Archive pour coronavirus eugénisme nouvel ordre mondial

Les virus mutent… les confinements sont prévus pour durer ad vitam aeternam… Si nous les laissons faire…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 19 janvier 2021 by Résistance 71

 

 


Le Pinocchiorona-21…22…23…24…25…26…27…x+1

 

« Des chercheurs qui cherchent on en trouve, mais des chercheurs qui trouvent, on en cherche ! »
~ Coluche ~

 

Les histoires de “mutations” de la COVID19 montrent que les confinements sont prévus pour durer éternellement

 

Brandon Smith

 

Décembre 2020

 

Source de l’article en français:
https://lesakerfrancophone.fr/les-histoires-de-mutations-de-la-covid-19-montrent-que-les-confinements-sont-concus-pour-durer-eternellement

 

Depuis de nombreux mois maintenant, j’avertis que la conception des mesures de confinement de la pandémie est perpétuelle, ce qui signifie que les mesures de confinement sont censées durer éternellement. Nous pouvons le constater dans les commentaires des élites de l’establishment qui font pression pour obtenir ces contraintes ; leur argument le plus fréquent étant que les restrictions liées à la pandémie sont la « nouvelle normalité ». Cette affirmation est soulignée par des globalistes comme Gideon Lichfield du MIT dans son article « On ne va pas revenir à la normale« .

Dans cet article, il déclare :

En fin de compte, cependant, je prédis que nous allons rétablir la capacité de socialiser en toute sécurité en développant des moyens plus sophistiqués pour identifier qui est à risque de maladie et qui ne l’est pas, et en discriminant – légalement – ceux qui le sont.

… on peut imaginer un monde dans lequel, pour prendre un vol, il faudra peut-être être inscrit à un service qui suit vos déplacements via votre téléphone. La compagnie aérienne ne pourrait pas voir où vous êtes allé, mais elle recevrait une alerte si vous avez été à proximité de personnes infectées connues ou de points chauds de la maladie. Les mêmes exigences s’appliquent à l’entrée des grandes salles de spectacles, des bâtiments gouvernementaux ou des centres de transport public. Il y aurait des scanners de température partout, et votre lieu de travail pourrait exiger que vous portiez un moniteur qui surveille votre température ou d’autres signes vitaux. Si les boîtes de nuit demandent une preuve d’âge, elles pourraient à l’avenir exiger une preuve d’immunité – une carte d’identité ou une sorte de vérification numérique via votre téléphone, montrant que vous vous êtes déjà remis ou que vous avez été vacciné contre les dernières souches de virus.

Dans mon article « Vagues de mutilation : La tyrannie médicale et la société sans cash« , j’ai démantelé les arguments de Lichfield et expliqué pourquoi les contrôles que l’establishment tente de mettre en place ont été planifiés longtemps à l’avance. Le « grand reset » et la « quatrième révolution industrielle » sont en cours de développement depuis au moins 2014, date à laquelle ces termes ont été injectés pour la première fois dans les principaux médias économiques. Les idées de société sans cash, d’« économie de partage », de surveillance biométrique des masses, de scores de crédit social, etc. font toutes partie du programme globaliste depuis des décennies. Le coronavirus n’est pour eux qu’une crise utile à exploiter pour justifier les mesures draconiennes qu’ils ont toujours voulues.

Le plan était si prévisible que j’ai même souligné, au début de l’épidémie de coronavirus, que les confinements ne prendraient pas fin même si une vaccination efficace était mise au point, car il leur suffirait de déclarer qu’une « nouvelle mutation » du virus résistante aux traitements existants a été trouvée. Ou bien, ils pourraient concevoir un tout nouveau virus et le diffuser dans la population afin de maintenir la machine à reset en marche.

Il n’est pas surprenant qu’au moment où la nouvelle a été diffusée que les vaccins Pfizer et Moderna, à peine testés et très suspects, étaient mis à la disposition du public, des rapports ont commencé à faire état de mutations du coronavirus, « plus infectieuses« , trouvées dans des endroits comme le Royaume-Uni, l’Inde et l’Afrique du Sud.

Je ne suis pas sûr que les élites puissent être plus transparentes.

Prenez le vaccin Pfizer maintenant et vous pourriez recevoir un passeport d’immunité pendant quelques mois, puis il sera annulé à chaque nouvelle mutation du virus. Vous devez donc vous soumettre à des vaccinations sans fin, dont beaucoup n’ont pas encore été testées et sont potentiellement dangereuses. Comme l’ancien vice-président de Pfizer et d’autres professionnels de la santé l’ont mis en garde, ces vaccins sont comme la roulette russe et pourraient provoquer une réaction auto-immune qui conduirait à la stérilité ou à d’autres réactions nocives.

Les vaccins eux-mêmes sont une solution à court terme, même s’ils sont efficaces. Ils nécessitent plusieurs doses au cours d’un mois, et les vaccinations doivent être renouvelées éventuellement tous les quelques mois. Fondamentalement, cela ne s’arrête jamais. Avec les mutations et les anticorps limités des vaccins, les élites pourraient maintenir les confinements et les contraintes en place pendant de nombreuses années.

L’Organisation Mondiale de la Santé indique clairement que la vaccination ne sera pas nécessairement considérée comme une solution à la propagation du virus. Cela signifie que même si vous êtes vacciné, vous serez toujours considéré comme un porteur et un transmetteur potentiel de la Covid-19, ce qui signifie que les mesures de confinement et les obligations de port de masques ne cesseront pas. Cela soulève la question suivante : quel est l’intérêt du vaccin ?

Le responsable scientifique de l’OMS cite le fait qu’il n’y a pas suffisamment de preuves pour établir que les vaccins empêchent la transmission. Selon cette logique, nous pourrions également soutenir qu’il n’y a pas de preuve que les vaccins sont efficaces à 95%, ou qu’ils sont sûrs à tout le moins.

En attendant, l’OMS et notre sympathique voisin fasciste, le Dr Anthony Fauci, répandent constamment l’histoire selon laquelle la « pire épidémie«  est encore à venir. Il faut que ce train de la peur continue à avancer sur la voie du « Grand Reset », n’est-ce pas ?

Pour les personnes qui croient réellement que la crise de la pandémie de Covid-19 prendra fin après les vaccinations de masse, je suis désolé de le dire, mais vous avez été dupés. Chaque élément de la réponse de l’establishment et chaque déclaration publique qu’ils font indique qu’ils prévoient de violer vos libertés civiles pendant longtemps. Ces promesses d’aide au coin de la rue ? Des mensonges. L’affirmation selon laquelle si vous suivez leur programme, tout reviendra à la normale ? C’est une arnaque. C’est une rhétorique creuse conçue pour vous faire taire et vous soumettre à la tyrannie médicale juste assez longtemps pour que cela devienne irréversible.

Je soupçonne qu’ils espèrent pouvoir conditionner le public au cours des prochaines années à s’adapter simplement aux contrôles jusqu’à ce que nous oubliions ce qu’était la vie avant la pandémie et le reset. Il semble cependant que le plan de reset des globalistes ne se déroule pas très bien.

Les vaccins et les nouvelles sur les mutations semblent précipités, c’est le moins qu’on puisse dire. Au départ, l’establishment a déclaré qu’il faudrait au moins 18 mois rien que pour mettre au point un vaccin à des fins d’essais et de tests, et que les confinements se poursuivraient bien au-delà de ce délai jusqu’à ce qu’une majorité de la population soit immunisée. Au lieu de cela, ils ont lancé plusieurs vaccins en six mois et le récit de la mutation fait déjà la une des journaux.

Je pense que cela est dû au fait que la résistance aux mesures de confinement face à la pandémie s’accroît et que le nombre de personnes refusant de se faire vacciner semble élevé. Comme on le dit, la révolution ne sera pas télévisée, mais il est encore impossible de la cacher complètement.

En Europe, un pourcentage énorme de la population (environ 50 % ou plus selon les pays) hésite à se faire vacciner. Aux États-Unis, les sondages montrent qu’au moins 30 % de la population refusera catégoriquement, tandis que 60 % des gens hésiteront selon l’efficacité du vaccin.

Même un grand nombre d’agents de santé refusent le vaccin, et ce sont ces personnes qui subissent le plus de pression pour se soumettre ou faire face aux conséquences.

Hilarant, les médias affirment que bien qu’il y ait eu « quelques réactions allergiques » au vaccin, il n’y a « aucune preuve d’effets secondaires graves à long terme ». Peut-être est-ce parce qu’il n’y a aucune étude des effets à long terme et qu’il y a eu un minimum d’essais avant que les vaccins ne soient mis sur le marché ? N’est-ce pas là une logique de base ? Pensent-ils vraiment que nous sommes aussi stupides ?

Jusqu’à présent, il semble que des centaines de millions de personnes ne soient pas aussi bêtes. Étonnamment, même des shérifs et des policiers dans tout le pays refusent ouvertement d’appliquer les mandats et d’infliger des sanctions au nom de la loi aux citoyens qui ne se soumettent pas. C’est vraiment un énorme obstacle pour les globalistes et leur reset.

Le virus a produit un IFR (Taux de létalité) de 0,26% chez toute personne ne se trouvant pas dans une maison de retraite avec des conditions préexistantes. Plus de 40 % des décès dus au Covid sont attribués à des personnes âgées qui souffraient déjà de nombreuses affections. Seulement 10 % environ des personnes qui finissent par être hospitalisées à cause de la Covid-19 souffrent de problèmes de santé à long terme (plus de trois mois). De plus, seuls 15 % environ des lits de soins intensifs sont utilisés aux États-Unis, ce qui signifie que les allégations de surcapacité et d’hôpitaux pleins n’étaient rien de plus que de la peur pour susciter des craintes, depuis le début.

Considérez le fait que des centaines de milliers de personnes meurent déjà chaque année de maladies infectieuses comme la grippe et la pneumonie et la Covid-19 commence à sembler beaucoup moins menaçant. Ce n’est certainement pas une excuse pour les confinements médicaux et les mesures orwelliennes de recherche des contacts.

En outre, de nombreuses études révèlent que les mesures de confinement et les masques sont totalement inefficaces pour arrêter la propagation du virus. Les États et les pays dont les contraintes sont parmi les plus strictement appliqués ont également tendance à être les endroits où les pics d’infection sont les plus élevés.

C’est pourquoi il est logique que de nombreuses personnes refusent de se conformer à ces contraintes. Les médias prétendent que nous sommes des théoriciens de la conspiration qui croient que le virus « n’existe pas » ; ce n’est pas le cas. En fait, je soupçonne depuis longtemps que le récit selon lequel le virus « n’existe pas » était une psy-op ou un homme de paille qui serait utilisé contre le mouvement de la liberté plus tard pour discréditer notre résistance aux confinements médicaux.

La plupart d’entre nous sont bien conscients de l’existence du virus. Certains d’entre nous l’ont déjà combattu et s’en sont remis. Ce que nous disons, c’est que le CDC, l’OMS et les propres statistiques de la communauté médicale montrent que la Covid-19 n’est pas une menace pour plus de 99% de la population. Si nous devons accepter leurs statistiques comme étant même très peu précises, alors la Covid-19 devient un non-problème pour la plupart des gens.

