaccins eux-mêmes sont une solution à court terme, même s’ils sont efficaces. Ils nécessitent plusieurs doses au cours d’un mois, et les vaccinations doivent être renouvelées éventuellement tous les quelques mois. Fondamentalement, cela ne s’arrête jamais. Avec les mutations et les anticorps limités des vaccins, les élites pourraient maintenir les confinements et les contraintes en place pendant de nombreuses années.

L’Organisation Mondiale de la Santé indique clairement que la vaccination ne sera pas nécessairement considérée comme une solution à la propagation du virus. Cela signifie que même si vous êtes vacciné, vous serez toujours considéré comme un porteur et un transmetteur potentiel de la Covid-19, ce qui signifie que les mesures de confinement et les obligations de port de masques ne cesseront pas. Cela soulève la question suivante : quel est l’intérêt du vaccin ?

Le responsable scientifique de l’OMS cite le fait qu’il n’y a pas suffisamment de preuves pour établir que les vaccins empêchent la transmission. Selon cette logique, nous pourrions également soutenir qu’il n’y a pas de preuve que les vaccins sont efficaces à 95%, ou qu’ils sont sûrs à tout le moins.

En attendant, l’OMS et notre sympathique voisin fasciste, le Dr Anthony Fauci, répandent constamment l’histoire selon laquelle la « pire épidémie«  est encore à venir. Il faut que ce train de la peur continue à avancer sur la voie du « Grand Reset », n’est-ce pas ?

Pour les personnes qui croient réellement que la crise de la pandémie de Covid-19 prendra fin après les vaccinations de masse, je suis désolé de le dire, mais vous avez été dupés. Chaque élément de la réponse de l’establishment et chaque déclaration publique qu’ils font indique qu’ils prévoient de violer vos libertés civiles pendant longtemps. Ces promesses d’aide au coin de la rue ? Des mensonges. L’affirmation selon laquelle si vous suivez leur programme, tout reviendra à la normale ? C’est une arnaque. C’est une rhétorique creuse conçue pour vous faire taire et vous soumettre à la tyrannie médicale juste assez longtemps pour que cela devienne irréversible.

Je soupçonne qu’ils espèrent pouvoir conditionner le public au cours des prochaines années à s’adapter simplement aux contrôles jusqu’à ce que nous oubliions ce qu’était la vie avant la pandémie et le reset. Il semble cependant que le plan de reset des globalistes ne se déroule pas très bien.

Les vaccins et les nouvelles sur les mutations semblent précipités, c’est le moins qu’on puisse dire. Au départ, l’establishment a déclaré qu’il faudrait au moins 18 mois rien que pour mettre au point un vaccin à des fins d’essais et de tests, et que les confinements se poursuivraient bien au-delà de ce délai jusqu’à ce qu’une majorité de la population soit immunisée. Au lieu de cela, ils ont lancé plusieurs vaccins en six mois et le récit de la mutation fait déjà la une des journaux.

Je pense que cela est dû au fait que la résistance aux mesures de confinement face à la pandémie s’accroît et que le nombre de personnes refusant de se faire vacciner semble élevé. Comme on le dit, la révolution ne sera pas télévisée, mais il est encore impossible de la cacher complètement.

En Europe, un pourcentage énorme de la population (environ 50 % ou plus selon les pays) hésite à se faire vacciner. Aux États-Unis, les sondages montrent qu’au moins 30 % de la population refusera catégoriquement, tandis que 60 % des gens hésiteront selon l’efficacité du vaccin.

Même un grand nombre d’agents de santé refusent le vaccin, et ce sont ces personnes qui subissent le plus de pression pour se soumettre ou faire face aux conséquences.

Hilarant, les médias affirment que bien qu’il y ait eu « quelques réactions allergiques » au vaccin, il n’y a « aucune preuve d’effets secondaires graves à long terme ». Peut-être est-ce parce qu’il n’y a aucune étude des effets à long terme et qu’il y a eu un minimum d’essais avant que les vaccins ne soient mis sur le marché ? N’est-ce pas là une logique de base ? Pensent-ils vraiment que nous sommes aussi stupides ?

Jusqu’à présent, il semble que des centaines de millions de personnes ne soient pas aussi bêtes. Étonnamment, même des shérifs et des policiers dans tout le pays refusent ouvertement d’appliquer les mandats et d’infliger des sanctions au nom de la loi aux citoyens qui ne se soumettent pas. C’est vraiment un énorme obstacle pour les globalistes et leur reset.

