Archive pour test RT-PCR faux positifs

Dictature sanitaire par les chiffres de la peur de la fraude des tests PCR. Informons et mettons-y fin ! (Dr Nicole Delépine)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , on 1 décembre 2021 by Résistance 71

La Dr Delépine enfonce un clou de plus dans le cercueil de cette fumisterie à test PCR dont nous avons par ailleurs déjà dénoncé la fraude il y a un an (voir le superbe PDF de Jo ici). A faire circuler au grand large. En une phrase lapidaire : Les tests PCR sont l’outil de la fabrication de la peur et du « consentement » forcé aux mesures sanitaires dictatoriales… La PCR n’a pas été inventé (Par Karry Mullis, qui obtint le prix Nobel de chimie pour son invention) pour être un test thérapeutique des instructions mêmes de son inventeur, mais un outil de reproduction de matériel génétique à des fins de recherche. Qu’on se le dise une bonne fois pour toute ! Réflexion – Union – Action – Rébellion ! Il est plus que grand temps !..
~ Résistance 71 ~

RT-PCR1
La fraude test PCR

Mr Véran, Un “cas” n’est pas un malade ! Sans test PCR il n’existe pas de vagues. Stop mesures antiCOVID

Dr Nicole Delépine

26 novembre 2021

source:
https://www.mondialisation.ca/mr-veran-un-cas-nest-pas-un-malade-sans-test-pcr-il-nexiste-pas-de-vague-stop-mesures-anticovid/5662654

Une nouvelle fois les mesures annoncées par le ministre reposent sur des « cas » dépistés par tests et non sur des malades.

VAGUE DE « CAS » FONDÉS SUR TESTS PCR DÉNONCÉS PAR LA FDA, MAIS PAS DE MALADES

Les nouvelles annonces d’O. Véran reposent comme depuis plus d’un an sur les « cas » et la mystification, qui consistent à confondre cas dépistés par des tests fallacieux et de vrais malades.

Et comme les médias diffusent en continu la propagande gouvernementale sans dénoncer la différence entre un test positif et un vrai malade (que le réseau sentinelle dépiste), la panique et ses conséquences funestes continuent sur tous les plans, médical, mais aussi psychologique, économique et politique. Pendant que des pays aussi différents que le Texas ou la Côte d’Ivoire ont repris des vies normales depuis des mois, la France continue de s’enfoncer dans la désespérance et la régression générale.[1]

Qu’a dit Véran ?

« Le pass sanitaire ne sera plus valide sans la 3e dose à partir du 15 janvier.

La 3e dose de vaccin anti-Covid est ouverte à tous les Français de plus de 18 ans dès 5 mois après la 2e injection. Le pass sanitaire sera désactivé 7 mois après la 2e dose.

– Le gouvernement a exclu toute mesure de restriction stricte de type confinement et couvre-feu, compte tenu de la pression hospitalière qui reste modérée.

– La durée de validité des tests PCR et antigéniques, qui permettent d’obtenir le pass sanitaire sans vaccination, sera réduite à 24 h.

– Le port du masque est à nouveau obligatoire dans tous les établissements recevant du public, et dans les lieux de brassage de population à l’extérieur sur décisions des préfets.

– Les classes d’école ne seront plus fermées dès détection d’un cas de Covid-19. En cas de nouveau cas détecté, les élèves seront tous testés, ceux présentant un résultat négatif resteront admis en classe.

Les tests seront gratuits et pourront être faits par les parents à l’extérieur de l’école »

Cerise sur le gâteau : passe obligatoire pour les marchés de Noel !! .

LES ÉVEILLÉS : OUVREZ LES YEUX CONTRE LES TESTS PCR ET INFORMEZ !

Quand les « éveillés » vont-ils ouvrir leurs propres yeux et ceux de la population sur la vague de tests et l’absence d’augmentation du nombre de malades ? Ce test est l’arme de terreur du pouvoir qui permet de tenir le peuple dans l’angoisse de cette fameuse nouvelle vague qu’ils attendent tant elle est annoncée. Et tant que la population ne fera pas la différence entre cas et malades, ils recommenceront encore et encore.

Il faut dénoncer la supercherie qui nous trompe depuis janvier 2020. Elle a été clairement démontrée par maître Reiner Fuellmich dès octobre 2020[2] et par le tribunal de Lisbonne qui a fort longuement expliqué qu’un diagnostic est un acte médical qui repose sur une consultation, des signes cliniques et éventuellement confirmé par les examens paracliniques.[3] Nous avions espéré que ces petites victoires juridiques aideraient à faire cesser cette tromperie mondiale, mais rien n’y a fait : le cirque continue, entretenant la peur même chez les soi-disant éveillés qui vont se faire tester pour se rassurer, et même chez certains médecins lanceurs d’alerte qui incluent le test PCR dans leurs algorithmes.

LE LEURRE DES CONTAMINATIONS DOIT CESSER

LES CAS NE SONT NI DES MALADES NI DES MORTS

Et le ministre l’avoue puisqu’il n’envisage pas de confinement ni couvre-feu en l’absence de pression hospitalière. Pas de malades, pas de morts.

Il vient de se faire prendre la main dans le sac, obligé de reconnaître que la soi-disant surcharge insupportable de nos hôpitaux de 2020 n’a rempli que 2 % des lits en moyenne et donc même si c’est 19 % au moment des pics, on reste très loin du tsunami décrit chaque soir par notre croque-mort de service toujours en place à ce jour. Donc il attend un peu que l’effet négatif médiatique soit oublié. Quelques journalistes n’ont pas apprécié le mensonge éhonté.

Le test PCR

ne dépiste que des virus, proches ou équivalents au SARS-CoV-2, des résidus de virus plus ou moins récents, mais ne démontre en aucun cas une nouvelle vague de Covid19.

Tous ceux qui tentent d’informer sur les vérités et mensonges dans ce scénario catastrophe de plandémie depuis bientôt deux ans doivent le hurler, le répéter, l’expliquer, etc. et ne jamais le laisser oublier ! Et n’oubliez jamais que les bien portants appelés asymptomatiques ne transmettent pas le virus : ceci fut définitivement démontré par l’étude chinoise sur dix millions de personnes et aussi vite oublié. C’est la deuxième arme du trucage du scénario Covid.[4]

LE TEST PCR EST L’ARME DU POUVOIR POUR NOUS MUSELER, PIQUER, ENFERMER, TRACER

Laissons raconter cette supercherie des tests PCR par le Dr Édouard Broussalian

Extrait de son magnifique récit de cette pandémie[5]:

« Sans tests PCR il n’y avait point de pandémie[6] et le test était parfaitement vérolé de manière à détecter un maximum de “cas”. Mais c’était tout ce qu’il fallait pour aller dans le sens de la nouvelle définition de “pandémie”, juste des “cas”, pas forcément des vrais malades et encore moins de mortalité. Un document qui vient d’être publié par la Food and Drug Administration (FDA) des États-Unis admet ouvertement que le fameux test PCR pour le coronavirus de Wuhan (Covid-19) a été mis au point non pas à partir d’échantillons réels du virus chinois, mais plutôt à partir de ce qui semble être du matériel génétique d’un virus du rhume. Dans le document de la FDA, il est clairement indiqué que le matériel génétique ordinaire de la grippe saisonnière a été utilisé comme marqueur de test dans les kits de test PCR.[7]

De manière parfaitement incroyable, l’article de Corman-Drosten a été soumis à Eurosurveillance le 21 janvier 2020 et accepté pour publication le 22 janvier 2020. Le 23 janvier 2020, l’article était en ligne. »

« Plus incroyable encore, le protocole de test Drosten, qu’il avait envoyé à l’OMS à Genève le 17 janvier 2020, avant même que l’article ne soit publié[8] a été officiellement recommandé par l’OMS comme test mondial pour déterminer la présence du coronavirus de Wuhan.»

Que dire du scandale des cycles d’amplification ? L’OMS et Drosten ont recommandé un CT de 45 cycles. Il n’est pas étonnant que, alors que le nombre de tests augmente au début de la saison grippale hivernale, les “positifs” PCR en Allemagne et ailleurs explosent. Comme le soulignent les auteurs critiques, si les autorités sanitaires devaient spécifier 35 cycles maximum, selon l’article de Jaafar à l’IHU à 35 cycles, il ne resterait plus que 3 % de vrais positifs ! Ils notent, « un résultat analytique avec une valeur CT de 45 est scientifiquement absolument dénué de sens (une valeur CT raisonnable ne doit pas dépasser 30). »

Le 27 novembre 2020, un groupe très respecté de plus de 20 virologues, microbiologistes et scientifiques du monde entier a publié un appel à Eurosurveillance pour retirer l’article du 23 janvier 2020 du « Dr » Christian Drosten, l’inventeur du dit « test » PCR. Leur analyse minutieuse de la pièce originale est accablante. Le leur est un véritable « examen par les pairs ». Ils accusent Drosten d’incompétence scientifique « fatale » et de failles dans la promotion de leur test.