Une fois de plus, je poserai la question que les médias dominant refusent de poser :

Pourquoi dit-on à 99 % de la population qu’elle doit sacrifier son emploi, ses entreprises et ses libertés au nom de la sécurité de moins de 1 % de la population ? Pourquoi ne pas demander aux 0,26% de personnes menacées par le virus de se porter volontaires pour rester chez elles afin que le reste d’entre nous puisse reprendre une vie normale ? Pourquoi faisons-nous le contraire de ce qui est le plus logique ?

La réponse est que la réponse à la pandémie est une question de domination, et non de santé publique. Les gens commencent à s’en rendre compte et ils sont sur le point de se révolter.

Donc, la prochaine étape logique pour l’establishment, s’il veut vraiment mettre en place son programme de reset, est d’introduire une nouvelle menace. Cela signifie qu’ils ont besoin d’une « mutation » du virus ou d’un tout nouveau virus afin de créer le genre de peur nécessaire pour manipuler le public et l’amener à accepter un contrôle plus poussé.

Un nouveau virus plus mortel sera-t-il découvert ? Peut-être. Dans la plupart des cas, les virus ont tendance à évoluer vers des souches moins mortelles que l’original. Ils ont également tendance à équilibrer leur taux de propagation et leur taux de mortalité. En d’autres termes, comme toute autre créature, les virus évoluent pour survivre, et un virus ne peut pas survivre s’il tue la majorité de ses hôtes potentiels. Ainsi, ils mutent pour devenir plus infectieux, mais invariablement moins mortels.

Si une « mutation » plus mortelle que la forme actuelle de la Covid-19 apparaît sur la scène, je serais très méfiant quant à ses origines. Le plus probable est que les élites sont en panique et qu’elles utilisent le récit de la mutation comme un outil de propagande pour semer la terreur et le conformisme dans le public. Il se peut qu’il n’y ait pas de mutation du tout, ou que les mutations n’aient aucune incidence significative sur le taux de mortalité.

Ironiquement, en lançant à la hâte les vaccins et les histoires de mutation, les élites se sont sabotées elles-mêmes. Elles ont voulu faire un blitzkrieg du public avec les confinements et elles ont rencontré une résistance plus forte que prévu. Ils ont donc mis le programme de vaccination sur un train fou et maintenant le public se méfie de se faire injecter un modèle de vaccin à peine testé. Maintenant, ils font la promotion du croque-mitaine de la mutation et cela ne fait que faire se demander pourquoi les gens devraient prendre n’importe quel vaccin ? Si le virus va continuellement muter, alors pourquoi prendre un vaccin douteux qui pourrait être inutile en quelques mois ?

Le récit de la mutation ne fait qu’exposer davantage ce qui est vraiment à l’ordre du jour : ce que les élites veulent, c’est un enfermement sans fin. Il n’y a pas de programme pour sauver des vies ou aplatir la courbe. Tout l’argument de la santé est une absurdité totale. Rien de ce qui a été fait jusqu’à présent ne soutient l’idée que la santé publique est la priorité. Au lieu de cela, nous assistons à une course folle vers le totalitarisme en utilisant la Covid-19 comme excuse, et l’effort échoue.

= = =

Voir notre page « Coronavirus, guerre contre l’humanité »

 

COVID-19 fabrication de pandémie et falsification des données, mensonges d’état pour dictature technotronique… Présentation du livre « Le virus et le président » (Izambert-Janvier)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 16 janvier 2021 by Résistance 71

 



 

COVID-19 le vaccin inachevé

 

Jean-Loup Izambert et Claude Janvier

 

Reçu par courriel des auteurs le 13 janvier 2021

 

Commander le livre : https://www.is-ebooks.com/produit/194/9782368452905/le-virus-et-le-president 

 

Impossible d’ignorer que Pfizer et Moderna ont créés en moins d’une année un vaccin ARN messager décrit et salué par des médecins, des politiciens et la presse main stream comme révolutionnaire et efficace contre le Coronavirus. Une vraie prouesse ! Et une vaste fumisterie qui cache les objectifs réels de ces  producteurs de « vaccins miracle ». Avec la complicité du gouvernement français.

Tout est bon pour inciter les citoyens à se faire injecter le précieux liquide. Du chef de l’Etat, en passant par les ministres, les parlementaires, les médias et une certaine caste de médecins, la propagande bat son plein. Comme si cela ne suffisait pas, un collectif d’artistes s’est formé afin de marteler le message tout en louant les vertus de ce vaccin1. Du reste que connaissent-ils ces artistes du processus de la mise au point d’un vaccin ? Rien ! Strictement rien ! Leur démarche est guidée par le bla-bla des lobbyistes des laboratoires et des toubibs médiatiques comme Karine Lacombe, récemment promue pour recevoir la Légion d’honneur en récompense de … Et bien, bonne question, on ne sait pas. Certainement pour son nombre d’interviews record. Elle va bientôt figurer en pôle position dans le Guinness. Pendant ce temps-là, d’autres docteurs et infirmières travaillant en milieu hospitalier nuits et jours ne bénéficieront pas de la même reconnaissance officielle. Pour ces derniers le pouvoir réserve matraques, gazages, arrestations et amendes s’ils viennent à protester contre sa politique de liquidation du système de santé publique.

Quant aux artistes engagés pour la vaccination, on retrouve entre autre Berléand2 qui avait dévoilé son mépris pour le peuple et les Gilets Jaunes, et le décevant Grand Corps Malade. En effet, avec sa chanson « Pas essentiel », on s’attendait à plus de réflexion3. Ce qui est dommage c’est que tout ce beau monde est fermement persuadé que, grâce à cette vaccination, la vie va reprendre comme avant. Retour à la normale, jouée en partition uniquement pour pipeau et violon ! 

Cette légion d’honneur, distribuée à tout-va comme des confettis à des enfants, ne signifie plus grand chose à part récompenser certains malfaisants. Jacques Servier, feu le grand patron des laboratoires du même nom, s’était vu remettre la décoration prestigieuse en plein scandale du Médiator. Rappelons que pendant trente ans, de 1976 à 2009, ce produit dangereux à été prescrit à plus de 5 millions de patients. Jugement final en 2021. Un record de « rapidité » dû à l’état de délabrement avancé du système judiciaire français que mettent en évidence depuis plusieurs années les enquêtes de la Commission européenne pour l’efficacité de la justice (CEPEJ). Entre 220 et 300 décès à court terme et entre 1300 et 1800 à long terme4.  Ce qui n’a pas empêché Nicolas Sarkozy, alors chef de l’Etat à l’époque, de remettre à Servier, le 7 juillet 2009, la plaque et le cordon de grand-croix – la plus haute distinction – de la Légion d’honneur5, alors que la célèbre pneumologue Irène Frachon, dans son livre – Médiator 150 mg, combien de morts ? – publié deux ans plus tôt dénonçait les méfaits du médicament « miracle ». 

Mais revenons à ce vaccin miraculeux fabriqué en moins d’un an. Les chercheurs ont bossé nuit et jour. Quand il y a des bénéfices à faire, pas d’hésitation…

Effets indésirables graves : la question est loin d’être résolue

Le professeur Raoult que l’on ne présente pas déclare le 8 janvier 2021 que ce vaccin n’est pas la baguette magique qui va arrêter l’épidémie. Extrait de l’article « … Je pense que la plupart d’entre eux (les vaccins) ne présentent pas de risques à court terme. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : il ne s’est pas passé de choses extraordinaires. À moyen-long terme, personne ne peut le savoir sur des formes nouvelles (…) on a évalué les effets secondaires qui ne sont ni plus ni moins que ceux des autres vaccins : Je ne le crois pas non plus. »6.

Côté Pfizer, le vaccin Covid-19 assurerait une efficacité globale de 80,2 % après la première injection, atteignant 94,1 % 14 jours après la seconde injection7.  

Côté Vidal, la bible des médecins, au 10 décembre 2020, dans son article  « Vaccin Pfizer/Biontech contre la Covid-19 : Enfin des données à analyser ! » : « un taux de protection de 52,4 % dès la première injection » mais surtout : « Les questions relatives à l’efficacité qui demeurent en suspens », « Des effets indésirables post-injection plus sévères chez les moins de 56 ans », « Les questions relatives à la toxicité qui demeurent en suspens »… Puis plus loin : « La possibilité d’effets indésirables graves, rares ou décalés dans le temps »8 ; « La toxicité chez les moins de 16 ans, les femmes enceintes et allaitantes et les personnes immunodéprimées ». Le Vidal souligne en conclusion : « la question d’une éventuelle toxicité à long terme se pose toujours, ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » En  cas d’effets indésirables graves possibles, qui ne semblent  nullement gêner ceux qui vaccinent avec ces vaccins inachevés, rendez-vous à l’hôpital s’il reste des lits hospitaliers ou au…cimetière. 

Le prix de l’incompétence

Comment ignorer que le développement et la mise au point d’un vaccin prend en moyenne une dizaine d’années en respectant le principe de précaution qui permet de s’assurer qu’il soit sans danger pour l’homme avant sa mise sur le marché ?

« Des prototypes de candidats-vaccins sont mis au point en laboratoire à partir de germes, puis on lance la production pharmaceutique et on réalise les premiers tests sur des animaux. Il faut ensuite obtenir des autorisations réglementaires pour mener des essais cliniques, plus vastes sur l’Homme. »9

Admettons quand même que ce vaccin soit efficace à 94,1 %. Si tel était le cas, et s’il protégeait réellement les vaccinés, pourquoi obliger ceux qui n’ont pas envie d’être vacciné à l’être ? Pourquoi vouloir établir un « passeport de santé/vaccination » qui serait exigible avant de prendre un avion, de monter dans un train, ou d’aller au spectacle ? La vérité semble ailleurs…

Nos braves artistes partant en guerre pour que tout le monde se fasse vacciner, feraient bien de revoir leurs copies. Car, s’ils s’imaginent que les salles de spectacles, les théâtres, les cinémas, et les restaurants (pour manger un petit bout en fin de soirée), vont réouvrir très vite, ils se fourrent le doigt dans l’oeil jusqu’au coude. 

Comment voulez-vous que le Conseil scientifique donne son feu vert à la liberté, vu que Jean-François Delfraissy, le  président du Conseil scientifique du pouvoir, a déclaré le 18 décembre 2020 que 2021 ressemblera à 2020.10. Tout comme il avait déjà déclaré en 2009 qu’il allait falloir vacciner deux fois les Français contre le virus de la grippe H1N1, alors présentée comme une terrible pandémie. Terrible au point qu’elle disparut en une année presqu’aussi vite qu’elle avait surgit … Coût pour l’Etat de ces prévisions aussi alarmistes qu’infondées et fumeuses : plus de 500 millions d’euros pour la seule opération vaccin dont des millions de doses seront annulées après dédommagements financiers de ses producteurs et 15 millions d’autres détruites ! Banco. 