Le virus a produit un IFR (Taux de létalité) de 0,26% chez toute personne ne se trouvant pas dans une maison de retraite avec des conditions préexistantes. Plus de 40 % des décès dus au Covid sont attribués à des personnes âgées qui souffraient déjà de nombreuses affections. Seulement 10 % environ des personnes qui finissent par être hospitalisées à cause de la Covid-19 souffrent de problèmes de santé à long terme (plus de trois mois). De plus, seuls 15 % environ des lits de soins intensifs sont utilisés aux États-Unis, ce qui signifie que les allégations de surcapacité et d’hôpitaux pleins n’étaient rien de plus que de la peur pour susciter des craintes, depuis le début.

Considérez le fait que des centaines de milliers de personnes meurent déjà chaque année de maladies infectieuses comme la grippe et la pneumonie et la Covid-19 commence à sembler beaucoup moins menaçant. Ce n’est certainement pas une excuse pour les confinements médicaux et les mesures orwelliennes de recherche des contacts.

En outre, de nombreuses études révèlent que les mesures de confinement et les masques sont totalement inefficaces pour arrêter la propagation du virus. Les États et les pays dont les contraintes sont parmi les plus strictement appliqués ont également tendance à être les endroits où les pics d’infection sont les plus élevés.

C’est pourquoi il est logique que de nombreuses personnes refusent de se conformer à ces contraintes. Les médias prétendent que nous sommes des théoriciens de la conspiration qui croient que le virus « n’existe pas » ; ce n’est pas le cas. En fait, je soupçonne depuis longtemps que le récit selon lequel le virus « n’existe pas » était une psy-op ou un homme de paille qui serait utilisé contre le mouvement de la liberté plus tard pour discréditer notre résistance aux confinements médicaux.

La plupart d’entre nous sont bien conscients de l’existence du virus. Certains d’entre nous l’ont déjà combattu et s’en sont remis. Ce que nous disons, c’est que le CDC, l’OMS et les propres statistiques de la communauté médicale montrent que la Covid-19 n’est pas une menace pour plus de 99% de la population. Si nous devons accepter leurs statistiques comme étant même très peu précises, alors la Covid-19 devient un non-problème pour la plupart des gens.

Une fois de plus, je poserai la question que les médias dominant refusent de poser :

Pourquoi dit-on à 99 % de la population qu’elle doit sacrifier son emploi, ses entreprises et ses libertés au nom de la sécurité de moins de 1 % de la population ? Pourquoi ne pas demander aux 0,26% de personnes menacées par le virus de se porter volontaires pour rester chez elles afin que le reste d’entre nous puisse reprendre une vie normale ? Pourquoi faisons-nous le contraire de ce qui est le plus logique ?

La réponse est que la réponse à la pandémie est une question de domination, et non de santé publique. Les gens commencent à s’en rendre compte et ils sont sur le point de se révolter.

Donc, la prochaine étape logique pour l’establishment, s’il veut vraiment mettre en place son programme de reset, est d’introduire une nouvelle menace. Cela signifie qu’ils ont besoin d’une « mutation » du virus ou d’un tout nouveau virus afin de créer le genre de peur nécessaire pour manipuler le public et l’amener à accepter un contrôle plus poussé.

Un nouveau virus plus mortel sera-t-il découvert ? Peut-être. Dans la plupart des cas, les virus ont tendance à évoluer vers des souches moins mortelles que l’original. Ils ont également tendance à équilibrer leur taux de propagation et leur taux de mortalité. En d’autres termes, comme toute autre créature, les virus évoluent pour survivre, et un virus ne peut pas survivre s’il tue la majorité de ses hôtes potentiels. Ainsi, ils mutent pour devenir plus infectieux, mais invariablement moins mortels.

Si une « mutation » plus mortelle que la forme actuelle de la Covid-19 apparaît sur la scène, je serais très méfiant quant à ses origines. Le plus probable est que les élites sont en panique et qu’elles utilisent le récit de la mutation comme un outil de propagande pour semer la terreur et le conformisme dans le public. Il se peut qu’il n’y ait pas de mutation du tout, ou que les mutations n’aient aucune incidence significative sur le taux de mortalité.

Ironiquement, en lançant à la hâte les vaccins et les histoires de mutation, les élites se sont sabotées elles-mêmes. Elles ont voulu faire un blitzkrieg du public avec les confinements et elles ont rencontré une résistance plus forte que prévu. Ils ont donc mis le programme de vaccination sur un train fou et maintenant le public se méfie de se faire injecter un modèle de vaccin à peine testé. Maintenant, ils font la promotion du croque-mitaine de la mutation et cela ne fait que faire se demander pourquoi les gens devraient prendre n’importe quel vaccin ? Si le virus va continuellement muter, alors pourquoi prendre un vaccin douteux qui pourrait être inutile en quelques mois ?