Il est même possible que ce test fourré au fond du nez serve rapidement à ficher toute la population avec l’ADN des frottis. Une firme britannique entend gagner ainsi beaucoup d’argent.

Que seule la complicité servile des mé(r)dias — hormis en France l’exception notable de France Soir et quelques rares autres — soutenue par une censure féroce dans tous les réseaux sociaux a permis d’installer la doxa officielle dans les cerveaux d’une population hypnotisée, abasourdie. Toute forme de pensée critique, quelle qu’elle soit, est immédiatement accusée d’être complotiste, la plupart des professionnels compétents sont muselés par la peur du dénigrement.

« Le grand test que fut la grippe H1N1 a appris aux mondialistes que le contrôle absolu des médias conditionnait la réussite du projet. C’est aujourd’hui chose faite. Devant des médias complices de la conspiration, débitant ad nauseam la doxa du système, la censure systématique — notamment sur les réseaux sociaux — et la ridiculisation de toute voix discordante à l’aide d’étiquettes telles que « complotisme » ou « anti-vax ». La censure organisée sur tous les réseaux sociaux et dans la pressetituée nous a prouvé très tôt l’existence d’un projet, d’une volonté, d’une coordination du crime, avec les fameux « fact-checkers » — simples informaticiens ou joueurs de jeux vidéo autoproclamés défenseurs de la « science » — formant les bataillons de la répression afin de maintenir à tout prix la vision et les ordres de l’OMS. »

Notons que cette nouvelle version de l’historique confirme une fois de plus les récits de Denis Rancourt et Pascal Sacré dans mondialisation.ca entre autres, et ceux de Reiner Fuellmich dans nombre de vidéos et de bien d’autres ; tous travaux que nous avons tenté de répercuter pour rassurer et faire stopper cette double tromperie, imposture, duperie, falsification, fraude, dans un silence et une indifférence intersidérale.

D’où vient la valeur magique de ce bout de coton enfoncé au fin fond de votre nez, alors qu’on vous raconte que ce virus malin est fort contagieux et qu’il faut porter un masque pour éviter de contaminer les autres, même en forêt ou à la plage voire seul sur le mont Blanc ?

Appelez le test PCR du nom de votre choix, fraude médicale étant peut-être encore le plus approprié, mais informez, que cette plandémie puisse cesser avec son cortège de drames, de malades cancéreux et autres non traités, de suicides, de faillites, de ruptures, etc.

En résumé

Les tests PCR doivent être abandonnés et les malades diagnostiqués par les médecins comme pour n’importe quelle grippe.

Les cas ne sont pas des malades.

Les asymptomatiques ne sont pas malades et ne sont pas contagieux.

Les pseudovaccins géniques ne protègent pas des contaminations ni des formes graves, comme le nombre élevé d’hospitalisés double-vaccinés en Israël ou en Angleterre le démontre. Leurs effets secondaires sont importants, bien supérieurs aux autres « vaccins ».

En France, le syndrome Tchernobyl et la peur du conseil de l’ordre et des supérieurs hiérarchiques bloquent l’information qui ne doit néanmoins être guère différente des autres pays.

Pour désarmer le ministre sans violence, il faut le priver de la croyance en son test PCR et de ce narratif mensonger.

Et pour tous ceux qui se sont fait injecter pour retrouver la liberté, si vous ne vous réveillez pas, vous avez pris un abonnement pour perpet…[9]

Dre Nicole Delépine

Notes :

[1] Faites vos jeux, rien ne va plus ! Comment le gouvernement peut-il parler de cinquième vague ? — Nouveau Monde (nouveau-monde.ca)

[2] Nuremberg-Covid : un crime contre l’humanité qui doit être jugé ! — Riposte LaïqueRiposte Laïque (ripostelaique.com)

[3] Vers le faire-part de décès des tests PCR (francesoir.fr)

Un tribunal portugais juge que les tests PCR sont « peu fiables » et les quarantaines « illégales » (profession-gendarme.com)

[4] Les bien-portants, dits « asymptomatiques », ne transmettent pas le Covid19 : étude chinoise sur 10 millions de personnes ! (francesoir.fr)

[5] Un Plan Pour Le Monde — Nouveau Monde (nouveau-monde.ca) et

Planète Homéopathie • Un Plan Pour Le Monde (planete-homeopathie.org) avec toutes les références

[6] résumé par Fuellmich lui-même : « Le fait est que les tests PCR comme méthode de mesure des infections ne sont pas seulement une absurdité scientifique, mais a apparemment été programmé intentionnellement de manière à créer le plus grand nombre possible de faux positifs, et donc à semer la panique dans le monde. Cela est prouvé par un article de rétractation rédigé par 22 scientifiques internationaux très respectés, qui demande à l’éditeur de la revue de rétracter immédiatement ces absurdités. Il a été consulté environ 18 millions de fois jusqu’à présent ». « En outre, l’affirmation de Drosten, selon laquelle il existe des infections asymptomatiques, est également fausse.Parce qu’il n’y a rien de tel, comme l’a récemment prouvé une grande étude de Wuhan, concernant 10 millions de personnes ». « Une personne qui ne présente aucun symptôme est en bonne santé — n’en déplaise au bon Docteur Knock. Cela signifie qu’aucun de nous ne doit avoir peur des personnes qui ne présentent aucun symptôme et les forcer à porter des masques, ni avoir peur qu’un résultat positif signifie forcément qu’il est infecté. Les images d’horreur des hôpitaux avec des lits dans les couloirs, qui réapparaissent maintenant, existent en fait chaque année pendant la vague de grippe tout à fait normale. Elles ne sont utilisées maintenant qu’à dessein, afin d’alimenter davantage la panique. Il n’y a toujours pas de surmortalité en Allemagne. Plus de gens meurent en hiver : c’est tragique, mais c’est malheureusement “normal” ». « Alors, de quoi s’agit-il vraiment s’il n’y a pas de problème de santé qui diffère de la vague de la grippe habituelle ? À cet égard, nous avons pu nous forger une opinion sur la base des auditions qui ont eu lieu, ainsi que des informations complémentaires.

[8] Et donc sans possibilité de relecture par ses pairs.

[9] élargissement de la dose de rappel à tous.

– Réduction du délai de 6 à 5 mois pour faire prendre sa dose de rappel ;

– À partir du 15 décembre, le pass sanitaire pour les +65 ans ne sera plus actif si l’injection de rappel n’aura pas été prise dans un délai de 7 mois après la dernière dose ;

– À partir du 15 janvier 2022, le pass sanitaire ne sera plus valide pour toutes les autres classes d’âges n’ayant pas pris leur dose de rappel.

Pour toutes et tous ceux qui croyaient que se faire injecter, c’était le retour à la liberté, vous voilà rassurés.

Vous venez de prendre pour perpet ». Via libreetinsoumis sur telegram

= = =

Lire notre page « Coronavirus, guerre contre l’humanité »

La fraude des tests RT-PCR (PDF)

mort_par_medicament

vax_BD

Dictature sanitaire et Nouvel Ordre Mondial : confirmation si besoin était de la fraude des tests RT-PCR pour COVID19 (Dr Nicole Delépine)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, désinformation, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , on 20 novembre 2021 by Résistance 71

resistance1

Nous avons dénoncé cette falsification des chiffres à coup des tests RT-PCR  et publié des articles depuis novembre 2020 avec rappel en mars 2021 sur la base de la fraude chiffrée que constitue les “tests” PCR qui ne sont pas des tests, mais un outil de duplication de matériel génétique pour pouvoir cultiver et travailler sur des échantillons. Ceci des mots mêmes de leur inventeur le Pr Karry Mullis, prix Nobel de chimie 1993 pour cette découverte.
De fait, nous avions relayé en août 2020 un article du journaliste Jon Rappoport traduit en français, mais dont la publication en anglais remontait à avril 2020, c’est à dire au tout tout début de la “pandémie” : “Les tests COVID19 sont une fraude !”
Le seul moyen de déclarer une “pandémie” est de :

1- changer la définition d’une “pandémie” ce qu’a fait l’OMS un paquet de fois depuis la “pandémie” H1N1 qui avait fait un gros “flop”