Comme le reconnut lui-même le professeur Delfraissy une fois que l’orage fût passé, il « n’était pas un spécialiste des virus de la grippe », pas plus qu’il ne l’est d’ailleurs aujourd’hui de ce coronavirus. Voilà qui « rassure » et laisse déjà entrevoir que la nouvelle ardoise laissée par ce régime et ses conseillers – des milliards d’euros avec un nouveau surendettement du pays – pourrait bien tomber plus vite que prévu comme des tuiles sur la place publique.  

Un vaccin est normalement sensé vous immuniser contre une maladie. Si vous êtes vacciné contre le tétanos, vous êtes protégé à 100 %. Extrait du Vidal : « La vaccination contre le tétanos est efficace à 100 % et cette maladie a quasiment disparu dans les pays, dont la France, où une politique vaccinale complète est appliquée et réalisée. De 2005 à 2017, 112 cas de tétanos ont été déclarés en France – sois moins de 10 par an. » Si le vaccin contre la Covid-19 ne peut être efficace à 100% en 2021, aucun de ses fabricants ne peut garantir sa sûreté. Ceux-ci ne s’étendent pas sur ses possibles effets secondaires. Comme on les comprend. 

Si le vaccin vous rend malades, on y est pour rien…

Une réunion du comité consultatif de la Food and Drug Administration (FDA) des États-Unis intitulée Vaccins et produits biologiques connexes qui s’est tenue le 22 octobre 2020 n’a-t-elle pas listé 22 conséquences négatives possibles, y compris la mort, avec ces vaccins alors en cours d’élaboration ?11 Cette liste, projet de travail sur les événements indésirables très graves pouvant survenir, n’incluait pas tous les effets négatifs mineurs et non étudiés sur la santé qui résulteront de ces injections pour une raison simple : ceux-ci ne peuvent apparaître qu’au bout de plusieurs années.

Voilà qui explique pourquoi les dirigeants de ces transnationales de la pharmacie ont été jusqu’à solliciter très fortement la Commission « européenne » afin qu’elle les décharge de leurs responsabilités sur les effets secondaires. Extrait de l’article LCI du 22 septembre 2020 : «  Le 27 août, la Commission européenne a confirmé être en discussion avec les laboratoires » sur ce sujet. Ces clauses sont ainsi en discussion afin de « compenser les risques élevés pris par les laboratoires ». Risques élevés ? Risques de pertes de profits faramineux par la vente de vaccins qui ne peuvent qu’être inachevés dans leur conception au moment de leur mise sur le marché ? Non, risques financier pour des effets secondaires liés à « une éventuelle toxicité à long terme (qui) se pose toujours » en début d’année 2021 « ainsi que celle des effets indésirables graves et rares qui pourraient survenir. » Et c’est justement pourquoi « les contrats d’achat anticipé prévoient que les états membres de l’UE indemnisent les fabricants pour les responsabilités encourues dans certaines conditions. »12 

Cerise sur le gâteau, ces vaccins ne garantiraient qu’une immunité de quelques mois, variable selon les fabricants. Ensuite rebelote pour une injection et jackpot pour Pfizer, Moderna et les autres. 

On imagine mal que des producteurs de vaccins assurés de l’efficacité et de la sûreté de leurs produits aillent quémander l’aide d’un Etat qu’ils ne cessent de stipendier au nom de la « libéralisation des entreprises » et auquel ils reprochent un prétendu « interventionnisme » pour qu’il prenne à sa charge les déboires qui pourraient survenir après l’injection de leur « vaccin révolutionnaire » 

Aussi, nul besoin d’être un grand devin pour deviner que le délire confinatoire avec port du masque et couvre feu va continuer alors que le mardi 12 mars 2020, l’inénarable Directeur général de la Santé, Jérôme Salomon, déclarait que « 98% des gens guérissent » de la Covid-19. Et attention, en matière de coronavirus le haut fonctionnaire Jérôme sait de quoi il parle : c’est lui qui annonça le 3 février 2020 qu’ « il n’y a pas d’épidémie en France, même pas de chaîne de transmission dans notre pays et aucune circulation du virus sur le territoire. » Le jour même la France comptait ses six premiers cas confirmés porteurs du virus SRAS-CoV-2, 57 le 29 du même mois et 191 avec le premier décès le 3 mars !

Notre enquête

 Se soigner ? Du repos chez soi, et pour aider, du zinc, de la vitamine D, de la vitamine C, de l’aspirine ou du Doliprane13, 14. Mais alors que devient l’Hydroxychloroquine, interdite par la « sinistre » de la Santé Buzyn aux médecins généralistes bien que ceux-ci parviennent à soigner des malades à l’hôpital s’ils sont traités dès les premiers symptômes ? 

Difficile de s’y retrouver dans les affirmations les plus contradictoires qui agitent la communauté scientifique auxquelles s’ajoutent les fausses  nouvelles diffusées par le Premier ministre et certaines administrations. Rien d’étonnant pourtant puisque ce coronavirus est nouveau pour les chercheurs, du moins pour ceux qui ne travaillent pas à la mise au point d’armes biologiques offensives dans l’un de ces laboratoires de l’armée des Etats-Unis échappant à tout contrôle international. Mais ceci est une autre histoire, celle de guerres biologiques et chimiques qui ne commencent ni en République populaire de Chine, ni en France mais au cœur de la Maison Blanche…

Nous sommes journalistes et non scientifiques et notre rôle est de rapporter avec rigueur à la population les informations et les idées qui circulent dans la société. Nous n’avons pas la prétention d’affirmer ce qu’il faut faire ou ne pas faire au plan médical ainsi que s’y ridiculisent des éditocrates parisiens et autres médecins imaginaires autoproclamés qui se répandent dans des médias dont les transnationales de Big Pharma sont l’un des principaux annonceurs. Par contre nous avons la détermination inébranlable de dénoncer les fausses informations, d’où qu’elles viennent, en nous appuyant sur des sources fiables – Insee, CNRS, Inserm, etc. -, en vérifiant et croisant leurs données et en analysant les faits avec le nécessaire recul. 

La pratique rigoureuse de l’enquête journalistique implique de suivre la « règle des trois principes » : bannir toute idée reçue, ne faire confiance à personne, vérifier les informations par recoupements. C’est pourquoi nous pouvons affirmer que ce gouvernement ment à l’opinion publique lorsqu’il prend prétexte d’une prétendue virulence du virus pour imposer de nouvelles mesures qui détruisent le contrat social français. Parvenu à ce stade de mensonge d’Etat, ce gouvernement n’a plus d’autre choix que d’entretenir la peur pour endiguer la révolte qui menace et permettre aux sociétés transnationales de la pharmacie d’écouler leurs millions de doses de vaccins autant inutiles qu’inachevés. 

Vous doutez ?

Fausses informations gouvernementales

Un nouvel exemple de l’esbroufe gouvernementale appert en début d’année 2021 : le nombre de personnes contaminées par la Covid-19 annoncé en décembre 2020 par le gouvernement, son ministre de la santé et son administration, et relayé par la plupart des médias, est de 1068 cas confirmés par semaine par million d’habitants. Cette statistique est diffusée par la plateforme ouverte des données publiques françaises (www.data.gouv.fr, https://LaFibre.info/Covid19, Comparatif du nombre de cas Covid-19 par semaine entre pays rapporté par million d’habitants, mise à jour du 06 décembre 2020 à 17h.)

Or, si l’on examine de près les chiffres du réseau Sentinelles de l’Institut national de la santé et de la recherche médicale (Inserm) composé de 1200 cabinets médicaux sur tout le territoire, ce rapport s’avère bien différent : 14 cas pour 100 000 personnes soit environ 140 cas pour un million d’habitants. Huit fois moins ! Rappelons que le taux de Sentinelles correspond aux vrais malades symptomatiques rencontrés dans les cabinets médicaux et testés. Ainsi que l’indique le réseau Sentinelles dans son bulletin sur la situation observée pour la semaine 53 – du 28 décembre 2020 au 03 janvier 2021-, « à partir des données cliniques et virologiques concernant les cas d’IRA (NdA : Infections respiratoires aiguës) vus en consultation de médecine générale, il est possible d’estimer la part de ces cas dus au COVID-19. » En semaine 53 à cheval entre décembre 2020 et janvier 2021, « aucun prélèvement n’a été testé positif au SARS-CoV-2 (COVID-19) parmi les prélèvements analysés. Ceci permet d’estimer que le taux d’incidence des cas d’IRA dus au SARS-CoV-2 (COVID-19) vus en médecine générale serait inférieur à 14 cas pour 100 000 habitants, représentant moins de 9 097 nouveaux cas de COVID-19 ayant consulté un médecin généraliste. » Précision de l’Inserm : « Cette estimation est stable par rapport aux semaines précédentes. » Quel média vous a rapporté ces faits et cette « stabilité par rapport aux semaines précédentes » ?… Le seuil épidémique étant de 150 à 200 cas pour 100 000 personnes, il est permis d’affirmer que le virus est en voie de disparition. 

Aussi, la troisième vague, le reconfinement, le couvre-feu et autres mesures annoncées par le gouvernement à grand renfort de médias semblent n’avoir qu’une raison d’être : entretenir la peur pour écouler le stock de millions de doses de vaccins ! Olivier Veran, ministre des Solidarités et de la Santé, ne tient visiblement pas à jouer « Bachelot 2 le retour » sur les traces de la « sinistre » de la Santé du gouvernement Fillon. Rappelez-vous : en 2010 celle-ci, suivant à la lettre les conseils du même Jean-François Delfraissy et de son équipe pour contrer la grippe H1N1, s’était retrouvée avec des dizaines de millions de doses de vaccins inutiles…

Les « profiteurs pandémiques »

Ceux qui depuis le début de l’année 2020 n’arrêtent pas de diffuser des annonces gouvernementales et d’administrations sans les vérifier puisqu’émises par des sources officielles  – donc a priori crédibles – se retrouvent, devant les arguments que nous présentons aux lecteurs, seuls et démunis avec le sentiment d’avoir été trompés par le pouvoir et ses représentants pour les plus honnêtes et professionnels d’entre eux. Si, si, il en existe encore… Si des erreurs peuvent survenir dans la création et la diffusion d’informations, celles-ci répétées dans le temps sur un même sujet façonnent ce qui s’appelle un mensonge d’Etat.

Ceux qui en font les frais ? 

Les professionnels de la santé et, d’une manière générale, les salariés des entreprises, les transporteurs, commerçants, artisans, hôteliers-restaurateurs, patrons de boîtes nuits, autocaristes, TPE et PME-PMI, les professions du spectacle et de l’événementiel, les salles de sports…Bref, tous les entrepreneurs et indépendants, qui grâce à leur travail et à leur dur labeur font vivre leurs familles et donnent de la convivialité à notre nation sont en train de disparaître.

En revanche, comme nous le montrons dans Le virus et le président, les « profiteurs pandémiques » se portent plutôt très bien. Parmi eux, les sociétés transnationales du CAC 40 – dont celles de la pharmacie – qui, tout en réalisant les plus importants chiffres d’affaires reçoivent, bon an mal an, plus de 200 milliards d’euros de subventions publiques et d’exonérations fiscales de l’Etat et de l’Union dite « européenne » et continuent de coter à la hausse en Bourse tout en tuant des milliers et des milliers d’emplois en France. C’est un peu aussi pourquoi nous disons que lorsque le président Macron qui a consacré son temps, depuis qu’il s’est assis en 2012 près de l’ancien président François Hollande, a privatiser l’économie, créer du chômage, réduire encore le système de santé publique, endetter le pays, déclare vouloir « reconstruire une économie forte et souveraine » c’est un peu comme si une dinde fêtait Noël.