Le récit de la mutation ne fait qu’exposer davantage ce qui est vraiment à l’ordre du jour : ce que les élites veulent, c’est un enfermement sans fin. Il n’y a pas de programme pour sauver des vies ou aplatir la courbe. Tout l’argument de la santé est une absurdité totale. Rien de ce qui a été fait jusqu’à présent ne soutient l’idée que la santé publique est la priorité. Au lieu de cela, nous assistons à une course folle vers le totalitarisme en utilisant la Covid-19 comme excuse, et l’effort échoue.

= = =

Voir notre page « Coronavirus, guerre contre l’humanité »

 

COVID-19 fabrication de pandémie et falsification des données, mensonges d’état pour dictature technotronique… Présentation du livre « Le virus et le président » (Izambert-Janvier)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 16 janvier 2021 by Résistance 71

 



 

COVID-19 le vaccin inachevé

 

Jean-Loup Izambert et Claude Janvier

 

Reçu par courriel des auteurs le 13 janvier 2021

 

Commander le livre : https://www.is-ebooks.com/produit/194/9782368452905/le-virus-et-le-president 

 

Impossible d’ignorer que Pfizer et Moderna ont créés en moins d’une année un vaccin ARN messager décrit et salué par des médecins, des politiciens et la presse main stream comme révolutionnaire et efficace contre le Coronavirus. Une vraie prouesse ! Et une vaste fumisterie qui cache les objectifs réels de ces  producteurs de « vaccins miracle ». Avec la complicité du gouvernement français.

Tout est bon pour inciter les citoyens à se faire injecter le précieux liquide. Du chef de l’Etat, en passant par les ministres, les parlementaires, les médias et une certaine caste de médecins, la propagande bat son plein. Comme si cela ne suffisait pas, un collectif d’artistes s’est formé afin de marteler le message tout en louant les vertus de ce vaccin1. Du reste que connaissent-ils ces artistes du processus de la mise au point d’un vaccin ? Rien ! Strictement rien ! Leur démarche est guidée par le bla-bla des lobbyistes des laboratoires et des toubibs médiatiques comme Karine Lacombe, récemment promue pour recevoir la Légion d’honneur en récompense de … Et bien, bonne question, on ne sait pas. Certainement pour son nombre d’interviews record. Elle va bientôt figurer en pôle position dans le Guinness. Pendant ce temps-là, d’autres docteurs et infirmières travaillant en milieu hospitalier nuits et jours ne bénéficieront pas de la même reconnaissance officielle. Pour ces derniers le pouvoir réserve matraques, gazages, arrestations et amendes s’ils viennent à protester contre sa politique de liquidation du système de santé publique.

Quant aux artistes engagés pour la vaccination, on retrouve entre autre Berléand2 qui avait dévoilé son mépris pour le peuple et les Gilets Jaunes, et le décevant Grand Corps Malade. En effet, avec sa chanson « Pas essentiel », on s’attendait à plus de réflexion3. Ce qui est dommage c’est que tout ce beau monde est fermement persuadé que, grâce à cette vaccination, la vie va reprendre comme avant. Retour à la normale, jouée en partition uniquement pour pipeau et violon ! 

Cette légion d’honneur, distribuée à tout-va comme des confettis à des enfants, ne signifie plus grand chose à part récompenser certains malfaisants. Jacques Servier, feu le grand patron des laboratoires du même nom, s’était vu remettre la décoration prestigieuse en plein scandale du Médiator. Rappelons que pendant trente ans, de 1976 à 2009, ce produit dangereux à été prescrit à plus de 5 millions de patients. Jugement final en 2021. Un record de « rapidité » dû à l’état de délabrement avancé du système judiciaire français que mettent en évidence depuis plusieurs années les enquêtes de la Commission européenne pour l’efficacité de la justice (CEPEJ). Entre 220 et 300 décès à court terme et entre 1300 et 1800 à long terme4.  Ce qui n’a pas empêché Nicolas Sarkozy, alors chef de l’Etat à l’époque, de remettre à Servier, le 7 juillet 2009, la plaque et le cordon de grand-croix – la plus haute distinction – de la Légion d’honneur5, alors que la célèbre pneumologue Irène Frachon, dans son livre – Médiator 150 mg, combien de morts ? – publié deux ans plus tôt dénonçait les méfaits du médicament « miracle ». 

Mais revenons à ce vaccin miraculeux fabriqué en moins d’un an. Les chercheurs ont bossé nuit et jour. Quand il y a des bénéfices à faire, pas d’hésitation…

Effets indésirables graves : la question est loin d’être résolue

Le professeur Raoult que l’on ne présente pas déclare le 8 janvier 2021 que ce vaccin n’est pas la baguette magique qui va arrêter l’épidémie. Extrait de l’article « … Je pense que la plupart d’entre eux (les vaccins) ne présentent pas de risques à court terme. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : il ne s’est pas passé de choses extraordinaires. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : Je ne le crois pas non plus. »6.