2- Falsifier les chiffres des données. Deux méthodes employées efficacement dans le cas de la fraude COVID19 : 

a) L’utilisation d’algorithmes et de “modèles informatiques”, c’est à dire ne plus baser la science sur l’observation des faits, mais extrapoler sur des modèles informatiques, qui “projettent” des résultats en fonction d’algorithmes et de données intégrés qui peuvent parfaitement être erronées, insuffisantes ou simplement falsifiés. Ainsi nous avait-on prédit 500 000 morts en France selon les “modèles” et qu’urgence il y avait.
Nous vivons depuis des lustres dans un monde de la “science des modèles”,  manipulatrice à souhait, un des meilleurs exemples étant celui de la fraude (une de plus !) de la théorie du réchauffement climatique anthropique, basée sur des modèles informatiques (sciemment) erronés… Le cas COVID n’est qu’un symptôme de plus de cette maladie qui ronge la science au profit de desseins vils, veules et criminels.

b) L’utilisation de “tests” frauduleux ayant pour vocation de donner des résultats dans le sens escompté, en l’occurence une marée de “cas positifs”, surgonflant les chiffres et facilitant la réaction à une peur synthétique, fabriquée à coup d’algorithmes et de “tests” erronés. Ceci permet la mise en place du pilotage émotionnel des masses et de proposer des “solutions” toutes pus liberticides les unes que les autres…
Mais il ne faut pas s’arrêter en si bon chemin. Tout ceci n’est qu’outil pour finaliser un objectif : celui de la mise en place d’une dictature technotronique, qui par le contrôle numérique se voudra résoudre et contrôler toutes les “crises” fabriquées (COVID, crise économique, crise “climatique”, crise démographique}, bien évidemment sous le couvert pernicieux de “sécurité, de “bien commun”, de “santé publique” et de “bien-être pour tous” dans un meilleur des mondes pré-digéré pour nous par un ramassis de criminels psychopathes qui essaient coûte que coûte de sauver, de transmuter le système qui les maintient au pouvoir et qui arrive au bout du bout du banc, en un Nouvel Ordre Mondial de l’horreur eugéniste et transhumaniste, sur toile de fond de d’immortalité et de “fontaine de jouvence” élitiste.
Il est plus que grand temps que nous, les peuples de la Terre, unis, ne les mettions eux et le système qui les génère, hors d’état de nuire.
Notre page “coronavirus” s’intitule depuis le tout début 2020 “Coronavirus, guerre contre l’humanité”. Nous ne l’avons pas intitulée de la sorte par pure coïncidence… Nous sommes sous attaque directe du système oligarchique par excellence. Nous sommes, depuis 2020, entrés de pleins pieds dans la phase terminale de mise en place et à terme, ce sera eux ou nous. Ils ne reculerons pas et nous sommes, nous les peuples de monde, plus que jamais en état de légitime défense permanente.
Il nous faut d’abord vaincre mentalement et physiquement l’oppression qui nous accable, puis immédiatement, dans le même temps mettre en place un système social des associations libres et de mise en avant du véritable bien commun, hors état, hors marchandise, hors argent et hors salariat. Ceci est la seule solution viable pour la réalisation de notre humanité. La condition pour l’espèce humaine de devenir enfin adulte au-delà de toutes les chimères et impostures du monde étatico-marchand en fin de cycle et voués aux oubliettes de l’Histoire.
Il n’en tient qu’à nous. La solution est en nous, unis et solidaires.
~ Résistance 71 ~

“La question sociale est une question agraire” (Gustav Landauer)

RT-PCR1
Test bidon + données bidon = vraie peur fabriquée !!

RÉVÉLATIONS CAPITALES DE LA FDA

Invention du récit Covid

Dr Nicole Delépine

18 novembre 2021

url de l’article original:

La mystification par le test PCR pour créer le mythe de la pandémie et entretenir la peur

La mystification par l’usage inapproprié du test PCR, dénoncée depuis octobre 2020 par l’avocat Reiner Fuellmich continue malgré sa condamnation en justice en octobre 2020 au Portugal.[1][2]

Partout dans les pays riches, les gouvernants imposent son usage mortifère grâce à la corruption de nombreux scientifiques et médecins, médias auxquels on laisse la parole, les nombreux autres étant diffamés menacés et muselés.

Actuellement, un simple test positif vous fait qualifier de « cas »,[3][4][5] vous déclare dangereux pour les autres, vous interdit de travail, d’école ou de sport et vous expose à des interrogatoires dignes de l’inquisition (la torture physique en moins) pour que vous dénonciez ceux que vous avez rencontrés, qui seront aussitôt déclarés cas contact et soumis à leur tour à la folie d’exclusion et de tests répétitifs.

Pour casser la chaîne de transmission, il faut isoler les vrais malades, ceux qui présentent des signes cliniques (fièvre, toux, fatigue, anosmie…) chez lesquels le test peut être utile pour confirmer le diagnostic d’infection virale (et guère plus) et laisser vivre normalement les asymptomatiques (qui ne sont que très exceptionnellement contaminateurs).

Chez une personne ne présentant aucun signe clinique, la positivité d’un test PCR n’indique absolument pas qu’elle est malade, ni qu’elle le deviendra, ni qu’elle est porteuse de virus, ni qu’elle peut le transmettre.

Ces constatations ont initialement été faites sur 3790 cas positifs.[6]

Leur confirmation définitive en a été réalisée lors du dépistage colossal (10 millions de personnes testées) autour de Wuhan[7] où aucun des 300 asymptomatiques positifs en PCR ne s’est révélé porteur de virus, ni contaminant, ni atteint par la maladie après un mois de surveillance.

Nous savons, ils savent, et nous savons qu’ils savent.[8]

Un document récent de la FDA admet enfin que le test PCR « Covid » a été développé sans échantillons viral spécifique isolé pour l’étalonnage des tests, admettant qu’il teste autre chose,[9] quelques séquences d’ARN insuffisamment spécifiques du virus

Le tristement célèbre test PCR pour le coronavirus (Covid-19) n’a pas été développé avec des échantillons réels, mais plutôt avec ce qui semble être du matériel génétique provenant d’un virus du rhume.

Dans le document de la FDA, il est clairement indiqué que le matériel génétique ordinaire de la grippe saisonnière a été utilisé comme marqueur de test dans les kits de test PCR.

Pourtant les autorités savaient que de nombreuses personnes seraient testées « positives », leur permettant ainsi d’utiliser ces résultats pour créer le récit « Covid ».

Il n’existe aucun test légitime permettant d’identifier avec précision la présence du SRAS-CoV-2.

Une autre révélation dans le document récent est l’admission par la FDA que les résultats des tests sont « regroupés » et donc produisent des chiffres inexacts. La FDA fabrique littéralement des données pour soutenir un faux récit.

AINSI : « nous sommes maintenant à la croisée des chemins dans le monde entier. Le moment est à nous de décider si nous allons permettre à ce type de fascisme médical de persister et d’avoir un impact sur l’avenir de nos enfants. Ou si nous allons enfin dire non à la politique tyrannique du gouvernement. »[10]

Extraits choisis du document de la FDA de janvier 2020 et revu régulièrement (dernier en juillet 2021)

« Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession : MN908947.2)

« Étant donné qu’aucun isolat de virus quantifié du 2019-nCoV n’était disponible pour une utilisation par les CDC au moment où le test a été développé et que cette étude a été menée, des tests conçus pour la détection de l’ARN 2019-nCoV ont été testés avec des stocks caractérisés d’ARN transcrit in vitro sur toute la longueur (gène N ; Accession GenBank : MN908947.2) de titre connu (copies d’ARN/μL) enrichi en un diluant constitué d’une suspension de cellules A549 humaines et d’un milieu de transport viral (VTM) pour imiter l’échantillon clinique.[11]

CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel[12]

« Les résultats concernent l’identification de l’ARN du SRAS-CoV-2.

L’ARN du SRAS-CoV-2 est généralement détectable dans les échantillons des voies respiratoires supérieures et inférieures pendant l’infection. Les résultats positifs sont révélateurs d’une infection active par le SRAS-CoV-2, mais n’excluent pas une infection bactérienne ou une co-infection par d’autres virus. L’agent détecté peut ne pas être la cause définitive de la maladie. Les laboratoires aux États-Unis et dans leurs territoires sont tenus de rapporter tous les résultats aux autorités de santé publique compétentes.