Le livre qui dérange

Le virus et le président n’oublie pas ces fauteurs de crise tant sanitaire qu’économique et financière. Vous y lirez comment les privilégiés du système se gavent des richesses de notre beau pays avec le concours de parlementaires qui, pour la plupart, ne sont plus que des sortes de greffiers de la Commission « européenne » qui confinent le budget de la Santé publique dans l’une des dernières places du budget de l’Etat. Pendant que la France du travail et de la création perd sa santé jusqu’à l’agonie sur l’une des toutes premières marches du podium du taux de suicide d’Europe occidentale, des profiteurs sans scrupules la pillent en flux tendu 24 heures sur 24. La fable du « vaccin miracle » inachevé contre la Covid-19 ne raconte pas une autre histoire que celle des manigances de ces accapareurs à la recherche de profit maximum immédiat quelles qu’en soient les conséquences pour le peuple.

Ce vol noir de corbeaux sur le pays qu’ils enchaînent à coups d’ordonnances de l’Union « européenne » et de lois liberticides et anti-sociales est le tableau « idyllique » annoncé par Klaus Schwab, le fondateur de Davos et de son Forum Economique Mondial, ainsi qu’il l’explique dans son livre, Covid-19 : la grande réinitialisation. C’est écrit noir sur blanc et ce n’est pas complotiste. C’est une réalité qui est en train de s’étendre, comme une gangrène malfaisante à toute la planète15. Aussi, le temps de la perdition, de la désespérance et du silence est révolu. Place à la réflexion, au débat et à l’action ! 

Notre livre Le virus et le président, (IS Edition, www.is-edition.com), qui vient de sortir souhaite y contribuer, peut vous éclairer, vous permettre de comprendre comment et pourquoi le pouvoir vous trompe, favoriser le débat, inciter à rechercher et à écrire les propositions qui permettront de changer de cap. Enquêtes minutieuses, faits, chiffres, zestes d’humour16… 

Le vaccin inachevé ? Comme pour ses promoteurs et propagandistes, au vu de ce qui précède, vous aurez deviné notre position. 

Jean-Loup Izambert et Claude Janvier

Notes :

1.https://www.msn.com/fr-fr/actualite/france/appel-de-200-artistes-pour-la-vaccination-c-est-le-seul-moyen-de-sortir-de-ce-bordel/ar-BB1cyLhj?ocid=msedgdhp et https://www.leparisien.fr/culture-loisirs/covid-19-l-appel-de-200-personnalites-de-la-culture-qui-veulent-se-faire-vacciner-06-01-2021-8417619.php

2.https://www.lefigaro.fr/cinema/ils-me-font-ch-francois-berleand-s-explique-devant-des-gilets-jaunes-20191209

3.https://www.youtube.com/watch?v=NencPkx7qgY

4.https://www.lepoint.fr/justice/proces-mediator-dernier-round-07-07-2020-2383304_2386.

5.https://www.nouvelobs.com/societe/20111010.OBS2124/nicolas-sarkozy-et-la-legion-d-honneur-le-revers-de-la-medaille.html

6.https://www.lindependant.fr/2021/01/08/covid-19-pour-didier-raoult-le-vaccin-nest-pas-la-baguette-magique-qui-va-arreter-lepidemie-9299989.php

7.https://www.vidal.fr/actualites/26337-vaccin-pfizer-biontech-contre-la-covid-19-enfin-des-donnees-a-analyser.html

8.https://www.vidal.fr/actualites/26105-vaccins-contre-la-covid-19-doit-on-s-inquieter-du-risque-de-maladie-aggravee-chez-les-personnes-vaccinees.html

9.https://www.santemagazine.fr/traitement/medicaments/vaccins/vaccins-contre-le-coronavirus-quelles-differences-pour-qui-quand-873097

10.https://www.ouest-france.fr/sante/virus/coronavirus/covid-19-jean-francois-delfraissy-2021-ressemblera-a-2020-7091792 

11.FDA U.S., Food & Drug Administration, Steve Anderson, VRBPAC, meeting October 22, 2020. Vaccines and Related Biological Products Advisory Committee (VRBPAC), October 22, 2020. Meeting Announcement. La FDA révèle une longue liste de problèmes de santé graves pouvant résulter de la vaccination contre le covid-19, y compris la mort, par Lance D.Jolmage, Natural News, mercredi 09 décembre 2020.

12.https://www.lci.fr/sante/vaccins-contre-le-covid-19-les-laboratoires-seront-ils-vraiment-decharges-de-toute-responsabilite-en-cas-d-effets-secondaires-2165265.html

13.https://france3-regions.francetvinfo.fr/occitanie/haute-garonne/toulouse/collectif-medecins-preconise-utilisation-vitamine-du-zinc-prevenir-formes-graves-covid-1908356.html

14.https://www.bfmtv.com/sante/en-combien-de-temps-guerit-on-du-coronavirus_AN-202003120174.html

15.https://blogs.mediapart.fr/semcheddine/blog/011220/covid-19-grande-reinitialisation-ou-insurrection-des-consciences et  https://lecourrierdesstrateges.fr/2020/12/29/le-great-reset-annonce-t-il-la-fin-du-travail-independant/

16.https://www.is-edition.com/actualites/parution-le-virus-et-le-president-jean-loup-izambert-claude-janvier/

 

Lectures complémentaires sur notre page « Coronavirus, guerre contre l’humanité »

 

Escalier de la Grande Réinitialisation… Échafaud vers le N.O.M ou Ascenseur vers l’Émancipation ?

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, N.O.M, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, terrorisme d'état with tags , , , , , , , on 9 janvier 2021 by Résistance 71

A nous de choisir… à personne d’autre…
A la croisée des chemins ce sera N.O.M ou ÉMANCIPATION et Société des Sociétés

Communiqué de presse de l’association Réaction 19 concernant la plainte pénale déposée contre l’utilisation des vaccins

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, Internet et liberté, média et propagande, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 5 janvier 2021 by Résistance 71

 

 


+ Moderna + AstraZeneca… L’humanité en péril

 

Association Réaction 19

 

4 janvier 2021

 

Communiqué de l’Association Réaction 19

4 janvier 2021

L’Association RÉACTION 19, co-présidée par Messieurs Carlo Alberto BRUSA et Riccardo MEREU, est une association loi 1901 qui compte aujourd’hui près de 40 000 adhérents et plus de 60 000 sympathisants, dont l’objet est de veiller au respect des libertés fondamentales, notamment dans le cadre de l’épidémie de la COVID-19.

L’Association RÉACTION 19 a, le 16 décembre 2020, déposé une plainte concernant les thérapies géniques Pfizer/BioNTech et Moderna, communément dénommées « vaccins ». Des chefs de :

  • mise en danger délibérée de la vie d’autrui ;
  • tromperie aggravée ;
  • abus de faiblesse ;
  • extorsion aggravée.

Déjà plus de 5 000 personnes ont déclaré s’associer à cette plainte, ce chiffre ne cessant de croître. Leurs interventions volontaires seront déposées auprès du Procureur de la République dans les prochains jours.

La plainte, enregistrée sous le numéro 20351000746, demeure entre les mains de la Justice et du Procureur de la République de Paris.

L’Association RÉACTION 19 a également adressé aux prescripteurs desdits « vaccins », notamment à l’ensemble des députés et sénateurs, au président de la République, au premier ministre, au ministre de la Santé et aux médecins, une déclaration d’engagement de responsabilité civile et pénale quant aux effets secondaires de ces « vaccins » pouvant aller jusqu’à la mort.

À ce jour, aucun des prescripteurs susdits n’a signé cette déclaration et n’a donc accepté d’engager sa responsabilité personnelle sur les conséquences de cette politique vaccinale.

Fait à Paris, le 30 décembre 2020.

Pour l’Association RÉACTION 19
Monsieur Carlo Alberto BRUSA
Président
63, rue la Boétie – 75008 PARIS
Mail : reaction19fr@gmail.com

= = =

Format PDF :

Communiqué-de-presse-relatif-à-la-plainte-pénale-rel-ative-aux-vaccins

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Dictature COVID-19 : Les labos poussent les gouvernements à les exonérer de toute responsabilité pour leurs vaccins chimériques…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

 

 

 

Les labos pharmaceutiques s’exonèrent de toute responsabilité sur les effets secondaires des vaccins covid

 

Anonyme

 

25 décembre 2020

https://www.lefigaro.fr/societes/vaccins-covid-19-l-ue-nbsp-indemnisera-les-laboratoires-en-cas-de-problemes-20200827

Bill Gates admet que ses vaccins changeront le génome

https://youtu.be/ksEVaO806Oo (vidéo à enregistrer avant censure)

Fauci le pantin de Bill Gates qui veut imposer les vaccins aux américains avoue que les vaccins covid peuvent être pires que le covid lui même

https://metro.co.uk/2020/05/12/americas-top-coronavirus-doctor-warns-vaccine-make-covid-19-worse-12692519/?ito=cbshare (article à enregistrer avant censure)

Bill Gates admet que ses vaccins peuvent tuer

https://www.armstrongeconomics.com/world-news/corruption/gates-admits-700000-people-may-die-from-his-vaccine/?__cf_chl_jschl_tk__=62eb6c7077991213fdafe4e84df29c5a07ebf0d4-1608836399-0-AVlKQVPOLfSy9QfQp3lKiMepwzABRTxxWMfww9Whtf27OPGp9Pysbzlln1vrkzWizhdh6sdzI5srwLQcRmU9Oi9E1O19KBS-t2bK9oY-kqIXxvzXo1evnUHmG-l9_fyt9BC82pusuzl4UQGKD99EyWzQQE8WO-spDIG2E8X-kqGWxXx7WeDjvlfQDbMemduSicRT22up-wqnYkzixyqrGvZ03FPAlCreAGCM0rYoEZcLZFPQFUVk7yyvxEUB6t1kl0wF9_gLrccxEoZtTl5ZLrhwVLAEPphfWMbYdrMIwW4CSEJyIQAnGO-mLBLRZV7otU94GN1ZQNccruGGk4-J3LKg0QjK58r7il0j3drDYjegmDieMGRAHBb3V7spLOlqZnk9Cg6q0UHKS6L_4uc_z1gDYNjz hY4WhEzoc4E6tfrWFkISoYiR0iLFQWZLiVk4z0GdxWuZPk33MketC3pa9do

https://resistance71.wordpress.com/2020/10/06/coronavirus-vaccin-covid19-et-controle-mondial-de-la-population/

les labos des vaccins AstraZeneca (NYSE: AZN), GlaxoSmithKline (NYSE: GSK), Janssen (NYSE: JNJ), Merck (NYSE: MRK), Novavax (NASDAQ: NVAX), Pfizer (NYSE: PFE), Sanofi Pasteur (NASDAQ) : SNY), Takeda (NYSE: TAK), Abbott (NYSE: ABT) et CureVac (NASDAQ: CVAC) ont tous demandé à être exonérés de toute responsabilité sur les effets secondaires de leurs vaccins OGM à ADN ou ARN

https://seekingalpha.com/news/3608810-coronavirus-vaccine-makers-seek-eu-liability-protections

AstraZeneca , GlaxoSmithKline, Janssen , Merck, Novavax , Pfizer , Sanofi , Takeda, Abbott CureVac sont tous financés par Bill Gates ou d’autres géants du web (comme le milliardaire Dietmar Hopp, co-fondateur du géant allemand du logiciel SAP https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html). ou collaborent avec lui

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2016/10/OPP1156831

https://observer.com/2020/05/coronavirus-vaccine-update-novavax-merck-bill-gates-funding/

https://nypost.com/2020/09/15/bill-gates-says-pfizer-has-best-shot-at-early-covid-19-vaccine/

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2015/10/OPP1127586

https://america-wake-up.com/2020/05/04/the-anthony-fauci-bill-gates-george-soros-sanofi-pasteur-china-corona-virus-vaccine-connection/

https://www.fiercebiotech.com/biotech/sanofi-pasteur-announces-vaccine-discovery-collaboration-bill-melinda-gates-foundation

https://www.takeda.com/newsroom/newsreleases/2016/takeda-receives-$38-million-grant-from-the-bill–melinda-gates-foundation-to-support-polio-eradication-in-developing-countries/

https://edition.cnn.com/2020/08/14/investing/curevac-ipo-coronavirus-vaccine-bill-melinda-gates/index.html

Pourquoi les géants du web investissent dans les vaccins?