Côté Pfizer, le vaccin Covid-19 assurerait une efficacité globale de 80,2 % après la première injection, atteignant 94,1 % 14 jours après la seconde injection7.  

Côté Vidal, la bible des médecins, au 10 décembre 2020, dans son article  « Vaccin Pfizer/Biontech contre la Covid-19 : Enfin des données à analyser ! » : « un taux de protection de 52,4 % dès la première injection » mais surtout : « Les questions relatives à l’efficacité qui demeurent en suspens », « Des effets indésirables post-injection plus sévères chez les moins de 56 ans », « Les questions relatives à la toxicité qui demeurent en suspens »… Puis plus loin : « La possibilité d’effets indésirables graves, rares ou décalés dans le temps »8 ; « La toxicité chez les moins de 16 ans, les femmes enceintes et allaitantes et les personnes immunodéprimées ». Le Vidal souligne en conclusion : « la question d’une éventuelle toxicité à long terme se pose toujours, ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » En  cas d’effets indésirables graves possibles, qui ne semblent  nullement gêner ceux qui vaccinent avec ces vaccins inachevés, rendez-vous à l’hôpital s’il reste des lits hospitaliers ou au…cimetière. 

Le prix de l’incompétence

Comment ignorer que le développement et la mise au point d’un vaccin prend en moyenne une dizaine d’années en respectant le principe de précaution qui permet de s’assurer qu’il soit sans danger pour l’homme avant sa mise sur le marché ?

« Des prototypes de candidats-vaccins sont mis au point en laboratoire à partir de germes, puis on lance la production pharmaceutique et on réalise les premiers tests sur des animaux. Il faut ensuite obtenir des autorisations réglementaires pour mener des essais cliniques, plus vastes sur l’Homme. »9

Admettons quand même que ce vaccin soit efficace à 94,1 %. Si tel était le cas, et s’il protégeait réellement les vaccinés, pourquoi obliger ceux qui n’ont pas envie d’être vacciné à l’être ? Pourquoi vouloir établir un « passeport de santé/vaccination » qui serait exigible avant de prendre un avion, de monter dans un train, ou d’aller au spectacle ? La vérité semble ailleurs…

Nos braves artistes partant en guerre pour que tout le monde se fasse vacciner, feraient bien de revoir leurs copies. Car, s’ils s’imaginent que les salles de spectacles, les théâtres, les cinémas, et les restaurants (pour manger un petit bout en fin de soirée), vont réouvrir très vite, ils se fourrent le doigt dans l’oeil jusqu’au coude. 

Comment voulez-vous que le Conseil scientifique donne son feu vert à la liberté, vu que Jean-François Delfraissy, le  président du Conseil scientifique du pouvoir, a déclaré le 18 décembre 2020 que 2021 ressemblera à 2020.10. Tout comme il avait déjà déclaré en 2009 qu’il allait falloir vacciner deux fois les Français contre le virus de la grippe H1N1, alors présentée comme une terrible pandémie. Terrible au point qu’elle disparut en une année presqu’aussi vite qu’elle avait surgit … Coût pour l’Etat de ces prévisions aussi alarmistes qu’infondées et fumeuses : plus de 500 millions d’euros pour la seule opération vaccin dont des millions de doses seront annulées après dédommagements financiers de ses producteurs et 15 millions d’autres détruites ! Banco. 

Comme le reconnut lui-même le professeur Delfraissy une fois que l’orage fût passé, il « n’était pas un spécialiste des virus de la grippe », pas plus qu’il ne l’est d’ailleurs aujourd’hui de ce coronavirus. Voilà qui « rassure » et laisse déjà entrevoir que la nouvelle ardoise laissée par ce régime et ses conseillers – des milliards d’euros avec un nouveau surendettement du pays – pourrait bien tomber plus vite que prévu comme des tuiles sur la place publique.  

Un vaccin est normalement sensé vous immuniser contre une maladie. Si vous êtes vacciné contre le tétanos, vous êtes protégé à 100 %. Extrait du Vidal : « La vaccination contre le tétanos est efficace à 100 % et cette maladie a quasiment disparu dans les pays, dont la France, où une politique vaccinale complète est appliquée et réalisée. De 2005 à 2017, 112 cas de tétanos ont été déclarés en France – sois moins de 10 par an. » Si le vaccin contre la Covid-19 ne peut être efficace à 100% en 2021, aucun de ses fabricants ne peut garantir sa sûreté. Ceux-ci ne s’étendent pas sur ses possibles effets secondaires. Comme on les comprend. 