Les résultats négatifs n’excluent pas l’infection par le SRAS-CoV-2 et ne doivent pas être utilisés comme seule base pour le traitement ou d’autres décisions de prise en charge des patients. Les résultats négatifs doivent être combinés avec des observations cliniques, des antécédents du patient et des informations épidémiologiques. »

Autre extrait :

“NE PAS JETER : Informations importantes spécifiques au produit *** LIMITATIONS Ce test n’a pas été approuvé par la FDA. Ce test a été autorisé par la FDA en vertu d’une EUA pour une utilisation par des laboratoires autorisés. Ce test n’a été autorisé que pour la détection de l’acide nucléique à partir du 2019-nCoV, et non pour d’autres virus ou agents pathogènes.

Ce test n’est autorisé que pour la durée de la déclaration selon laquelle il existe des circonstances justifiant l’autorisation de l’utilisation d’urgence de diagnostics in vitro pour la détection et/ou le diagnostic du SARS-CoV-2 en vertu de l’article 564(b)(1) de la Federal Food, Drug, and Cosmetic Act, 21 U.S.C. § 360bbb-3(b)(1), à moins que l’autorisation ne soit résiliée ou révoquée plus tôt.”

“Mea Culpa de l’OMS”

L’OMS en avril 2021 avait attiré l’attention de l’invalidité de trop des tests PCR surtout lorsque les laboratoires utilisent fallacieusement des amplifications du signal trop élevées. Aucun compte n’a été tenu de cette mise en garde, du moins dans la plupart des labos français.[13]

Vous trouverez ci-dessous la ‘rétractation’ soigneusement formulée par l’OMS. Le texte intégral avec le lien vers le document original est en annexe« [14]

“Le document d’orientation de l’OMS sur les Tests diagnostiques pour le dépistage du SARS-CoV-2 souligne que les résultats faiblement positifs doivent être interprétés avec prudence.

La valeur de cycle seuil (Ct) nécessaire pour détecter le virus est inversement proportionnelle à la charge virale du patient. Lorsque les résultats du test ne correspondent pas au tableau clinique, il convient de prélever un nouvel échantillon et de répéter le test en utilisant une méthode d’amplification des acides nucléiques identique ou différente.

L’OMS rappelle aux utilisateurs de DIV[15] que la prévalence d’une maladie altère la valeur prédictive des résultats de test ; à mesure que la prévalence diminue, le risque de faux positifs augmente.

Cela signifie que la probabilité qu’une personne ayant obtenu un résultat positif (SARS-CoV-2 détecté) soit réellement infectée par le SARS-CoV-2 diminue à mesure que la prévalence diminue, quelle que soit la spécificité déclarée du test. (emphase ajoutée par l’auteur).”

Estimations erronées 

Ce n’est pas une question de “faibles positifs” ou de “risque de faux positifs”. L’enjeu relève au point de départ en janvier 2020 de la mise en application par l’OMS d’une méthodologie trompeuse et erronée qui conduit à des estimations qui n’ont aucune base scientifique. 

Ce que cette déclaration contradictoire de l’OMS confirme, c’est que l’estimation du Covid positif à partir d’un test PCR (avec un seuil d’amplification de 35 cycles ou plus) est tout simplement invalide. Dans ce cas, l’OMS recommande de répéter le test PCR :

il convient de prélever un nouvel échantillon et de répéter le test…”.

“Retester, On s’est trompé…”. Cette recommandation de RÉPÉTER LE TEST n’a aucun sens. C’est une impossibilité. Des millions de personnes dans le monde entier ont déjà été testées, à partir du début février 2020. Il s’agit néanmoins de conclure que la recommandation contradictoire de l’OMS de “retester” confirme sans équivoque QUE CES ESTIMATIONS PCR RELATIVES À LA Covid SONT TOUT SIMPLEMENT ERRONÉES.[16]

Au point de départ en janvier 2020, le test PCR fut (de manière routinière) appliqué à un seuil d’amplification Ct de 35 ou plus, conformément aux recommandations de l’OMS. Cela signifie que la méthodologie PCR appliquée dans 193 pays membres des Nations Unies a mené au cours des 12 à 14 derniers mois à la compilation de statistiques Covid surestimées et trompeuses.

Et ce sont ces statistiques (erronées) qui servent à mesurer l’évolution de ladite “pandémie”.

Au-dessus d’un cycle d’amplification de 35 ou plus, le test ne détectera pas spécifiquement les segments du virus . Par conséquent, ces chiffres n’ont aucun sens.

Il s’ensuit qu’il n’y a aucune base scientifique pour confirmer l’existence d’une pandémie.

Ce qui signifie également que le verrouillage (confinement) ainsi que les mesures économiques qui ont entraîné la panique sociale, l’accroissement extrême de la pauvreté et le chômage (dont l’objectif annoncé par les gouvernements était de freiner la propagation du virus) n’ont aucune justification ».

Par ailleurs d’autres scandales éclatent par rapport au test PCR[17]

La US Food and Drug Administration a émis « le type de rappel le plus sérieux » pour des kits de test à domicile populaires qui indiquent si une personne est infectée par le coronavirus. Au moins 2,2 millions de produits pourraient avoir donné de faux positifs.

Quelques 2 212 335 kits produits par la société de biotechnologie Ellume, basée en Australie, et distribués aux États-Unis, présentent potentiellement des résultats faussement positifs au test de dépistage du SARS-CoV-2, a indiqué l’agence de santé publique dans un communiqué récent en novembre 21.

La FDA a averti que l’utilisation de kits défectueux « peut entraîner de graves conséquences néfastes pour la santé ou la mort », qualifiant le cas de « rappel de classe I ».

En conclusion, la confirmation que les tests PCR ne sont pas fiables et ne devraient en aucun cas être utilisés par les gouvernements comme preuve de la « pandémie » vient de la FDA elle-même.

Il est grand temps que nos dirigeants reviennent aux moyens classiques d’évaluer les épidémies : 

le comptage des malades et celui des morts de la maladie.

Notes :

[1] Vers le faire-part de décès des tests PCR (francesoir.fr)

[2] La grande supercherie des tests PCR, 90 % des cas positifs ne sont pas malades ni contagieux (francesoir.fr)

[3] *Elena Surkova, Vladyslav Nikolayevskyy, Francis Drobniewsk

False-positive Covid-19 results: hidden problems and costshttp://www.thelancet.com/respiratory Vol 8 December 2020

[4] https://latribunedissidente.over-blog.com/2020/10/la-pertinence-des-tests-pcr-dr-pascal-sacre.html

[5] Covid : La PCR nasale peut-elle mentir ? Dr Pascal Sacré, AIMSIB, 30 août 2020

[6] Rita Jaafar Corrélation entre 3790 échantillons positifs de réaction en chaîne de polymérase quantitative et cultures de cellules positives, y compris 1941 isolats de coronavirus 2 du syndrome respiratoire aigu sévère Maladies infectieuses cliniques, 28/9/2020 ciaa1491,

https://doi.org/10.1093/cid/ciaa1491

[7] France info avec AFP : Après avoir mobilisé plus de 28 000 soignants sur plus de 2 800 sites, les autorités de Wuhan (Chine) ont réalisé la plus vaste opération de dépistage du Covid-19 chez onze millions d’habitants pour un prix de 127 millions de dollars lundi 9 août 2020…

[8] L’archipel du goulag, Soljenitsyne

[9] https://www.fda.gov/media/134922/downloadwww.fda.gov

[10] https://rightsfreedoms.wordpress.com/2021/10/27/fda-document-admits-Covid-pcr-test-was-developed-without-isolated-samples-for-test-calibration-e

[11] https://www.fda.gov/media/134922/downloadwww.fda.gov

[12] Centers for Disease Control and Prevention Division of Viral Diseases 1600 Clifton Rd NE Atlanta GA 30329 CDC-006-00019, Revision: 07 CDC/DDID/NCIRD/ Division of Viral Diseases Effective: 07/21/2021

[13] L’OMS confirme que le test Covid-19 PCR est invalide, les estimations des « cas positifs » sont sans fondement. Le confinement n’a aucune base scientifique. | Mondialisation — Centre de Recherche sur la Mondialisation

[14] WHO Information Notice for Users 2020/05

[15] Diagnostic in vitro

[16] Le Pr Prof Michel Chossudovsky mentionne qu’il existe plusieurs autres défauts concernant le test PCR qui ne sont pas abordés dans cet article. (Voir le livre électronique de Michel Chossudovsky :

The 2020 Worldwide Corona Crisis: Destroying Civil Society, Engineered Economic Depression, Global Coup d’État and the Great Reset(Chapitre II).