Tout simplement parce que le but des vaccins c’est de donner une identité numérique, marque de la bête connecté à la 5G

https://www.kla.tv/Coronavirus-fr/16685

une autre vidéo qui en parle a été censurée sur

http://stoplinkyvarest.canalblog.com/archives/2020/09/21/38547121.html

vaccin connecté à la 5G

https://resistance71.wordpress.com/2020/10/09/dictature-technotronique-en-marche-vaccin-covid-arnm-hydrogel-enzyme-luciferase-cocktail-modificateur-genetique/

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

https://resistance71.wordpress.com/2020/12/16/laffaire-du-vaccin-contre-la-covid-19-nest-pas-une-affaire-sanitaire-mais-celle-de-la-normalisation-de-lidentite-numerique-philippe-guillemant-physicien-cnrs/

 

Déclaration de responsabilité civile et pénale pour l’administration du vaccin Pfizer / BioNTech ou Moderna dans le cadre de la COVID-19 (Association Réaction19, format PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 26 décembre 2020 by Résistance 71


Mais que diable vont-ils nous injecter ?…

POUR DIFFUSION IMMEDIATE

Résistance 71

26 décembre 2020

Devant la menace sanitaire de ces vaccins OGM à ARNm dont personne ne peut savoir ce qu’ils génèreront sur le long terme sur le génome humain et le manque de transparence total les concernant, ainsi que l’ineptie totale pour les gouvernements et surtout l’UE d’avoir totalement exonéré de toute responsabilité légale les labos pharmaceutiques Pfizer / BioNTech, Moderna, voici un document de responsabilité civile ayant valeur légale que ceux qui désirent se faire vacciner peuvent faire signer au médecin et chargé de mission sanitaire les injectant.
Le document est réalisé par l’association REACTON19, Paris 8ème, rue de la Boétie, « pour toute personne concernée par le « vaccin » Pfizer/BioNTech ou Moderna ».

Ne faites confiance à aucune des instances promouvant cette saloperie, elles sont noyées ainsi que les individus qui les dirigent, dans le conflit d’intérêt le plus grossier et ce à tous les niveaux, que ce soit financier ou politique.

Voici le document à faire signer, diffusez, imprimez, distribuez… (PDF)
Déclaration-de-responsabilité-civile-et-pénale-du-médecin-1

Test COVID-19 RT-PCR : deux textes vitaux pour comprendre la fraude des chiffres statistiques de la pandémie (PDF)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 17 décembre 2020 by Résistance 71

 

 

Résistance 71

 

17 décembre 2020

 

Nous avons traduit et publié récemment ces deux textes que Jo nous a réunis en un temps record dans ce PDF vital à la compréhension de l’enfumage auquel nous sommes tous victimes et qui vise à la mise en place d’une bonne partie de la grille de contrôle technotronique planétaire, comme l’explique par ailleurs le physicien Philippe Guillemant, et du contrôle eugéniste de la population mondiale par l’oligarchie en charge de faire perdurer le système étatico-capitaliste en phase de mutation vers son objectif final transhumaniste.
La mise en place d’une dictature sanitaire planétaire ne peut reposer que sur une seule chose ressentie par la vaste majorité des gens: la peur, voire la psychose face à quelque chose qu’on ne peut pas voir ni maîtriser (plutôt, qu’on ne VEUT pas maîtriser). Quoi de mieux donc qu’un nouveau croquemitaine invisible et nuisible à souhait, entre ainsi en scène le nouveau coronavirus (créé en laboratoire) :

Bébert Corona. Pour que la peur soit effective, durable, ajustable et modulable il faut qu’elle s’appuie sur la « science », mais pas n’importe quelle science… celle des chiffres, des statistiques et des extrapolations modélisées, comme à l’accoutumée maintenant ; de cette science qui privilégie les modèles informatiques à l’observation de faits de terrain.
Pour ce faire, il faut des chiffres, mais pas n’importe lesquels et certainement pas ceux qui résulteraient d’une observation réelle de terrain, mais de chiffres « adaptés » pour la circonstance, non pas falsifiés par quelques personnes mal intentionnées, ce serait vite repérable, mais par un protocole litigieux à moins, frauduleux au pire, pratiqué à l’insu et au plein gré de toutes et tous. Entre en scène les kits de test RT-PCR pour Real Time-Polymerase Chain Reaction… Tout est en place… le virus a été largué dans la nature… Que la fête commence !

Qu’est-ce que ce test PCR et quel usage en est-il fait ? Quelques réponses essentielles dans ces deux articles que nous avons traduits et que Jo nous a mis en PDF, à lire et diffuser sans aucune modération.

Dossier-special-CoV19-fraude-tests-RT-PCR
format PDF

 

Entretien du Pr. Personne avec France-Soir au sujet de sa suspension.
Nous devons dire ici que depuis quelques semaines, nous sommes étonnés de voir France-Soir
comme voix critique dans les médias de masse français au sujet de cette crise COVID.
Tout à leur honneur, ne crachons pas dans la soupe…

 

Vaccin CoV19 et stérilisation des populations ?…Des éléments plus que troublants

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 12 décembre 2020 by Résistance 71

 

 

Un vaccin covid qui stérilise la population pour un virus moins mortel que la grippe ?

 

Anonyme (reçu par courriel)

 

12 décembre 2020

 

La protéine d’origine virale du placenta et la protéine d’origine virale du sperme ressemblent à la protéine d’origine covid

vaccination covid= stérilisation des femmes et des hommes ?

8% de l’ADN humain est d’origine virale, les virus participent au système de reproduction humaine, si le covid ressemble au virus participant à la reproduction humaine, le vaccin covid s’attaquera à la fertilité humaine

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

La protéine d’origine virale chargé de la création du  placenta ressemble à la protéine créé par le covid,  donc il y a un risque que le vaccin covid  va causer l’infertilité tant des femmes que des hommes, car la syncytine 1 est présent aussi dans le sperme

https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

La syncytine 1 est une protéine d’origine virale joue un rôle essentiel lors de la formation du placenta au moment de la grossesse

La syncytine est une glycoprotéine d’enveloppe rétrovirale possédant des capacités fusogéniques induisant la formation de syncytium (cellules polynucléées découlant de fusion cellulaire). Elle est abondamment exprimée au niveau du placenta durant la grossesse. Chez l’humain les cytotrophoblastes jouent un rôle crucial dans le développement fœtal et placentaire. https://fr.wikipedia.org/wiki/Syncytine_1

« Qu’y a-t-il, dans ces protéines syncytines créés par les virus de l’ADN humain https://fr.wikipedia.org/wiki/Syncytine_1, de si nécessaire à la formation du placenta ? « Pour qu’ils puissent pénétrer dans la cellule hôte, les rétrovirus ont la faculté de faire fusionner la membrane de leur enveloppe avec la paroi cellulaire, explique M. Heidmann. Cette fusion de deux membranes est rendue possible par les syncytines puisque ce sont elles qui interagissent avec la surface de la cellule qui va être infectée. » Or ce mécanisme de fusion membranaire permet la formation de structures géantes appelées « syncytia » et constituées par la réunion de cellules individuelles… Une structure que l’on retrouve dans le placenta, à l’interface entre le foetus et la mère. »

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

là une preuve que le covid 19 est en partie similaire au virus du placenta qui permet la création des bébés: 

« les protéines de pointe du COVID 19 contiennent également des protéines homologues à la syncytine protéine d’origine virale chargé de la formation du placenta »

.http://www.francesoir.fr/societe-sante/vaccination-sars-cov-2-le-dr-wodarg-et-le-dr-yeadon-disent-stop

Pfizer admet que son vaccin peut causer la stérilisation des femmes

« Responsable de la recherche chez Pfizer : Le vaccin Covid entrainera la stérilisation des femmes

Le vaccin contient une protéine de pointe (voir image) appelée syncytine-1, vitale pour la formation du placenta humain chez la femme. 

Si le vaccin fonctionne de telle sorte que nous formons une réponse immunitaire CONTRE la protéine de pointe, nous entraînons également le corps féminin à attaquer la syncytine-1, ce qui pourrait entraîner une stérilité chez les femmes pour une durée indéterminée.