Si le vaccin vous rend malades, on y est pour rien…

Une réunion du comité consultatif de la Food and Drug Administration (FDA) des États-Unis intitulée Vaccins et produits biologiques connexes qui s’est tenue le 22 octobre 2020 n’a-t-elle pas listé 22 conséquences négatives possibles, y compris la mort, avec ces vaccins alors en cours d’élaboration ?11 Cette liste, projet de travail sur les événements indésirables très graves pouvant survenir, n’incluait pas tous les effets négatifs mineurs et non étudiés sur la santé qui résulteront de ces injections pour une raison simple : ceux-ci ne peuvent apparaître qu’au bout de plusieurs années.

Voilà qui explique pourquoi les dirigeants de ces transnationales de la pharmacie ont été jusqu’à solliciter très fortement la Commission « européenne » afin qu’elle les décharge de leurs responsabilités sur les effets secondaires. Extrait de l’article LCI du 22 septembre 2020 : «  Le 27 août, la Commission européenne a confirmé être en discussion avec les laboratoires » sur ce sujet. Ces clauses sont ainsi en discussion afin de « compenser les risques élevés pris par les laboratoires ». Risques élevés ? Risques de pertes de profits faramineux par la vente de vaccins qui ne peuvent qu’être inachevés dans leur conception au moment de leur mise sur le marché ? Non, risques financier pour des effets secondaires liés à « une éventuelle toxicité à long terme (qui) se pose toujours » en début d’année 2021 « ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » Et c’est justement pourquoi « les contrats d’achat anticipé prévoient que les états membres de l’UE indemnisent les fabricants pour les responsabilités encourues dans certaines conditions. »12 

Cerise sur le gâteau, ces vaccins ne garantiraient qu’une immunité de quelques mois, variable selon les fabricants. Ensuite rebelote pour une injection et jackpot pour Pfizer, Moderna et les autres. 

On imagine mal que des producteurs de vaccins assurés de l’efficacité et de la sûreté de leurs produits aillent quémander l’aide d’un Etat qu’ils ne cessent de stipendier au nom de la « libéralisation des entreprises » et auquel ils reprochent un prétendu « interventionnisme » pour qu’il prenne à sa charge les déboires qui pourraient survenir après l’injection de leur « vaccin révolutionnaire » 

Aussi, nul besoin d’être un grand devin pour deviner que le délire confinatoire avec port du masque et couvre feu va continuer alors que le mardi 12 mars 2020, l’inénarable Directeur général de la Santé, Jérôme Salomon, déclarait que « 98% des gens guérissent » de la Covid-19. Et attention, en matière de coronavirus le haut fonctionnaire Jérôme sait de quoi il parle : c’est lui qui annonça le 3 février 2020 qu’ « il n’y a pas d’épidémie en France, même pas de chaîne de transmission dans notre pays et aucune circulation du virus sur le territoire. » Le jour même la France comptait ses six premiers cas confirmés porteurs du virus SRAS-CoV-2, 57 le 29 du même mois et 191 avec le premier décès le 3 mars !

Notre enquête

 Se soigner ? Du repos chez soi, et pour aider, du zinc, de la vitamine D, de la vitamine C, de l’aspirine ou du Doliprane13, 14. Mais alors que devient l’Hydroxychloroquine, interdite par la « sinistre » de la Santé Buzyn aux médecins généralistes bien que ceux-ci parviennent à soigner des malades à l’hôpital s’ils sont traités dès les premiers symptômes ? 

Difficile de s’y retrouver dans les affirmations les plus contradictoires qui agitent la communauté scientifique auxquelles s’ajoutent les fausses  nouvelles diffusées par le Premier ministre et certaines administrations. Rien d’étonnant pourtant puisque ce coronavirus est nouveau pour les chercheurs, du moins pour ceux qui ne travaillent pas à la mise au point d’armes biologiques offensives dans l’un de ces laboratoires de l’armée des Etats-Unis échappant à tout contrôle international. Mais ceci est une autre histoire, celle de guerres biologiques et chimiques qui ne commencent ni en République populaire de Chine, ni en France mais au cœur de la Maison Blanche…

Nous sommes journalistes et non scientifiques et notre rôle est de rapporter avec rigueur à la population les informations et les idées qui circulent dans la société. Nous n’avons pas la prétention d’affirmer ce qu’il faut faire ou ne pas faire au plan médical ainsi que s’y ridiculisent des éditocrates parisiens et autres médecins imaginaires autoproclamés qui se répandent dans des médias dont les transnationales de Big Pharma sont l’un des principaux annonceurs. Par contre nous avons la détermination inébranlable de dénoncer les fausses informations, d’où qu’elles viennent, en nous appuyant sur des sources fiables – Insee, CNRS, Inserm, etc. -, en vérifiant et croisant leurs données et en analysant les faits avec le nécessaire recul. 