[17] FDA recalls millions of Covid test kit over false results – Asume Tech 11 Nov 21

= = =

Lire notre page “Coronavirus, guerre contre l’humanité” et y voir les articles répertoriés vers le bas de page remontant à novembre 2020 et mars 2021 sur la fraude des “tests” PCR

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

poster3

resistance1

desobeissance-civile

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Test COVID-19 RT-PCR : deux textes vitaux pour comprendre la fraude des chiffres statistiques de la pandémie (PDF)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 17 décembre 2020 by Résistance 71

 

 

Résistance 71

 

17 décembre 2020

 

Nous avons traduit et publié récemment ces deux textes que Jo nous a réunis en un temps record dans ce PDF vital à la compréhension de l’enfumage auquel nous sommes tous victimes et qui vise à la mise en place d’une bonne partie de la grille de contrôle technotronique planétaire, comme l’explique par ailleurs le physicien Philippe Guillemant, et du contrôle eugéniste de la population mondiale par l’oligarchie en charge de faire perdurer le système étatico-capitaliste en phase de mutation vers son objectif final transhumaniste.
La mise en place d’une dictature sanitaire planétaire ne peut reposer que sur une seule chose ressentie par la vaste majorité des gens: la peur, voire la psychose face à quelque chose qu’on ne peut pas voir ni maîtriser (plutôt, qu’on ne VEUT pas maîtriser). Quoi de mieux donc qu’un nouveau croquemitaine invisible et nuisible à souhait, entre ainsi en scène le nouveau coronavirus (créé en laboratoire) :

Bébert Corona. Pour que la peur soit effective, durable, ajustable et modulable il faut qu’elle s’appuie sur la « science », mais pas n’importe quelle science… celle des chiffres, des statistiques et des extrapolations modélisées, comme à l’accoutumée maintenant ; de cette science qui privilégie les modèles informatiques à l’observation de faits de terrain.
Pour ce faire, il faut des chiffres, mais pas n’importe lesquels et certainement pas ceux qui résulteraient d’une observation réelle de terrain, mais de chiffres « adaptés » pour la circonstance, non pas falsifiés par quelques personnes mal intentionnées, ce serait vite repérable, mais par un protocole litigieux à moins, frauduleux au pire, pratiqué à l’insu et au plein gré de toutes et tous. Entre en scène les kits de test RT-PCR pour Real Time-Polymerase Chain Reaction… Tout est en place… le virus a été largué dans la nature… Que la fête commence !

Qu’est-ce que ce test PCR et quel usage en est-il fait ? Quelques réponses essentielles dans ces deux articles que nous avons traduits et que Jo nous a mis en PDF, à lire et diffuser sans aucune modération.

Dossier-special-CoV19-fraude-tests-RT-PCR
format PDF

 

Entretien du Pr. Personne avec France-Soir au sujet de sa suspension.
Nous devons dire ici que depuis quelques semaines, nous sommes étonnés de voir France-Soir
comme voix critique dans les médias de masse français au sujet de cette crise COVID.
Tout à leur honneur, ne crachons pas dans la soupe…

 

La peur fabriquée… Au cœur du scandale allemand des tests RT-PCR permettant la falsification des chiffres COVID-19 (F. William Engdahl)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, N.O.M, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , on 16 décembre 2020 by Résistance 71

 

Là, on tape vraiment dans le bois dur avec ce superbe article d’Engdahl…
La dictature sanitaire, le « consentement » des populations à une vaccination de masse contre un virus dont le taux de mortalité réel est de l’ordre de 0,03% des gens infectés et avec des vaccins 100% expérimentaux qui sont en fait de la thérapie génique, ne peut se faire que sur un argument entretenant la peur, la psychose généralisée dans un environnement volontairement maintenu anxiogène. La base sont les chiffres sortis du chapeau magique tel le lapin, turlututu chapeau pointu ! La falsification des données chiffrées et des stats de contagion via un test ouvrant toutes les portes possibles à une fraude généralisée.
Nous y sommes. La fraude au test RT-PCR permet peur => psychose => acceptation de mesures les plus totalitaires qui soit.
Il est grand temps d’y mettre un terme définitif ! Reprenons possession de la science au passage, celle-ci, en tout domaine a été kidnappée pour le profit du plus petit nombre. Le système marchand dans sa vampirisation totale a remplacé la science des données et des observations naturelles de terrain, par celle des modèles informatiques bidouillantes à souhait. Ceci se passe en tut domaine scientifique où des « modèles informatiques », des logiciels d’extrapolation de données sont utilisés.
~ Résistance 71 ~

 

Un scandale coronavirus éclate dans l’Allemagne de Merkel

 

F. William Engdahl

 

10 décembre 2020

 

url de l’article original:
https://journal-neo.org/2020/12/10/coronavirus-scandal-breaking-in-merkel-s-germany-2/

 

~ Traduit de l’anglais par Résistance 71 ~

 

Le modèle allemand adulé de gestion de la crise pandémique du COVID19 du régime d’Angela Merkel est maintenant en proie à une série de scandales potentiellement dévastateurs, qui vont au cœur même du conseil médical et du test qui est utilisé pour déclarer de draconiennes fermetures économiques et ensuite, une vaccination qui deviendra de facto obligatoire. Les scandales impliquent un professeur qui est au cœur du groupe de conseil de Merkel sur l’affaire du corona. Les implications vont bien au-delà des frontières de l’Allemagne, jusqu’au plus profond de l’OMS elle-même et de ses recommandations globales.

Le cas entier de confinement d’urgence mandaté par l’OMS, confinement des affaires, des écoles, des églises et autres arènes sociales dans le monde, est fondé sur un test introduit incroyablement plus tôt, dans la saga du coronavirus de Wuhan en Chine. Le 23 janvier 2020, dans la revue scientifique Eurosurveillance du Centre pour la Prévention et le Contrôle des Maladies (CPCM) de l’UE, le Dr Christian Drosten, avec d’autres collègues de l’Insitut de Virologie de Berlin à son Hôpital de la Charité, ainsi que la patron d’une petite entreprise de biotechnologie berlinoise, TIB Molbiol Syntheselator GmbH, ont publié une étude affirmant avoir développé le premier test efficace pour détecter si quelqu’un est infecté avec le nouvel coronavirus identifié juste quelques jours auparavant à Wuhan. Le titre de l’article de Drosten était “Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR” (Eurosurveillance 25(8) 2020). La nouvelle fut accueillie par sa validation immédiate par le directeur général corrompu de l’OMS, Tedros Adhanom, le premier non médecin a présider l’OMS dans son histoire. Depuis lors, le test pour le virus de Drosten, appelé real time ou RT-PCR, s’est répandu dans le monde via l’OMS, comme étant le protocole de test le plus usité pour déterminer si une personne peut avoir la COVID-19, la maladie.

Le 27 novembre, un groupe de 23 virologues, de microbiologistes et scientifiques affiliés internationaux très respectés, ont publié un appel pour qu’Eurosurveillance rétracte l’article du 23 janvier du Dr Drosten. Leur analyse minutieuse de l’article original est dévastatrice (damning.). La leur est une véritable revue par les pairs (“peer review”) Ils accusent Drosten et sa cohorte d’incompétence scientifique “fatale” et de grosses lacunes quant à la promotion de leur test.

Pour commencer, comme le révèle les scientifiques, l’article qui a établi le test PCR de Drosten pour la variété de virus de Wuhan qui a été subséquemment adopté avec une rapidité indécente par le gouvernement Merkel ainsi que par l’OMS pour une utilisation mondiale, ce qui résulta en de sévères mesures de confinement globales et une catastrophe économique et sociale, n’a jamais été révisé par les pairs avant sa publication par la revue Eurosurveilance. Les critiques font remarquer que, l’article Corman-Drosten a été soumis à Eurosurveillance le 21 janvier 2020 et accepté pour publication le 22 janvier. Le 23 janvier, l’article était publié en ligne. De manière incroyable, le protocole de test de Drosten, qui avait déjà été envoyé à l’OMS à Genève le 17 janvier, fut officiellement recommandé par l’OMS comme pour être le test mondial pour déterminer la présence du coronavirus de Wuhan, et ce avant même que l’article ne fut publié. (published.)

Comme les auteurs critiques le font remarquer, pour un sujet si important et si complexe pour la santé et la sécurité du monde, une révision sérieuse par au moins deux pairs dans le domaine de recherche sur une période de 24 heures n’est pas possible. Les critiques de l’article font aussi remarquer que Drosten et sa co-auteure Dr Chantal Reusken n’ont pas divulgué un évident conflit d’intérêt. Tous deux étaient aussi membres du comité d’édition d’Eurosurveillance. De plus, comme rapporté par la BBC et Google Statistics, le 21 janvier, il y avait un total mondial de 6 morts attribuées au coronavirus de Wuhan. Ils demandent “Pourquoi les auteurs assument-ils un défi aux laboratoires de santé publique alors qu’il n’y avait aucune preuve substantielle à ce moment là indiquant que la contagion était plus importante qu’envisagé ?Un autre co-auteur de l’article de Drosten donnant une couverture d’apparente crédibilité scientifique à la procédure PCR de Drosten était le patron de l’entreprise qui a développé le test promu et vendu aujourd’hui, avec la bénédiction de l’OMS et ce à des centaines de millions d’exemplaires, Olfert Landt de Tib-Molbiol de Berlin, mais Landt n’a pas fait part de ce fait intéressant non plus dans l’article de Drosten.