Après quelques recherches, il s’avère que la syncytine 1 est également présente dans le sperme, de sorte que ce ne sont pas seulement les femmes qui seront stérilisées, mais aussi les hommes

https://www.researchgate.net/publication/261257414_Syncytin-1_and_its_receptor_is_present_in_human_gametes

https://healthandmoneynews.wordpress.com/2020/12/02/head-of-pfizer-research-covid-vaccine-is-female-sterilization/

Contrairement aux trolls qui prétendent que l’ARN ne peut pas modifier notre génome car est dans le cytoplasme de la cellule, ils oublient que certains virus possèdent une enzyme appelés transcriptase inverse qui permet de transcrire de l’ARN à l’ADN, et donc de modifier l’ADN à partir de l’ARN
https://fr.wikipedia.org/wiki/Transcriptase_inverse

 

or le covid qui est un virus manipulé en laboratoire https://fort-russ.com/2020/05/major-researchers-uncover-new-evidence-showing-covid-19-was-lab-created/, possède des fragments du VIH selon Le prof luc Montaigner qui l’a étudié
https://youtu.be/Vx91DZTjNTI

 

or le VIH possède dans son génome l’enzyme transcriptase inverse
https://en.wikipedia.org/wiki/Reverse-transcriptase_inhibitor#Non-nucleoside_reverse-transcriptase_inhibitor

 

ainsi donc les vaccins à ARN pourront modifier notre génome mais rassurez vous, les virus à ARN seuls sans vaccins ne peuvent pas modifier votre génome
la raison est que les enzymes de nos corps ainsi que nos anticorps détruisent tout ARN étranger venant de l’extérieur
c’est la raison pour laquelle pour protéger leur ARN de virus, ils l’engloberont de nanoparticules lipides, afin que le corps l’identifie comme lui appartenant et ne l’attaque pas, et le laisse entrer dans ses cellules pour faire de la modification génétique à partir de la transcription inverse une fois que l’ARN sera dans le cytoplasme de la cellule, donc le vaccin à ARN modifiera le génome à partir de la transcriptase inverse (de l’ARN à l’ADN)
la transcriptase normal tout court dont parlent les trolls c’est de l’ADN à l’ARN, mais vu que le covid contient la fonction transcriptase inverse, leur théorie bidon que les vaccins à ARN ne peuvent pas modifier le génome ne fonctionnera pas
la preuve les fabricants de vaccins sont obligés d’englober leur précieux virus RNA (the mRNA) modifié de nanoparticules lipidiques (lipid nanoparticles), car sinon les enzymes secrétés par les mucus du nez, la salive, les muqueuses de l’estomac, et autres émetteurs d’enzymes présents partout dans le corps, anticorps tueraient leur précieux RNA virus modifié
citations:
« lipid nanoparticles can be synthesized with relative ease in a scalable manner, protect the mRNA against degradation, facilitate endosomal escape, can be targeted to the desired cell type by surface decoration with ligands, and as needed, can be codelivered with adjuvants.
https://pubmed.ncbi.nlm.nih.gov/27075952/

As mRNA molecules are vulnerable to ribonuclease enzymes that widely exist in the biological systems and highly negatively charged, which compromise their internalization through cell membranes, suitable in vivo mRNA delivery systems are urgently needed (4). To protect and deliver mRNA, extensive efforts have been devoted to construct biocompatible carriers, such as LNPs, polymeric nanoparticles, peptides/protein-mRNA complexes, and other types of biomaterials (9, 22, 23). Among these reported platforms, lipid-like nanoparticles (LLNs) are one of the representative materials that have been extensively used for mRNAs delivery

https://advances.sciencemag.org/content/6/34/eabc2315.full

 

RNA molecules are also fragile molecules, easily degraded in the body https://www.pharmaceutical-journal.com/news-and-analysis/features/rna-interference-therapies-could-be-on-the-cusp-of-success/20204853.article?firstPass=false

le virus est composé d’un ARN, donc est facile à dégrader par le corps

il ne peut être protégé de la destruction du corps que si il est protégé et encapsulé à l’intérieur de nanoparticules biocompatibles dans le corps humain via le vaccin

Nanoparticle-based delivery systems protect RNA molecules from enzymatic degradation and immune system attacks https://www.biosyn.com/tew/Nanocarriers-for-RNA-delivery.aspx#!

la famine programmée par le gouvernement par les confinements meurtriers (morts de la faim à cause du chômage à cause de la fermeture des commerces non essentiels pour permettre à Amazon qui fraude sur la TVA de se remplir les pocheshttp://www.cielvoile.fr/2020/12/fraude-massive-a-la-tva-sur-les-places-de-marche-des-acteurs-du-e-commerce.html )http://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html,  future loi finance 2021https://strategika.fr/2020/12/04/appel-aux-francais-faites-pression-sur-vos-elus-afin-quils-sopposent-au-vote-de-la-prochaine-loi-de-finances-pour-2021/ et les compteurs linkyhttps://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/   en revanche fait réduire la production d’enzymes pouvant détruire les virus d’où le fait que dans l’histoire de l’humanité, les épidémies n’ont lieu uniquement que dans les périodes de famines, et disparaissent automatiquement avec la fin de celles ci
https://fr.wikipedia.org/wiki/Liste_de_famines

 

d’où le fait qu’ils font tout pour accroitre la crise économique avec les confinementshttp://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/  , fermeture des commerces non essentiels mettant en chomage des millions de personnes
les masques assèchent la bouche, donc réduction de la salive qui contient des enzymes tuant les virus

le Ribonucléase Rnase ennemi mortel du covid (RNA) et présent naturellement dans tout le corps humain
https://en.wikipedia.org/wiki/Ribonuclease

les vaccinateurs veulent nous imposer le covid à travers le vaccin obligatoire, en protégeant leur précieux virus à l’intérieur de nanoparticules lipidiques pour l’empêcher d’être détruits par nos méchants enzymes et méchants anticorps

La stérilité causé par les vaccinés sera-t-elle imputée au Covid19 ? Regardez ces liens ou faites votre propre recherche.

https://www.nationalheraldindia.com/health/coronavirus-can-cause-male-infertility-study

https://www.thailandmedical.news/news/breaking-male-infertility-research-shows-that-sars-cov-2-coronavirus-may-indirectly-cause-testicular-damage-in-male-covid-19-patients-and-also-orchiti

https://www.forbes.com/sites/victoriaforster/2020/11/15/covid-19-compromises-sperm-count-and-quality-in-recovering-patients/

https://www.urotoday.com/recent-abstracts/men-s-health/male-infertility/124144-male-fertility-and-the-covid-19-pandemic-systematic-review-of-the-literature-beyond-the-abstract.html

https://journals.physiology.org/doi/full/10.1152/ajpendo.00183.2020

https://www.bionews.org.uk/page_152485

https://healthandmoneynews.wordpress.com/2020/12/03/oxford-designer-of-covid-vaccine-admits-vaccine-will-only-sterilize-70-per-cent-of-the-population/

Les tests PCR sont bidons et à 90% d’asymptomatiques, leur objectif c’est de stériliser la jeunesse fertile via la vaccination

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

Autre preuve que le covid est bidon:
en l’année 2020 du covid 2019, la population mondiale augmente, donc aucun risque qu’un virus puisse faire que l’espèce humaine disparaisse, la vie continue normalement comme des millénaires avant
https://www.worldometers.info/fr/

Evidemment le gouvernement enrage que le virus covid n’arrive pas à dépeupler les gueux et ne les stérilise pas et ne leur fait aucun symptôme du tout, donc il a fait pondre la loi pour avorter les bébés à 9 mois dans le ventre et une autre loi pour euthanasier les vieux, et une autre loi pour baillonner tout le monde pour empêcher tout le monde de respirer, et une loi pour autoriser le glyphosate de Monsanto

https://www.ouest-france.fr/environnement/glyphosate/glyphosate-l-assemblee-refuse-d-inscrire-l-interdiction-de-l-herbicide-dans-la-loi-5789451

alors qu’on sait que les pesticides tout comme les autres polluants chimiques abiment les poumons donc entravent la respiration

https://observatoire-des-aliments.fr/sante/pesticides-et-problemes-respiratoires-chez-les-enfants
https://www.lefigaro.fr/vox/societe/img-jusqu-au-9e-mois-pour-detresse-psychosociale-le-danger-d-un-motif-imprecis-20200812

preuve que le covid n’a aucun impact sur la fertilité et n’empêche pas la naissance de bébés en excellente santé

https://indianexpress.com/article/cities/chandigarh/covid-positive-woman-delivers-healthy-baby-6552509/

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

En plus vu que la population mondiale augmente, on voit que le covid n’a aucun impact sur la fertilité des hommes et des femmes, que s’il y a une épidémie de gens stériles après, ce sera bien causé par la vaccination…

Mais ils feront croire que la stérilisation est causé par le covid pour pousser les gens à se vacciner, et bien sur, ils feront passer leurs exemples d’individus stériles à cause de la vaccination comme des gens qui n’ont jamais été vaccinés pour faire croire à leurs mensonges

Alors ne vous vaccinez pas, tant que les labos n’ont pas fait de garanties écrites et sont prêts à être responsables judiciairement si leurs vaccins causent un impact sur la fertilité et toute autre déraillement de la santé par effets secondaires mortifères !

Tests PCR sinon bidons du moins bien peu fiable en contexte clinique et dépistage thérapeutique

https://resistance71.wordpress.com/2020/12/10/cov19-test-pcr-et-falsification-des-chiffres-le-test-rt-pcr-ne-devrait-pas-etre-utilise-a-fins-therapeutiques-il-nest-quun-outil-de-fabrique-comme-concu-par-son-inventeur-kary-mullis/

https://resistance71.wordpress.com/2020/10/16/voix-de-la-raison-cov19-et-tests-rt-pcr-comprendre-le-comment-de-lenfumage-general-permettant-de-maintenir-un-etat-de-terreur-accepte-du-plus-grand-nombre-et-de-dire-non-a-la-dictature-sanitair/

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

= = =

A lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

 

L’inquisition sanitaire par la dictature de la science des modèles… De la science des faits à la science des algorithmes (Jean-Claude Paye)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 11 décembre 2020 by Résistance 71

 

 

 

Coronavirus : une nouvelle inquisition

 

Jean-Claude Paye et Tülay Umay

 

9 décembre 2020

 

url de l’article original:
https://www.mondialisation.ca/coronavirus-une-nouvelle-inquisition/5651897

 

Installé depuis neuf mois, « l’état d’urgence sanitaire » a atteint le plus intime des individus. Afin de les conformer à des injonctions mortifères, il exhibe le spectacle d’un sacrifice permanent des populations. Celui-ci relève d’un théâtre gestuel, tel celui d’Antonin Artaud,[1] qui fait appel à une forme de purgation, impactant le Réel des êtres humains.

La « guerre contre le coronavirus » n’est pas une lutte contre la maladie et ne repose pas non plus sur sa prévention. Si la « pandémie » se limite à l’impact d’une grippe saisonnière, on constate, suite aux mesures prises, une dégradation globale de la santé des individus, confirmant ainsi que cette hostilité est bien une guerre contre les populations. Dans son dernier discours, le président Macron en précise les dernières modalités, en énonçant la possibilité d’organiser « l’isolement des personnes contaminées de manière plus contraignante,[2]» ce qui pourrait signifier, selon le sénateur Alain Houpert, la création de camps d’internement.

Bien que son cadre d’application ne soit pas précisé, le principe de précaution présente une primauté sur toute autre politique destinée à « gérer des risques incertains.[3] »  Dans le cas du coronavirus, il devient un « outil de gestion virtuel de risques virtuels.[4]». La « pratique scientifique » est alors réduite au principe moral de responsabilité. Ce dernier se résume à une monstration de la participation des populations à des mesures qui les asservissent. Les mesures de précaution relèvent alors d’une théologie de l’obscène, d’un faire-voir  amalgamant responsabilité et culpabilité. Elles s’inscrivent dans une nouvelle religion basée sur le sacrifice.

La facilité, avec laquelle les populations ont renoncé, à leur propre corps et au rapport à l’autre, produit un impensable. L’Inquisiteur du roman, Les frères Karamazov de Dostoïevski, donne sa réponse à cette interrogation, en énonçant que ce serait le propre de l’Homme de faire de Dieu le « responsable de la charge de sa vie ». 

Le pouvoir politique exerce actuellement la fonction réservée au grand Inquisiteur dans le roman de Dostoïevski. Il est aujourd’hui l’institution à laquelle les populations abandonnent la « charge du désir de l’autre », en offrant leur libre arbitre en sacrifice. Le principe de précaution relève de la culpabilité. Il donne du sens au sacrifice des populations et à la violence des mesures prises. 