La pratique rigoureuse de l’enquête journalistique implique de suivre la « règle des trois principes » : bannir toute idée reçue, ne faire confiance à personne, vérifier les informations par recoupements. C’est pourquoi nous pouvons affirmer que ce gouvernement ment à l’opinion publique lorsqu’il prend prétexte d’une prétendue virulence du virus pour imposer de nouvelles mesures qui détruisent le contrat social français. Parvenu à ce stade de mensonge d’Etat, ce gouvernement n’a plus d’autre choix que d’entretenir la peur pour endiguer la révolte qui menace et permettre aux sociétés transnationales de la pharmacie d’écouler leurs millions de doses de vaccins autant inutiles qu’inachevés. 

Vous doutez ?

Fausses informations gouvernementales

Un nouvel exemple de l’esbroufe gouvernementale appert en début d’année 2021 : le nombre de personnes contaminées par la Covid-19 annoncé en décembre 2020 par le gouvernement, son ministre de la santé et son administration, et relayé par la plupart des médias, est de 1068 cas confirmés par semaine par million d’habitants. Cette statistique est diffusée par la plateforme ouverte des données publiques françaises (www.data.gouv.fr, https://LaFibre.info/Covid19, Comparatif du nombre de cas Covid-19 par semaine entre pays rapporté par million d’habitants, mise à jour du 06 décembre 2020 à 17h.)

Or, si l’on examine de près les chiffres du réseau Sentinelles de l’Institut national de la santé et de la recherche médicale (Inserm) composé de 1200 cabinets médicaux sur tout le territoire, ce rapport s’avère bien différent : 14 cas pour 100 000 personnes soit environ 140 cas pour un million d’habitants. Huit fois moins ! Rappelons que le taux de Sentinelles correspond aux vrais malades symptomatiques rencontrés dans les cabinets médicaux et testés. Ainsi que l’indique le réseau Sentinelles dans son bulletin sur la situation observée pour la semaine 53 – du 28 décembre 2020 au 03 janvier 2021-, « à partir des données cliniques et virologiques concernant les cas d’IRA (NdA : Infections respiratoires aiguës) vus en consultation de médecine générale, il est possible d’estimer la part de ces cas dus au COVID-19. » En semaine 53 à cheval entre décembre 2020 et janvier 2021, « aucun prélèvement n’a été testé positif au SARS-CoV-2 (COVID-19) parmi les prélèvements analysés. Ceci permet d’estimer que le taux d’incidence des cas d’IRA dus au SARS-CoV-2 (COVID-19) vus en médecine générale serait inférieur à 14 cas pour 100 000 habitants, représentant moins de 9 097 nouveaux cas de COVID-19 ayant consulté un médecin généraliste. » Précision de l’Inserm : « Cette estimation est stable par rapport aux semaines précédentes. » Quel média vous a rapporté ces faits et cette « stabilité par rapport aux semaines précédentes » ?… Le seuil épidémique étant de 150 à 200 cas pour 100 000 personnes, il est permis d’affirmer que le virus est en voie de disparition. 

Aussi, la troisième vague, le reconfinement, le couvre-feu et autres mesures annoncées par le gouvernement à grand renfort de médias semblent n’avoir qu’une raison d’être : entretenir la peur pour écouler le stock de millions de doses de vaccins ! Olivier Veran, ministre des Solidarités et de la Santé, ne tient visiblement pas à jouer « Bachelot 2 le retour » sur les traces de la « sinistre » de la Santé du gouvernement Fillon. Rappelez-vous : en 2010 celle-ci, suivant à la lettre les conseils du même Jean-François Delfraissy et de son équipe pour contrer la grippe H1N1, s’était retrouvée avec des dizaines de millions de doses de vaccins inutiles…

Les « profiteurs pandémiques »

Ceux qui depuis le début de l’année 2020 n’arrêtent pas de diffuser des annonces gouvernementales et d’administrations sans les vérifier puisqu’émises par des sources officielles  – donc a priori crédibles – se retrouvent, devant les arguments que nous présentons aux lecteurs, seuls et démunis avec le sentiment d’avoir été trompés par le pouvoir et ses représentants pour les plus honnêtes et professionnels d’entre eux. Si, si, il en existe encore… Si des erreurs peuvent survenir dans la création et la diffusion d’informations, celles-ci répétées dans le temps sur un même sujet façonnent ce qui s’appelle un mensonge d’Etat.

Ceux qui en font les frais ? 