Certainement rien de suspicieux ou de discutable là-dedans n’est-il pas ? Il serait intéressant de savoir si Drosten, le chef conseiller scientifique de Merkel pour la COVID-19, le de facto Tony Fauci de l’Allemagne, reçoit un pourcentage sur chaque vente de test effectuée par Tib-Molbiol dans leur accord de marketing global avec les laboratoires Roche.

De faux positifs ?

Depuis la fin juillet 2020, les médias de masse du monde nous ont inondé de mises à jour heure par heure, toutes plus terrifiantes les unes que les autres, du “nombre total de personnes infectées par le coronavirus”. Routinièrement, ils ajoutent simplement l’augmentation du jour à un total global de “cas confirmés”, qui seraient à l’heure actuelle de 66 millions. Alarmant, sauf pour le fait que, comme le font remarquer Pieter Borger et ses collaborateurs scientifiques, le chiffre de “cas confirmés” est un total non sens. Pourquoi ?

Le rapport Borger identifie ce qu’ils qualifient de “10 problèmes fatals” dans l’article de Drosten de janvier dernier. Ici, nous allons prendre le plus évident et le plus facile à comprendre pour la plupart des personnes du commun.

Drosten & co ont donné des séquences premières et d’essais non spécifiées et donc confuses. Les critiques notent “Le chiffre important de variantes est non seulement inhabituel, mais aussi porte à beaucoup de confusion pour les laboratoires. Ces six positions non spécifiées pourraient facilement être le résultat du design de plusieurs séquences primaires alternatives différentes qui n’ont pas de rapport avec le SRAS-CoV-2… la description non spécifiée et confuse dans l’article Drosten-Corman n’est pas souhaitable dans un protocole opérationnel standard. Ces positions non spécifiées auraient du être établies sans équivoque possible.” Ils ajoutent que “RT-PCR n’est pas recommandé pour des diagnostiques primaires d’infections. C’est pourquoi le test RT-PCR utilisé de manière clinique routinière pour la détection de la COVID-19 n’est pas indiqué pour un diagnostique COVID-19 sur une base régulière.

L’amplification des cycles

Mais encore plus condamnant pour Drosten est le fait que nulle part il ne mentionna qu’un test serait positif ou négatif, ni même ce qui définirait un résultat positif ou négatif ! Le rapport Borger note “Ces types de tests pour diagnostique virologique doivent être basés sur un POS (Protocole Opérationnel Standardisé), incluant un nombre de cycles PCR fixé et validé (valeur Ct) en comparaison duquel un échantillon est évalué positif ou négatif. La valeur Ct maximale fiable est de 30 cycles. Au-dessus de 35 cycles, un nombre rapidement croissant de faux positifs doit être attendu…. des études scientifiques montrent que seulement des virus non-infectant (morts) sont détectés avec une valeur Ct de 35.

(NdT: notons ici au passage que la France “teste” à une Ct = 35)

L’OMS et Drosten recommandent une valeur Ct de 45 cycles et, comme rapporté, les officiels de la santé allemands font de même. Pas étonnant donc qu’alors que le nombre de tests a drastiquement augmenté pour la saison grippale hivernale, les “positifs” PCR ont explosé en Allemagne et partout ailleurs. Comme le font remarquer les auteurs critiques de l’article, si les autorités sanitaires décrétaient des tests avec un maximum de 35 cycles, le nombre de cas positifs au COVID-19 seraient aujourd’hui moins de 3% des chiffres actuels ! Ils notent “un résultat analytique avec une valeur Ct de 45 est absolument sans aucun sens diagnostique et scientifique (une valeur Ct raisonnable ne devrait pas dépasser 30 cycles). Tout ceci devrait être communiqué de manière claire et précise. C’est une erreur signifiante non adressée par l’article Drosten-Corman, ce fait de ne pas mentionner la valeur Ct maximum à laquelle un échantillon peut-être sans ambigüité considéré comme un test  positif ou négatif. La limite de cycle importante n’est pas non plus spécifiée dans quelques suivis et mises à jours faites jusqu’à maintenant.” Les auteurs ajoutent “Le fait que ces produits PCR n’ont pas été validés à l’échelle moléculaire est une autre erreur flagrante de protocole, rendant tout test fondé dessus inutile en tant qu’outil spécifique de dépistage du virus SRAS-CoV-2.”

En français simple, l’édifice complet de la Fondation Gates, du gouvernement Merkel, de l’OMS ainsi que le cas pour une vaccination forcée avec des vaccins non testés, repose sur des résultats d’un test PCR pour coronavirus qui ne vaut pas un pet de lapin. Le test de Drosten et de l’OMS pour tester la COVID-19 n’est que grosso modo une merde “scientifique”.

Manque aussi de preuve doctorale ?

Cette critique en provenance de 23 scientifiques du monde experts en ce domaine, incluant des scientifiques qui ont des expériences probantes liées à la PCR et au séquençage et l’isolation d’ADN, ainsi que d’un ex-top scientifique du laboratoire Pfizer, est dévastatrice, mais elle n’est pas le seul problème auquel doit faire face aujourd’hui le Dr Christian Drosten, Lui et les officiels de l’université Goethe de Francfort, où il affirma avoir obtenu son doctorat en médecine en 2003, sont accusés de fraude à l’obtention de diplôme. D’après le Dr Markus Kühbacher, un spécialiste d’enquête sur la fraude scientifique comme par exemple le plagiat dans les dissertations, la thèse du Dr Drosten, de par la loi doit être déposée à une certaine date butoir auprès des autorités administratives de son université, qui ensuite signe le formulaire légal, Revisionsschein, dument estampillé par l’université avec la date, un document contenant le titre de la thèse et l’auteur, afin qu’elle soit envoyée aux archives de l’université. Avec cela, trois copies originales de la thèse sont enregistrées.

Kühbacher accuse l’université Goethe de couverture de fraude car elle affirme, faussement, que le Revisionsschein de Drosten était archivé. Le porte-parole de l’université a été obligé d’admettre par la suite que ce n’était pas le cas, du moins les documents ne pouvaient-ils pas être localisés par eux. de plus, des trois copies obligatoires mises en archive de sa thèse de doctorat, ce qui est très important au vu de l’importance du rôle de Drosten dans toute cette affaire de coronavirus, deux copies ont “disparu” et la dernière copie demeurant a été endommagé par de l’eau. Kühbacher dit que maintenant le Dr Drosten va sans doute devoir faire face à une procédure légale pour détenir frauduleusement le titre de docteur en médecine.

Que cela se produise ou pas, c’est un fait qu’une autre procédure judiciaire a été engagée à Berlin contre deux personnes responsables d’un media allemand en ligne : Volksverpetzer.de, pour calomnie et diffamation, menée par un médecin allemand bien connu et très critique, le Dr Wolfgang Wodarg. Le litige judiciaire demande aux défendants 250 000 euros de dommage et intérêt pour diffamation et dégâts matériels envers Wodarg par les accusés sur leur site internet ainsi que dans un autre média allemand, litige affirmant une diffamation vicieuse sans preuve à l’encontre de Wodarg, l’appelant “négationniste du COVID”, affirmant faussement que le médecin était un extrémiste de droite (il est un ancien membre du parlement allemand pour le parti social démocrate) ainsi que d’autres accusations diffamatoires et/ou fausses.

L’avocat du Dr Wodarg est un avocat américano-allemand très connu, Dr Reiner Fuellmich. Dans sa plaidoirie contre les défendants, Fuellmich cite en entier les charges contre le test de Drosten pour le coronavirus par le rapport du Dr Borger et al. cité ci-dessus. Ceci a pour effet de contraindre les défendants à refuser l’article de Borger et de le réfuter. Ceci est un pas majeur vers la réfutation totale de cette fraude au test PCR de l’OMS pour la COVID-19. Il y a déjà eu une décision d’une cour d’appel de Lisbonne au Portugal le 11 novembre dernier, qui a décidé que le test PCR de Drosten et de l’OMS n’était pas valide pour détecter une infection au coronavirus et qu’il n’y avait aucune base pour ordonner des confinements partiels ou nationaux.