Le principe de précaution

Depuis une vingtaine d’années, la « lutte antiterroriste » a permis de saper les fondements de l’organisation de la société, en détruisant, de l’intérieur, la forme de l’État de droit [5]. Aujourd’hui, dans la « guerre contre le coronavirus », les libertés fondamentales n’ont simplement plus lieu d’être et laissent la place à des notions morales, celles de  responsabilité et de culpabilité.

Lévinas nous éclaire sur cette problématique, car toute sa philosophie repose sur l’idée de responsabilité. Il reprend, à son compte, les propos de Dostoïevski dans Les frères Karamazov, sur la culpabilité de chacun de nous « devant tous, pour tout». Lévinas précise que cette culpabilité ne résulte pas «  de fautes que j’aurais commises, mais parce que je suis responsable d’une responsabilité totale, qui répond de tous les autres et de tout chez les autres.[6]» 

En devenant responsable de l’autre, chaque individu deviens, tout particulièrement, comptable de sa mort. Il entre dans « l’inquiétude-pour-la-mort-de-l’autre-homme [7]». La responsabilité n’est pas d’ordre juridique, mais est fondée sur une « communion spirituelle de tous les humains », ici, une communion dans l’universalité du coronavirus. 

Ainsi, le principe de précaution suspend l’observation des faits et dénie l’ordre juridique, pour laisser la place à « l’amour du prochain ». La communication du pouvoir n’est-elle pas :  « soyez solidaire, sauvez des vies, rester chez vous  » ? Les injonctions du pouvoir se réduisent à des commandements d’amour, relevant de la perversion.  L’amour qui se sacrifie est bien pire que l’exigence de la Loi : il rend la dette impossible à solder et la culpabilité infinie. 

Le principe de précaution libère alors le pouvoir, des contraintes de la loi écrite et de la Loi symbolique, afin d’intégrer un discours hors-sens, reposant sur des impératifs catégoriques nous entraînant dans une forme nouvelle d’inquisition. « Il faut » est la réponse standardisée des personnes, portant le masque ou respectant scupuleusement les mesures de distanciation. 

En se plaçant hors-sens, le « covidé » fonde une religion, celle d’un Dieu pervers, dénoncé par le théologien Maurice Bellet [8]. Le régime de précaution réclame un sacrifice. L’injonction repose sur « une volonté capricieuse, arbitraire, sans foi ni loi, qu’il faudrait satisfaire [9] ». Ce qui nous engage dans le cercle infini, imposé par un nouvel inquisiteur, révèlant que « ce divin est semblable à une bouche dévorante et insatiable : plus on cherche à la satisfaire, plus elle en demande, puisqu’elle se nourrit précisément de nos renoncements [10]».

Les derniers propos, du ministre belge de la santé Franck Vandenbroeck, illustre bien ce discours d’amour et d’éducation reposant sur une politique se nourissant des renoncements successifs des citoyens.  Au micro de la radio RTBF, il a affirmé que la décision de fermer les magasins, « c’était pour  créer un choc  au sein des populations », puisque dit-il « faire du shopping seul, pendant une courte période ne représente pas un danger pour la circulation du virus .[11]»

Un principe moral inscrit dans le droit

Le principe de précaution est un principe moral. Il ne s’adresse pas à un sujet de droit. C’est une injonction qui se place au-delà de la loi. La mutation du comportement des individus est son objectif premier. En France, il a fait son entrée dans le droit positif, en 1995, avec la loi Barnier sur la protection de l’environnement. Son domaine d’application s’est ensuite développé dans les domaines de la santé publique et de la sécurité alimentaire [12].  Il a également été adopté par la Commission Européenne et de nombreux Etats membres. 

En 2005,  le législateur français a introduit le principe de précaution dans la Constitution. Un principe moral est ainsi devenu un principe constitutionnel. Le principe de précaution y est défini  comme « une norme-guide pour l’action en univers incertain, un outil de gestion virtuel des risques virtuels…[13]». Ainsi, son encadrement juridique ne peut être que formel. 

Le principe de précaution se dégage donc de la matérialité du fait. Il fait penser à la notion de « proactivité » relative à l’enquête policière, introduite dans le droit pénal afin développer une recherche en l’abscense d’infraction [14]. L’inscription juridique du principe de précaution permet également de justifier l’intervention de l’administration dans un contexte ou « elle légitime le pouvoir de police »[15].

Dans l’enquête policière proactive, s’il s’avère que l’infraction est finalement inexistante, l’enquête a bien eu lieu, mais elle ne pourra pas produire d’effets de droit. Il en va bien autrement pour le principe de précaution qui permet d’agir en dehors de tout rapport avec la réalité des faits, de confiner la population ou d’isoler, dans des camps, les personnes testés positives, bien que le test utilisé produise essentiellement des faux positifs.

L’intervention des autorités sanitaires n’est pas donc déterminée en fonction de l’observation, mais bien par la prédiction de résultats et leur modélisation, comme les 500.000 morts du covid prévus par le docteur Neil Fergunson. Bien que l’oracle soit constamment démenti par les faits, il sert toujours de référence et de caution aux diverses mesures gouvernementales.

Précaution versus prévention

Le principe de précaution participe de la rationalité instrumentale, celle de la technique et du calcul économique. Il n’a pas pour ambition d’anticiper l’évènement, afin d’éviter sa survenance ou d’en minimiser les effets, il s’en tient à une gestion probabiliste des risques [16].

Il ne s’agit plus de prévenir le développement d’une maladie, mais de révéler un danger  potentiel, non à partir d’une analyse concrète, mais grâce à une simulation mathématique, détachée de la matérialité des faits. Une succession de chiffres est censée indiquer une tendance, celle du l’intensité et de la progression exponentielle du virus. C’est donc à partir des algorithmes que le risque est révélé et non plus à partir de l’observation. Les chiffres avancés sont toujours des projections, des modélisations, comme les 9000 morts récemment annoncés par le président Macron qui se réduiront, dans les faits, à la moitié  du chiffre prévu.

Pour la généticienne Alexandra Henrion-Caude, les prévisions donnent l’impression « qu’on est revenu au temps des devins, des oracles ». « On était en plein pic épidémique, avec un nouveau virus, une nouvelle maladie, qu’on nous parlait déjà d’une deuxième vague. Là on entend une troisième, une quatrième [17] ».

On peut donc établir ce qui différencie le principe de précaution de la notion de prévention. La prévention vise des risques avérés, dont sait estimer l’ampleur et la fréquence du dommage encouru. Les mesures de prévention ont été conçues pour circonvenir les risques certains, fondés sur des relations déterminées de cause à effet. 

Ce qui n’est pas le cas du principe de précaution qui porte sur les risques incertains, dont on n’a pas à établir la réalité scientifique [18]. On a affaire ici à un droit purement procédural, car « en matière de précaution, la preuve du risque et la procédure sont liés [19]». Comme dans le droit de l’inquisition, la preuve fonde sa validité sur le strict respect de la procédure. Dans la guerre contre le coronavirus, la question n’a même pas à être posée, car la « connaissance » est immédiate, directement révélée par le chiffre de l’algorithme. 

Le contrôle juridictionnel est restreint.  Tel que l’a stipulé le Tribunal de première instance des Communautés européennes : l’autorité qui « prend un risque incertain ne doit pas faire la preuve du risque, mais celle de sa politique [20] ». Dans les faits, l’autorité concernée doit simplement mentionner ses bonnes intentions. 

Le principe de précaution : une théologie de « l’ob-scène » 

La prévention vise à gérer les conséquences d’une crise, à l’anticiper et à en réduire les effets. Quant au principe de précaution, il n’a pas pour objet d’affronter la maladie, mais, ici, de préparer la population à sa survenance inéluctable. Il s’agit de placer les individus dans une position d’accueil du discours sur la pandémie. Ce principe procède d’une exigence morale, conduisant non pas à une lutte contre le virus, mais à une mutation du comportement des individus.  

Ainsi, le principe de précaution, au contraire de la prévention, est un outil de gestion des populations, de leurs attitudes et de leurs croyances. Comme l’écrit Pierre Moscovici, «L’Etat ne se contente plus de gérer un risque, il doit gérer un rapport social… Le principe de précaution devient alors un outil de gestion de l’opinion publique.[21]»

Nous sommes ici dans l’incertitude d’un risque, dont la réalisation est elle-même incertaine. Le principe de précaution nous interdit de penser. Il s’oppose à toute possibilité d’observation, en supprimant la notion même de causalité, comme succession temporelle de causes et d’effets.  Sous la forme du délire, le discours sur la coronavirus colonise notre vie individuelle et notre réalité sociale. Il fonde un nouveau Réel, il porte sur quelque chose dont nous ne pouvons rien dire et sur lequel nous n’avons pas de prise.

Le principe de précaution n’impose pas des mesures destinées à confronter la réalité, mais il permet la fabrication d’un Réel obscène, dont le masque chirurgical devient le symbole. Par un dénombrement continu des victimes du coronavirus, il réactualise l’idéologie victimaire. Ainsi, il met en scène l’ob-scène en quantifiant la mort, tout en l’expulsant du symbolique, du lien social. 

L’obscénité des mesures réside aussi dans leur caractère volontairement exorbité, dans le fait de rendre non seulement visible, mais surtout médusant, leur aveuglante abération, celle, par exemple, d’un couvre-feu imposé entre minuit et cinq heures, ainsi que leur violence sans limite, tel le massacre des personnes âgées dans les Ehpad. 

L’obscénité réside dans leur caractère religieux, dans la donation de sens qu’apportent les populations à leur participation compulsive aux mesures imposées. Celles-ci donnent alors vie à des dispositions administratives qui conduisent à leur destruction. L’obscénité réside non seulement dans l’expression de la toute puissance du pouvoir, mais surtout dans la monstration des populations de leur extrème faiblesse. Cette dernière trouve leur source dans la capacité des médias d’engendrer des images et un bruit permanent, empêchant l’installation d’un refoulement [22].

Le grand Inquisiteur

Si « la guerre contre le terrorisme » avait pour objet de supprimer toute résistance, ici dans « la guerre contre le coronavirus », il s’agit d’abandonner toute possibilité même de résistance. À travers « la gestion de cette pandémie », cette perspective est entrée dans notre quotidien, pourtant, ce n’est pas la première fois qu’elle apparaît dans l’histoire de l’humanité. 

L’humanité réduite à un troupeau est une réalité qui s’est présentée à chaque fois que la population s’est trouvée totalement démunie, placée dans une position de détresse par rapport au pouvoir. La détresse des individus résulte d’une perte des repères et surtout d’une impossibilité de faire face, de dire non aux injonctions qui leur sont adressées. Confrontées au fait de « ne pouvoir attendre l’aide de personne », les populations sont alors plongées dans une radicale impuissance.

Le roman de Dostoïevski, Les frères Karamazov, en situant l’action dans la période historique de l’inquisition, fait ressortir une problématique qui rappelle étrangement ce que nous vivons présentement. L’organisation de l’inquisition repose sur le personnage du grand Inquisiteur qui considère l’humanité comme un troupeau. Il conçoit que l’homme ne peut trouver son salut qu’en renonçant à sa subjectivité et en se dépersonnalisant. 

Si l’humanité doit être réduite à l’état de troupeau docile, l’individu, en déléguant sa liberté au grand inquisiteur, redevient un « infans », coupable de renoncer à sa liberté. Il devient alors complètement dépendant d’un pouvoir qui lui dicte sa conduite. Si bien que le grand Inquisiteur peut affirmer : « Oh, nous arriverons à les convaincre qu’ils ne deviendront libres qu’au moment où ils renonceront pour nous à leur liberté et ils se soumettront [23]».   Dans cette « pandémie », il est signifié aux individus qu’ils ne redeviendront « libres » qu’au moment où ils auront acceptés le vaccin et qu’ils auront abandonné toute volonté d’avoir une maîtrise de leur existence.

Le grand Inquisiteur préconise également une logique de déresponsabilisation de l’individu, de renoncement à son libre arbitre, aboutissant à sa déshumanisation. Le règne du grand Inquisiteur, c’est également la disparition totale de la sphère privée, jusqu’à l’ultime intimité que représente la conscience. 

Si l’Homme n’est plus libre et, par conséquent, n’est plus responsable, il lui revient le « droit de pêcher. » Plus précisément, il lui est permis de ne plus être un homme, en transgressant les lois symboliques, comme dans les différentes réformes éthiques, tel que le « mariage pour tous », la législation sur l’euthanasie et les lois sur la bio-éthique. Ces « nouveaux droits » ne sont en fait qu’un moyen supplémentaire pour le pouvoir d’asservir les hommes. « Tout est permis », tel est le mot d’ordre du nihilisme [24].

Autrefois, l’inquisition était une institution spécialisée, destinée à empêcher l’éclatement du corps social, en criminalisant tout questionnement d’ordre religieux. Aujourd’hui, elle ne se focalise plus sur une partie de la société, mais porte sur son ensemble. C’est la société toute entière qui est mobilisée, en vue de sa propre destruction. Ce qui occupe actuellement la place du grand Inquisiteur n’a plus pour objectif de bloquer une mutation sociale et politique, mais au contraire d’être le catalyseur d’un changement radical de société. Ici, le sacrifice n’est plus limité et codifié, mais permanent et généralisé. 

« État d’urgence sanitaire »

Le principe de précaution s’inscrit étroitement dans « l’état d’urgence sanitaire ». La notion doit être prise à la lettre, dans le sens où il s’agit bien, ici, d’une suspension du droit d’être soigné. Cet abandon se traduit par des mesures de confinement des personnes âgées et malades avec celles ne présentant aucun symptôme et par le refus d’accès à l’hôpital des personnes ne présentant pas de symptôme du corona, mais ayant, par exemple, un problème cardiaque. Au nom de ce principe, les personnes âgés, malades du Covid 19, ne sont pas prises en charge et sont renvoyées chez elles, avant que l’on abrège les souffrances grâce au Rétrovil . La question de la précaution est aussi convoquée pour interdir des médicaments, permettant de faire face à l’épidémie, telle l’hydroxychloroquine. 

L’état d’urgence juridique implique la suspension des libertés individuelles et des droits politiques, comme disposition permettant de faire face à la « menace terroriste ». L’état d’urgence juridique, par le biais de la lutte antiterroriste, se définit également, tel l’exprimait W. Bush, comme une « lutte contre du bien contre le mal ». Le nouvel ordre juridique permettait, en l’abscence de peuves, d’emprisonner les personnes, nommées comme terroristes par le pouvoir exécutif. L’état d’urgence juridique permet de s’attaquer à l’Habeas Corpus des citoyens et, en Grande Bretagne et aux Etats-Unis, de se saisir du corps des personnes créant « un climat favorable au terrorisme [25]» ou simplement désignées comme « ennemi du gouvernement ». 

L’état d’urgence sanitaire permet, quant à lui, de supprimer le corps par des mesures de confinement, tandis que le port, obligatoire et généralisé, du masque est une remise « en marche » de ce corps, mais comme « corps sans tête », comme corps-machine. La suppression du corps, induite par la « guerre contre le coronavirus », grâce au port permanent d’un masque ou de gants, trouve déjà un antécédent dans les images de prisonniers, détenus au bagne de Guantanamo [26]. 

Le type d’enfermement, induit par la « lutte contre la pandémie », est une rupture complète avec le type d’emprisonnement qui visait à séparer le corps du prisonnier du corps social. Ici, c’est l’ensemble des citoyens qui est touché par les mesures de confinement. La prison n’est plus un lieu clos, séparé de la société, mais bien cette dernière qui, en confinant chez lui le « citoyen responsable » participant du « souci de l’autre », devient une prison. 

La prison, comme partie distincte de la société, reste cependant présente, comme une menace d’enfermer, dans des camps, les personnes déclarés positives par un test PCR, une procédure qui permet considérer, comme positifs, une grande proportion des individus testés [27]. L’ensemble de ces mesures et projets participent d’une volonté du pouvoir d’installer les citoyens dans la psychose.

Comme les images des tortures de Guantanamo, ces mesures ont pour objet de nous signifier notre impuissance, de nous montrer à quel point nous sommes dépendant d’un pouvoir qui, cependant, nous veut du bien, qui, pour Noêl, comme le président du parti libéral francophone belge, Louis Bouchez, nous communique : « si les chiffres le permettent, on tentera encore de donner plus  d’humanité. [28]»

Jean-Claude Paye

Tülay Umay

 

Notes :

1 Lire : Jean-Claude Paye, Tülay Umay, « Pandémie ou le retour du grand Pan », Réseau International, le 3 novembre 2020,  https://www.mondialisation.ca/pandemie-ou-le-retour-du-grand-pan/5650703

2 Sud radio, Macron 20H: analyse avec Alain Houpert, Sénateur de la Côte-d’Or et médecin radiologue,

https://www.youtube.com/watch?v=i-vHz-M-Eys 

3 Dominique Bourg et Alain Papaux, « Des limites du principe de précaution : OGM, transhumanisme et détermination collective des fins », Economie publique, 2007/2,  https://journals.openedition.org/economiepublique/7932 

4 Matthieu Paillet, « Le principe de précaution. Concept, application, enjeux », p. 8,  https://www.pourlasolidarite.eu/sites/default/files/publications/files/wp_-le_principe_de_precaution.pdf 

5 Jean-Claude Paye, La fin de l’Etat de droit, de l’état d’exception à la dictature, La Dispute, Paris 2004.

6 Emmanuel Lévinas, Éthique et infini, Paris, Le livre de poche, 1982, p. 95.

7 Emmanuel Lévinas, De Dieu qui vient à l’idée, Paris, Vrin, 1992, p. 248.

8 Maurice Bellet, Le dieu pervers, éditions du Cerf, Paris 1987.

9 Jean-Daniel Causse, Lacan et le christianisme, in Valérie Chevassus-Marchionni, Raymond  Lemieux, et François Nault, « Psychanalyse et christianisme : note critique à propos du dernier livre de Jean-Daniel Causse (1962-2018) ». Laval théologique et philosophique 75, no 1 (2019), p. 134.. https://doi.org/10.7202/1067506ar 

10 Ibidem

11 https://plus.lesoir.be/340753/article/2020-11-30/la-fermeture-des-commerces-non-essentiels-avait-ete-decidee-pour-creer-un 

12  Catherine Larrère, « Le principe de précaution et ses critiques » , Innovations 2003/2 (n°18), pages 9 à 26 , https://www.cairn.info/revue-innovations-2003-2-page-9.htm 

13 Moscovici, Pierre, «Le principe de précaution: implications politiques et juridiques», cours donné à l’Ecole Nationale d’Administration (ENA), avril 2010, p. 26

14 Sur l’enquête proactive, lire Jean-Claude Paye, Vers un Etat policier en Belgique ?, EPO, Bruxelles 1999.

15 M. Gros, D.Deharbe, La controverse du principe de précaution, Chron. Adm.,R.D.P.,2002-3., p.834.

16 Matthieu Paillet, https://www.pourlasolidarite.eu/sites/default/files/publications/files/wp_-le_principe_de_precaution.pdf 

17 Alexandra Henrion-Caude : « J’ai l’impression qu’on est revenu au temps des devins », La Rédaction, le 16 novembre 2020, https://www.sudradio.fr/societe/alexandra-henrion-caude-jai-limpression-quon-est-revenu-au-temps-des-devins/ 

18 Le Conseil d’État et le principe de précaution,  Journal des Tribunaux, Bruxelles, Larcier, le 28 février 2004, p. 21

https://orbi.uliege.be/handle/2268/7260 

19 C.Noiville et N.de Sadelleer, o.c., Revue du droit de l’Union européenne, 2/2001, p. 444

20 T.P.I., 11 septembre 2002, Pfizer Animal Health et a.c.Conseil, Aff.T-13/99, motifs 164 et 165

21 Pierre Moscivici, Ibid., p. 23.

22 Entretien avec Serge Tisseron, « L’obscène est une machine de guerre contre la métaophore », La voix du regard n° 15, septembre 2002,https://www.youscribe.com/catalogue/documents/loisirs-et-hobbies/humour/l-obscene-est-une-machine-de-guerre-contre-la-metaphore–376961     

23 Fédor Mikhaïlovitch Dostoïevski, Les frères Karamazov, vol. 1 – § Le Grand Inquisiteur, Éditions Actes Sud © 2002, collection Babel, traduit du russe par André Markowicz, pp. 444, 445, 449 à 470 et 474. https://www.philo5.com/Mes%20lectures/Dostoievski_GrandInquisiteur_1880.htm  

24 Matthieu Giroux, « Dostoïevski : La légende du grand inquisiteur dans Les Frères Karamazov », Philitt, le 25 septembre 2012, 

  https://philitt.fr/2012/09/25/dostoievski-la-legende-du-grand-inquisiteur-dans-les-freres-karamazov/ 

25 Lire : Jean-claude Paye, « Royaume-Uni, menaces sur l’Habeas Corpus, » Le Monde, le 13 avril 2005  https://www.lemonde.fr/idees/article/2005/04/13/royaume-uni-menaces-sur-l-habeas-corpus-par-jean-claude-paye_638494_3232.html 

26 Lire : Jean-Claude Paye, « Guantanamo comme réel de la lutte antiterroriste », in L’emprise de l’image, de Guantanamo à Tarnac, Editions Yves Michel 2011, pp.140 à 149.

27 Dr Pascal Sacré, « COVID-19: RT-PCR ou comment enfumer toute l’humanité », Mondialisation.ca, le 14 octobre 2020, https://www.mondialisation.ca/covid-19-rt-pcr-ou-comment-enfumer-toute-lhumanite/5650143 

28 Aurelie Demesse, «  Noël pourrait-il être sauvé, in-extremis ?, La Libre Belgique, le 29 novembre 2020,  https://www.lalibre.be/belgique/politique-belge/un-assouplissement-des-mesures-pour-noel-si-les-chiffres-le-permettent-on-tentera-encore-de-donner-plus-d-humanite-5fc375e0d8ad585a459299a3