Les professionnels de la santé et, d’une manière générale, les salariés des entreprises, les transporteurs, commerçants, artisans, hôteliers-restaurateurs, patrons de boîtes nuits, autocaristes, TPE et PME-PMI, les professions du spectacle et de l’événementiel, les salles de sports…Bref, tous les entrepreneurs et indépendants, qui grâce à leur travail et à leur dur labeur font vivre leurs familles et donnent de la convivialité à notre nation sont en train de disparaître.

En revanche, comme nous le montrons dans Le virus et le président, les « profiteurs pandémiques » se portent plutôt très bien. Parmi eux, les sociétés transnationales du CAC 40 – dont celles de la pharmacie – qui, tout en réalisant les plus importants chiffres d’affaires reçoivent, bon an mal an, plus de 200 milliards d’euros de subventions publiques et d’exonérations fiscales de l’Etat et de l’Union dite « européenne » et continuent de coter à la hausse en Bourse tout en tuant des milliers et des milliers d’emplois en France. C’est un peu aussi pourquoi nous disons que lorsque le président Macron qui a consacré son temps, depuis qu’il s’est assis en 2012 près de l’ancien président François Hollande, a privatiser l’économie, créer du chômage, réduire encore le système de santé publique, endetter le pays, déclare vouloir « reconstruire une économie forte et souveraine » c’est un peu comme si une dinde fêtait Noël.

Le livre qui dérange

Le virus et le président n’oublie pas ces fauteurs de crise tant sanitaire qu’économique et financière. Vous y lirez comment les privilégiés du système se gavent des richesses de notre beau pays avec le concours de parlementaires qui, pour la plupart, ne sont plus que des sortes de greffiers de la Commission « européenne » qui confinent le budget de la Santé publique dans l’une des dernières places du budget de l’Etat. Pendant que la France du travail et de la création perd sa santé jusqu’à l’agonie sur l’une des toutes premières marches du podium du taux de suicide d’Europe occidentale, des profiteurs sans scrupules la pillent en flux tendu 24 heures sur 24. La fable du « vaccin miracle » inachevé contre la Covid-19 ne raconte pas une autre histoire que celle des manigances de ces accapareurs à la recherche de profit maximum immédiat quelles qu’en soient les conséquences pour le peuple.

Ce vol noir de corbeaux sur le pays qu’ils enchaînent à coups d’ordonnances de l’Union « européenne » et de lois liberticides et anti-sociales est le tableau « idyllique » annoncé par Klaus Schwab, le fondateur de Davos et de son Forum Economique Mondial, ainsi qu’il l’explique dans son livre, Covid-19 : la grande réinitialisation. C’est écrit noir sur blanc et ce n’est pas complotiste. C’est une réalité qui est en train de s’étendre, comme une gangrène malfaisante à toute la planète15. Aussi, le temps de la perdition, de la désespérance et du silence est révolu. Place à la réflexion, au débat et à l’action ! 

Notre livre Le virus et le président, (IS Edition, www.is-edition.com), qui vient de sortir souhaite y contribuer, peut vous éclairer, vous permettre de comprendre comment et pourquoi le pouvoir vous trompe, favoriser le débat, inciter à rechercher et à écrire les propositions qui permettront de changer de cap. Enquêtes minutieuses, faits, chiffres, zestes d’humour16… 

Le vaccin inachevé ? Comme pour ses promoteurs et propagandistes, au vu de ce qui précède, vous aurez deviné notre position. 

Jean-Loup Izambert et Claude Janvier

Notes :

1.https://www.msn.com/fr-fr/actualite/france/appel-de-200-artistes-pour-la-vaccination-c-est-le-seul-moyen-de-sortir-de-ce-bordel/ar-BB1cyLhj?ocid=msedgdhp et https://www.leparisien.fr/culture-loisirs/covid-19-l-appel-de-200-personnalites-de-la-culture-qui-veulent-se-faire-vacciner-06-01-2021-8417619.php

2.https://www.lefigaro.fr/cinema/ils-me-font-ch-francois-berleand-s-explique-devant-des-gilets-jaunes-20191209

3.https://www.youtube.com/watch?v=NencPkx7qgY

4.https://www.lepoint.fr/justice/proces-mediator-dernier-round-07-07-2020-2383304_2386.