Si les enjeux n’étaient pas si mortels pour l’humanité, ceci pourrait être le matériel de base pour une comédie absurde. Le Tsar de la santé mondiale, patron de l’OMS, Tedros, n’est pas médecin et dont l’organisation mondiale de l’OMS est financée par un milliardaire n’ayant jamais fini l’université, gérant de logiciels ordinateurs, Bill Gates, qui conseille aussi le gouvernement Merkel sur les mesures à prendre contre la COVID-19. Le gouvernement allemand de Merkel utilise le test de Drosten et celui-ci en tant “qu’expert à la grande sagesse” pour imposer les conséquences économiques les plus draconiennes hors celles de la guerre. Son ministre de la santé Jens Spahn, est un ancien banquier qui n’a aucun diplôme médical et fut un lobbyiste pour Big Pharma. Le patron allemand de l’équivalent du centre de contrôle des maladies, appelé le Robert Koch Institute, Lothar Wieler, n’est pas un virologue mais un vétérinaire, Tierartz. Avec cette fine équipe, les Allemands voient leurs vies détruites par des confinements et des mesures sociales jamais encore imaginées en dehors de l’URSS de Staline. Il y a science et science et toute “science” n’est pas valide quoi qu’il en soit.

= = =

Lectures complémentaires:

SRAS-CoV-2 / COVID-19 : Test RT=PCR et falsification des chiffres

https://resistance71.wordpress.com/2020/12/10/cov19-test-pcr-et-falsification-des-chiffres-le-test-rt-pcr-ne-devrait-pas-etre-utilise-a-fins-therapeutiques-il-nest-quun-outil-de-fabrique-comme-concu-par-son-inventeur-kary-mullis/

Notre page “Coronavirus, guerre contre l’humanité”

La fraude au test RT-PCR, deux textes vitaux en format PDF:
Dossier-special-CoV19-fraude-tests-RT-PCR

 


Ayez peur !… Tremblez !…
et faites confiance à Big Pharma qui ne nous veut que du bien…

CoV19, test PCR et falsification des chiffres… Le test RT-PCR ne devrait pas être utilisé à fins thérapeutiques, il n’est qu’un outil de fabrique comme conçu par son inventeur Kary Mullis…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, N.O.M, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologie, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , on 10 décembre 2020 by Résistance 71


…ou détournable pour falsifier les données ?

“Les scientifiques sont en train de créer de sacrés dégâts au monde au nom de vouloir l’aider. Je n’ai aucun scrupule à attaquer ma propre confraternité parce que j’en ai honte.”
Kary Mullis (1944-2019), Inventeur de la Polymerase Chain Reaction (PCR), prix Nobel de chimie 1993 —

Cette affaire des tests PCR est une pierre angulaire de la dictature sanitaire mise en place par l’oligarchie. Pour maintenir les gens dans la peur constante et les faire acquiescer à tout, il faut des chiffres qui fassent peur, diffusés et répétés en boucle à fin anxiogène et le test RT-PCR est parfait pour gonfler les chiffres et créer de toute pièce de faux positifs simplement parce qu’il n’a JAMAIS ÉTÉ un test clinique thérapeutique, mais il a été conçu pour la recherche et n’est en fait qu’un procédé de production, de réplication qui ne permet en rien d’identifier avec certitude les traces d’ARN / ADN trouvées chez une personne ; il ne peut ni identifier ni fournir le quantitatif concernant la charge virale d’un sujet. La falsification des données depuis le départ est possible parce que le test utilisé… n’est PAS UN TEST et on peut lui faire dire ce qu’on veut.
Les chiffres avancés par les gouvernements sont falsifiés, surgonflés à dessein et ont pour objectif de maintenir la psychose en boucle et de maintenir l’alibi de la dictature sanitaire. Il est grand temps de faire toute la lumière sur cette supercherie, à commencer par l’utilisation de ce « test ». L’inventeur du test, Kary Mullis (prix Nobel de chimie en 1993, pour ceux toujours attachés aux breloques systémiques…) en déconseillait l’usage thérapeutique, il doit faire des sauts de carpe dans sa tombe le bougre, déjà qu’il s’était copieusement frotté et frictionné avec la mafia « scientifique » du VIH-SIDA, s’il savait que son invention servait à « dépister » des « positifs » à la maladie causée par le SARS-CoV-2, il rendrait sans doute son tablier.
Ce test est une aubaine pour les grands falsificateurs de Big Pharma et leurs exécutants politiques à la solde… Pour rendre un mensonge scientifique crédible, il faut des « chiffres » et en l’occurence, plus on trouve de « cas » et plus « l’urgence » (bidon) doit être maintenue. Le problème est créé, il suffit ensuite de proposer les solutions déjà prêtes (mesures sanitaires autoritaires, lois toujours plus liberticides, médicaments, vaccins chimériques et mortifères eugénisme oblige, contrôle terminal des populations et élimination de toute dissidence…)
Il est plus que grand temps de foutre toute cette cabale criminelle par dessus bord…
~ Résistance 71 ~

Test RT-PCR pour CoV19, deux textes vitaux pour comprendre la falsification des chiffres (PDF):
Dossier-special-CoV19-fraude-tests-RT-PCR

La vérité au sujet des kits de test PCR de son inventeur et d’autres experts

Octobre 2020

Source:
https://bestarticle.net/the-truth-about-pcr-test-kit-from-the-inventor-and-other-experts-6581.html

~ Traduit de l’anglais par Résistance 71 ~

Le scientifique qui a inventé le kit de test PCR (Polymerase Chain Reaction) fut Kary B. Mullis. Cette technologie est ce qu’ils utilisent aujourd’hui pour tester le soi-disant coronavirus, affirmé être la cause d’une maladie que les autorités sanitaires telles que l’OMS ont vaguement et de manière inconstante identifiée. Mullis fait partie des scientifiques courageux qui questionnent le narratif de l’hypothèse VIH-SIDA. Mullis ne croyait pas ce qu’affirmait la science de masse financée par l’élite globaliste, à savoir que c’était le rétro-virus VIH qui causait la maladie du SIDA. Il était un membre important du “Groupe pour la réévaluation de l’hypothèse VIH-SIDA, organisation de protestation de 500 membres poussant pour une réexamination de la cause du SIDA.” D’après lui, dans un entretien donné en 1992 à Spin, “Le PCR a rendu plus facile de voir que certaines personnes sont infectées par le VIH et que certaines d’entre elles développent les symptômes du SIDA. Mais cela ne commence même pas à répondre à la question : Est-ce que le VIH cause le SIDA ?

Qu’est-ce que le test PCR ?

Au début des années 1990, le test PCR est devenu populaire dans son utilisation et Karry Mullis reçut alors le prix Nobel pour ce test en 1993. Simplement dit, le PCR est une méthode cyclique thermique utilisée pour faire des milliards de copies d’un échantillon spécifique d’ADN, rendant l’échantillon suffisamment important pour pouvoir être étudié. Le PCR est une technique indispensable ayant une vaste variété d’applications incluant la recherche biomédicale et la médecine légale.

Kary B. Mullis (1944-2019)

D’après Mullis lui-même, le test PCR ne devrait pas être totalement, ne devrait jamais être utilisé comme “outil de diagnostique de maladies infectieuses”. C’est la raison essentielle pour laquelle Mullis ne fut pas d’accord avec les scientifiques qui se tenaient derrière l’hypothèse VIH-SIDA. Il défia la notion communément admise que “les mécanismes causant la maladie du VIH sont simplement ‘mystérieux” à comprendre. D’après lui, “Le mystère de ce satané virus a été généré par les 2 milliards de dollars que l’on dépense sur lui par an et vous pouvez aussi inventer des grands mystères à son sujet.” Il ajouta également “les êtres humains sont pleins de rétro-virus, nous ne savons pas s’ils se chiffrent par centaines, milliers ou centaines de milliers. Nous n’avons commencé à les observer que récemment. Mais ils n’ont jamais tué quelqu’un auparavant. Les gens ont toujours survécu aux rétro-virus”.

En regard de la crise courante du coronavirus, dont certains croient qu’elle est une tromperie organisée, elle n’est pas bien différente de la situation VIH-SIDA décriée par Kary Mullis. Mais la réaction des autorités de nos jours est bien plus sévère et autoritaire globalement tout en étant toute aussi éhontée alors qu’elles mettent en place des politiques et des protocoles qui violent de manière évidente les droits constitutionnels des citoyens tout en détruisant également l’économie, rendant la vie misérable et plus dure pour les gens de l’ordinaire, situation dénoncée par des policiers à travers les Etats-Unis, par exemple.

Pour en savoir plus sur le pourquoi cette crise est ridiculement fondée sur une “science” déficiente, écoutons ce que d’autres experts ont à dire au sujet de ces tests pour le coronavirus.

D’après Jason Hommel, chercheur et journaliste et auteur de l’article très important sur les tests coronavirus intitulé : “Scientists Say the COVID19 Test Kits Do Not Work, Are Worthless, and Give Impossible Results”:

“La PCR prend en fait un échantillon de vos cellules et amplifie toute ADN pour observer des ’séquences virales’, c’est à dire des morceaux d’ADN non humaine qui semble correspondre à des parties d’un génome connu. Le problème est que ce test est connu pour ne pas marcher. Il utilise des “amplifications” ce qui veut dire prendre une petite partie d’ADN et la cultiver exponentiellement jusqu’à ce qu’elle puisse être analysée. De manière évidente tout contamination minute dans l’échantillon sera aussi amplifiée ceci menant à de grosses erreurs potentielles de découverte. De plus, le test ne regarde que des séquences virales partielles et non pas des génomes complets, ainsi identifier un seul pathogène est quasiment impossible même si vous ignorez les autres facteurs. La simple idée que ces kits de test puissent isoler un virus spécifique comme celui de la COVID-19 est un non-sens total.

Dans le même temps, d’après Celia Farber, auteure de l’ouvrage “Serious Adverse Events: An Uncensored History of AIDS” et un autre chercheur dont le travail sur l’industrie pharmaceutique, le socialisme, la manipulation médiatique et plus spécifiquement, ce sujet du VIH-SIDA, lui a fait gagner un prix de journalisme d’enquête. Elle est aussi l’éditrice de The Truth Barrier, un site d’enquête et co-hôtesse de la “Whistleblower Newsroom” avec Kristina Borjesson sur PRN :

Un des mystères donnant le tournis de toute cette situation sur le Corona fut l’annonce de ces célébrités comme Tom Hanks, Sophie Trudeau et le Prince Charles annonçant avoir été testés “positifs” pour la COVID-19 et se maintenant en auto-quarantaine. Dans tous ces cas de figures célèbres, les symptômes étaient soit non-existant ou alors très légers. Pourquoi en a t’on fait tout un plat donc ? La famille royale britannique par exemple brise son vœu du secret dans ce cas précis. que cela voulait-il dire ? Cela signalait en fait que la COVID-19 n’est pas du tout mortelle, que le virus peut être présent sans présenter aucune forme de symptôme, que les facteurs impliquant l’hôte du virus sont importants. et qu’être “testé positif” pour la COVID-19 n’est ni une condamnation à mort de relation publique, ni une condamnation à mort de fait.

Peut-être que dans leur langage d’élite ésotérique, cela devient même une sorte de prestige ou un sacrement à une déité virale païenne, qui sait ?…Dans le cas des Trudeau, Sophie fut testée positive et eut des symptômes, tandis que son mari Justin, le premier ministre du Canada ne fut jamais malade et ne fut pas non plus testé. (il ne voulait pas paraître privilégié, tout le monde n’est pas testé au Canada, vous devez présenter des symptômes pour ce faire)

D’un autre côté, dans un article également de Celia Farber, David Crowe ‘un chercheur canadien diplômé de mathématique et de biologie et hôte du podcast “The Infectious Myth”, aussi président du think-tank “Rethinking AIDS”, a aussi clairement expliqué les problèmes liés aux tests coronavirus par PCR “révélant un monde d’une incroyable complexité mais aussi de tricherie.

Il continue:

La première chose à savoir est que le test n’est pas binaire. En fait je ne pense pas qu’il y ait un seul test pour les maladies infectieuses qui soit positif ou négatif. Ce qu’ils font est qu’ils prennent une certaine sorte de continuité et ils décident arbitrairement que ce point est la différence entre positif et négatif.”

La PCR est véritablement une technique de production. Vous commencez avec une molécule. Vous commencez avec très peu d’ADN et sur chaque cycle, la quantité double, ce qui n’a l’air de rien, mais si vous doublez 30 fois, vous vous retrouvez avec approximativement 1 milliard de fois plus de matériel que quand vous avez commencé. Donc comme technique de production, c’est super. Ils attachent une molécule fluorescente à l’ARN en cours de production. Vous allumez une lumière à une longueur d’ondes données et vous avez une réponse, vous avez une lumière qui vous est renvoyée à une longueur d’ondes différente. Ainsi, ils mesurent la quantité de lumière en retour et cela constitue leur remplaçant pour déterminer combien il y a d’ADN. J’utilise le mot ADN. Il y a une étape dans le RT-PCR (Real Time-Polymerase Chain Reaction ou réaction en chaîne polymérase en temps réel)) ou on convertit l’ARN en ADN. Donc, le test PCR n’utilise pas en réalité l’ARN viral, il utilise l’ADN, mais c’est comme l’ARN complémentaire. Donc logiquement, c’est la même chose, mais cela peut prêter à confusion. Comme par exemple, pourquoi suis-je en train soudainement de parler d’ADN ?… Fondamentalement, il y a un certain nombre de cycles.

En ce qui concerne l’intention de Kary Mullis concernant son test PCR, voici ce qu’il en a dit :

Je suis bien triste qu’il ne soit pas là pour défendre sa technique de fabrication (NdT: Mullis est décédé en août 2019…). Kary n’a pas inventé un TEST. Il a inventé une puissante technique de fabrication dont on abuse, qui est abusée. Quelles sont les meilleures applications pour la PCR ? Pas les diagnostiques médicaux. Il le savait et il l’a toujours dit.

Il ajouta ensuite :

Je ne pense pas qu’ils savent ce qu’ils font ; je pense que tout cela est hors de contrôle. Ils ne savent pas comment y mettre fin. Je pense que ceci s’est passé : Ils ont construit une machine à pandémie au cours des années et comme vous le savez, il y a des exercices de sécurité sur les pandémies, il y en a eu un peu avant que celle-ci ne commence.

En même temps, toujours dans l’entretien de Celia Farber, le Dr David Rasnick, biochimiste, développeur de la protéase et ancien fondateur d’un laboratoire appelé Viral Forensics, a déclaré :

Vous devez avoir une énorme quantité de quelque organisme que ce soit pour avoir des symptômes. Un très grand nombre. Vous ne commencez pas par tester, vous commencez par écouter, observer, ausculter les poumons en l’occurence. Je suis sceptique sur le fait que le test PCR soit même véritable dans ses résultats. C’est un super outil de recherche scientifique, mais un très mauvais outil pour les tests cliniques en médecine. 30% de vos cellules infectées ont été tuées avant même que vous ne ressentiez des symptômes… les cellules mortes génèrent les symptômes.

Farber lui a demandé quel serait son conseil pour les gens qui veulent se faire tester pour le COVID-19, il a répondu :

Ne le faites pas, c’est ce que je dis aux gens qui me le demandent. Aucune personne saine ne devrait être testée. Cela ne veut rien dire mais ça peut détruire votre vie, vous rendre absolument misérable. A chaque fois que quelqu’un se fait tester, écouvillonner, un échantillon d’ADN de leurs tissus est prélevé et va dans une base de données du gouvernement. C’est fait pour nous tracer. Ils ne font pas que regarder et tester pour le virus. Incluez cela dans votre article S.V.P

Il ajouta :

Utiliser la PCR pour diagnostiquer est un gros problème. Quand vous devez amplifier le résultat un énorme nombre de fois, cela va générer une énorme quantité de faux positifs. Une fois de plus, je le répète, je doute que le test PCR soit même jamais juste.

Pour en savoir davantage au sujet du test PCR, je vous suggère de lire l’article de Celia Farber en entier, vous le trouverez ici (en anglais)

Note de R71: Nous envisageons de le traduire dans son intégralité mais il est très long, un peu de patience, c’est pour cela que nous avons décidé de traduire le présent article plus court afin d’informer au plus court. L’article de Farber date d’avril 2020, nous n7en avons eu connaissance que très récemment.

https://uncoverdc.com/2020/04/07/was-the-covid-19-test-meant-to-detect-a-virus

References:

https://revealingfraud.com/2020/03/health/test-kits-do-not-work/

https://occamsrazorterrorevents.weebly.com/blog/coronavirus-hoax-jan-2020

Featured image: https://dranshublog.com/the-story-of-kary-mullis-and-the-invention-of-pcr/

= = =

Lire notre page “Coronavirus, guerre contre l’humanité”


écouvillon… piège à ?…