5.https://www.nouvelobs.com/societe/20111010.OBS2124/nicolas-sarkozy-et-la-legion-d-honneur-le-revers-de-la-medaille.html

6.https://www.lindependant.fr/2021/01/08/covid-19-pour-didier-raoult-le-vaccin-nest-pas-la-baguette-magique-qui-va-arreter-lepidemie-9299989.php

7.https://www.vidal.fr/actualites/26337-vaccin-pfizer-biontech-contre-la-covid-19-enfin-des-donnees-a-analyser.html

8.https://www.vidal.fr/actualites/26105-vaccins-contre-la-covid-19-doit-on-s-inquieter-du-risque-de-maladie-aggravee-chez-les-personnes-vaccinees.html

9.https://www.santemagazine.fr/traitement/medicaments/vaccins/vaccins-contre-le-coronavirus-quelles-differences-pour-qui-quand-873097

10.https://www.ouest-france.fr/sante/virus/coronavirus/covid-19-jean-francois-delfraissy-2021-ressemblera-a-2020-7091792 

11.FDA U.S., Food & Drug Administration, Steve Anderson, VRBPAC, meeting October 22, 2020. Vaccines and Related Biological Products Advisory Committee (VRBPAC), October 22, 2020. Meeting Announcement. La FDA révèle une longue liste de problèmes de santé graves pouvant résulter de la vaccination contre le covid-19, y compris la mort, par Lance D.Jolmage, Natural News, mercredi 09 décembre 2020.

12.https://www.lci.fr/sante/vaccins-contre-le-covid-19-les-laboratoires-seront-ils-vraiment-decharges-de-toute-responsabilite-en-cas-d-effets-secondaires-2165265.html

13.https://france3-regions.francetvinfo.fr/occitanie/haute-garonne/toulouse/collectif-medecins-preconise-utilisation-vitamine-du-zinc-prevenir-formes-graves-covid-1908356.html

14.https://www.bfmtv.com/sante/en-combien-de-temps-guerit-on-du-coronavirus_AN-202003120174.html

15.https://blogs.mediapart.fr/semcheddine/blog/011220/covid-19-grande-reinitialisation-ou-insurrection-des-consciences et  https://lecourrierdesstrateges.fr/2020/12/29/le-great-reset-annonce-t-il-la-fin-du-travail-independant/

16.https://www.is-edition.com/actualites/parution-le-virus-et-le-president-jean-loup-izambert-claude-janvier/

 

Lectures complémentaires sur notre page « Coronavirus, guerre contre l’humanité »

 

Escalier de la Grande Réinitialisation… Échafaud vers le N.O.M ou Ascenseur vers l’Émancipation ?

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, N.O.M, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, terrorisme d'état with tags , , , , , , , on 9 janvier 2021 by Résistance 71

A nous de choisir… à personne d’autre…
A la croisée des chemins ce sera N.O.M ou ÉMANCIPATION et Société des Sociétés

Communiqué de presse de l’association Réaction 19 concernant la plainte pénale déposée contre l’utilisation des vaccins

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, Internet et liberté, média et propagande, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 5 janvier 2021 by Résistance 71

 

 


+ Moderna + AstraZeneca… L’humanité en péril

 

Association Réaction 19

 

4 janvier 2021

 

Communiqué de l’Association Réaction 19

4 janvier 2021

L’Association RÉACTION 19, co-présidée par Messieurs Carlo Alberto BRUSA et Riccardo MEREU, est une association loi 1901 qui compte aujourd’hui près de 40 000 adhérents et plus de 60 000 sympathisants, dont l’objet est de veiller au respect des libertés fondamentales, notamment dans le cadre de l’épidémie de la COVID-19.

L’Association RÉACTION 19 a, le 16 décembre 2020, déposé une plainte concernant les thérapies géniques Pfizer/BioNTech et Moderna, communément dénommées « vaccins ». Des chefs de :

  • mise en danger délibérée de la vie d’autrui ;
  • tromperie aggravée ;
  • abus de faiblesse ;
  • extorsion aggravée.

Déjà plus de 5 000 personnes ont déclaré s’associer à cette plainte, ce chiffre ne cessant de croître. Leurs interventions volontaires seront déposées auprès du Procureur de la République dans les prochains jours.

La plainte, enregistrée sous le numéro 20351000746, demeure entre les mains de la Justice et du Procureur de la République de Paris.

L’Association RÉACTION 19 a également adressé aux prescripteurs desdits « vaccins », notamment à l’ensemble des députés et sénateurs, au président de la République, au premier ministre, au ministre de la Santé et aux médecins, une déclaration d’engagement de responsabilité civile et pénale quant aux effets secondaires de ces « vaccins » pouvant aller jusqu’à la mort.

À ce jour, aucun des prescripteurs susdits n’a signé cette déclaration et n’a donc accepté d’engager sa responsabilité personnelle sur les conséquences de cette politique vaccinale.

Fait à Paris, le 30 décembre 2020.

Pour l’Association RÉACTION 19
Monsieur Carlo Alberto BRUSA
Président
63, rue la Boétie – 75008 PARIS
Mail : reaction19fr@gmail.com

= = =

Format PDF :

Communiqué-de-presse-relatif-à-la-plainte-pénale-rel-ative-aux-vaccins

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »