Archive pour test RT-PCR falsification des données COVID19

« Le véritable Anthony Fauci, Bill Gates, Big Pharma et la guerre globale contre la démocratie et la santé publique » Robert F. Kennedy Jr (chapitre 5)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, ingérence et etats-unis, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , on 13 janvier 2022 by Résistance 71

RFK_RealFauci

Le véritable Anthony Fauci, Bill Gates, Big Pharma et la guerre globale contre la démocratie et la santé publique

Larges extraits

Robert F. Kennedy Jr

Skyhorse Publishing, novembre 2021, 450 pages

~ Traduit de l’anglais par Résistance 71 ~

Janvier 2022

La présentation de ce projet de traduction (Résistance 71)

Introduction

Chapitre 1

Chapitre 2

Chapitre 3

Chapitre 4

Chapitre 6

Chapitre 7

Chapitre 8

Chapitre 9

Chapitre 10

Chapitre 11

Chapitre 12

Chapitre 5 Les hérésies du VIH

NdT : Ce chapitre explique les différentes théories prouvant la supercherie des dr Fauci et dr Robert Gallo, nous en traduirons quelques éléments marquants mais référons les lecteurs à la lecture complète du chapitre, qui est très instructive sur le sujet mais qui à notre sens n’ajoute rien à ce qui a déjà été préalablement dit sur cette affaire de SIDA et de la fourberie de Fauci et autres sbires du système médico-pharmaceutico-industriel. Une emphase est mise dans ce chapitre sur la critique de célèbre Dr Peter Duesberg.

“Un homme vivant en dehors du cercle des illusions qui emprisonne la plupart des humains, a une question pour quiconque il rencontre, question habituellement silencieuse : ‘Pouvez-vous sortir de vous-même ne serait-ce que pour un fragment de seconde afin d’entendre quelque chose que vous n’avez jamais entendu auparavant ?’ Ceux qui apprennent à écouter entreront dans un monde nouveau.”
~ Khalil Gibran ~

J’ai longuement hésité à inclure ce chapitre dans ce livre parce que tout questionnement de l’orthodoxie disant que le virus VIH est la seule cause du SIDA demeure une hérésie impardonnable, voire même dangereuse, parmi le cartel médical régnant et ses larbins des médias. Mais on ne peut pas écrire un bouquin sur Anthony Fauci sans toucher à la controverse scientifique acceptée et fascinante sur ce qu’il considère comme “le plus grand accomplissement” de “sa vie de travail”.

Pour commencer, je veux clarifier une chose : je ne prend aucune position sur la relation entre le VIH et le SIDA. J’inclus cette histoire parce qu’elle fournit un excellent cas d’étude illustrant comment, quelques quatre cents ans après Galilée, la politique et le pouvoir continuent de dicter le soi-disant “consensus scientifique” plutôt que l’empirisme, la pensée critique ou les étapes bien établies de la méthode scientifique. C’est un danger à la fois pour la démocratie et la santé publique lorsqu’une sorte de foi religieuse dans des déclarations d’autorité, supplante l’observation disciplinée, les preuves rigoureuses et les résultats d’expériences qu’on puisse dupliquer comme la source de la “vérité” dans le domaine médical.

Alors que le consensus peut être un admirable objectif politique, il est l’ennemi de la science et de la vérité. Le terme de “science définitive” est un oxymore. L’admonestation que nous est faite de “devoir faire confiance aux experts” est un tropisme autoritaire. La science est en rupture constante, elle est irrévérencieuse, dynamique, rebelle, et démocratique. Le consensus et l’appel à l’autorité que ce soit le CDC, l’OMS, Bill Gates, Anthony Fauci ou le Vatican sont des caractéristiques religieuses et non pas scientifiques. La science est tumulte. La vérité empirique vient souvent de sols retournés et agités du débat. Le doute, le scepticisme, le questionnement et le désaccord en sont les engrais. Chaque grande avancée scientifique dans l’histoire, chaque idée transformatrice, de l’évolution à la relativité en passant par l’hélio-centrisme, a rencontré un ridicule initial de la part de la clique du “consensus scientifique” du moment. Comme le dit si bien le romancier et médecin Michael Crichton :

Le consensus fait partie du domaine de la politique. La science, au contraire, ne demande qu’un seul chercheur ait raison, ce qui veut qu’il ou elle possède des résultats vérifiables en référence au monde réel. En science, le consensus ne veut absolument rien dire. Les plus grands scientifiques de l’histoire sont justement “grands” parce qu’ils ont échappé et ont refusé tous les “consensus” de leur temps. Le consensus n’existe pas en science. De fait, si c’est un consensus, alors ce n’est pas de la science. Si c’est de la science, alors il n’y a pas de consensus. Point barre.

[…]

Durant les 36 années depuis que les dr Fauci et Gallo ont initialement affirmé que le virus du VIH était la seule cause du SIDA, personne n’a pu faire référence à une étude qui démontre leur hypothèse en utilisant des preuves scientifiques acceptées. Le fait que le dr Fauci a obstinément refusé de décrire une base scientifique convaincante pour étayer sa proposition, ou de simplement débattre sur le sujet avec quiconque de critique et de qualifié sur le sujet, incluant quelques prix Nobel qui exprimèrent leur scepticisme, ne fait que rendre encore plus important le fait de donner de l’air frais et de la lumière à ces voix du désaccord.

[…]

Le 28 février 1994, dans un numéro du New York Native, Neenyah Ostrom écrivit un éditorial intitulé : “La canonisation d’Anthony Fauci” dans lequel il disait : “Anthony Fauci, l’homme qui a tant brouillé et mal dirigé la recherche américaine sur le SIDA, que 13 années dans cette épidémie, il n’y a toujours aucune idée claire sur sa patho-génèse et toujours pas de traitement efficace, a été récemment plébiscité jusqu’à une quasi-sainteté, une fois de plus par le New York Times.

Au lieu de répondre aux critiques en répondant à des questions de sens-commun. Le dr Fauci a cultivé toute une théologie qui dénonce le questionnement sur son orthodoxie comme étant irresponsable, mal informée et comme dangereuse hérésie. Il est axiomatique que la démocratie américaine fleurit sur le libre flot de l’information et abhorre la censure. Ainsi donc, la capacité extraordinaire du dr Fauci de réduire au silence, de censurer, de ridiculiser, de débudgétiser et de ruiner sans vergogne tout désaccord important, semble bien plus compatible avec l’inquisition espagnole ou le sytème soviétique et autre système totalitaire. Aujourd’hui, “Le premier amendement [NdT: libre pensée, libre parole] ne s’applique pas au dr Fauci” dit Charles Ortleb. “Tout scientifique qui dispute sa cosmologie officielle ou tout canon promouvant l’orthodoxie voulant que le VIH soit la seule et unique cause du SIDA, est un homme mort en termes de récompenses et soutien de la science.

[…]

Donc, sans tenter de tirer des conclusions sur les disputes sous-jacentes sur la théorie VIH/SIDA, il vaut cependant la peine de faire un inventaire des armes utilisées par le dr Fauci durant sa lutte initiale pour construire et fortifier une “théologie scientifique”.

Le défi le plus puissant, le plus influent et le plus persistant à la thèse VIH/SIDA, provient du Dr Peter Duesberg, qui en 1987, avait la réputation d’être le rétro-virologiste le plus qualifié et reconnu au monde. De manière spécifique, le Dr Duesberg accuse le dr Fauci de commettre un assassinat de masse avec l’AZT, cette décoction chimique mortelle qui d’après Duesberg, cause, et ne guérit jamais, les constellations de suppression immunitaire que nous appelons maintenant “SIDA”. Mais la critique de Duesberg va plus profondément que sa révulsion de l’AZT. Duesberg argumente que le VIH ne cause pas le SIDA mais n’est qu’un “passager libre” ce qui est commun dans des populations à haut-risque qui souffre de suppression immunitaire à cause d’une exposition à l’environnement. Alors que le VIH peut bien être sexuellement transmissible, Duesberg argumente que le SIDA ne l’est pas. Duesberg dit que le VIH est visible chez des millions de personnes saines qui ne développent aucun symptôme du SIDA. Il y a aussi des milliers de malades du SIDA qui ne démontrent aucune infection au VIH. Le dr Fauci n’a jamais été capable d’expliquer ces phénomènes, qui sont inconsistants avec la pathogénèse de n’importe quelle autre maladie infectieuse.

[…]

Avant d’avancer sa propre théorie sur l’étiologie du SIDA, Duesberg a énoncé méthodologiquement les erreurs de logique dans l’hypothèse du dr Fauci sur le VIH/SIDA dans un article fondamental datant de 1987 dans la revue Cancer Research. Celui-ci n’a jamais répondu aux questions de bons sens du Dr Duesberg.

Dans le livre qui s’ensuivit “Inventer le virus du SIDA”, Duesberg, tout au long de 724 pages passionnantes, étend sa dissection des erreurs dans l’hypothèse et énonce sa propre explication sur l’étiologie du SIDA.

[NdT : s’ensuit ici toute une historique de l’affaire, passionnante mais fastidieuse, à lire dans le livre de RFK Jr…]

Le prix Nobel de biochimie, le Dr Kary Mullis, nota : “Le VIH n’est pas d’un seul coup sorti de la forêt tropicale d’Haïti ; il a juste atterri dans les mains de Robert Gallo alors que celui-ci se cherchait une nouvelle carrière.” Duesberg déclara plus tard : “Il a volé les faux diamants de Luc Montagnier.

[…]

De fait, l’annonce de Gallo fut une véritable aubaine pour Anthony Fauci. Épingler l’épidémie de SIDA sur un virus lui permettait de détourner une rivière cascadant de l’argent de la recherche sur le SIDA du NCI vers les coffres débordant du NIAID.

Le dr Fauci ouvrit alors les vannes du fric du NIAID pour développer un nouvel antiviral contre le VIH. Il ouvrit les portes du chenil de ses chiens de garde PI afin qu’ils concoctent et testent de nouveaux médicaments qui tueraient le virus. De manière tout à fait remarquable, le dr Fauci n’a jamais financé une seule étude explorant le fait de savoir si le VIH causait effectivement le SIDA.

[…]

Le Dr Kary Mullis connaissait les effets du financement du NIH qui scellait le dogme officiel. “Tous les vieux chasseurs de virus du NCI apposèrent de nouveaux panneaux sur leur porte et devinrent des chercheurs sur le SIDA. Le président Reagan envoya un milliard de dollars pour commencer,” nota Mullis qui avait eu le prix Nobel de chimie en 1993 pour son invention de la “réaction en chaîne polymérase” ou technique PCR. “Et soudainement, tous ceux qui pouvaient affirmer être une sorte de scientifique médical et qui n’avaient plus grand chose à faire ces derniers temps, se retrouvèrent embauchés à temps plein.”

[…]

Le bataillon de scientifiques du dr Fauci mirent en place un très large programme de test VIH utilisant de manière généralisée des tests PCR capables d’amplifier des milliards de fois d’infinitésimales quantité de bande ARN/ADN dans des débris morts depuis longtemps. Le test PCR ne pouvait pas identifier l’infection active au VIH. Mullis, qui inventa le test [NdT : ou plutôt la technique de reproduction par amplification de petits échantillons ARN/ADN] fit remarquer que le PCR était capable de trouver des signaux de VIH dans de larges segments de la population qui ne souffrait d’aucune menace du VIH et qui n’avait aucun virus VIH vivant dans leurs corps. Les chercheurs trouvèrent naturellement  des détritus d’ADN viral du VIH chez des personnes ayant une constellation d’autres maladies. Toutes ces maladies sans aucun rapport se retrouvèrent bientôt incorporées sous l’ombrelle bien utile des définitions du SIDA.

[…]

Le test VIH n’a jamais été validé” a dit Kary Mullis. “Il ne montre pas une infection ; il montre des particules virales qui peuvent exister chez des millions de personnes.” A la fin des années 80, l’acerbe et sardonique Mullis devint le plus virulent des critiques de Gallo et Fauci, en fait, il les tourna en ridicule. Mullis ajouta : “Avec la méthode PCR voyez-vous,  ce n’est pas un virus qui peut être détecté mais des traces infimes de gènes ARN/ADN, quant à savoir si elles proviennent d’un certain virus ou d’une autre contamination demeure absolument obscur.

[NdT: s’ensuit ici une explication très intéressante mais très technique sur le rapport VIH/SIDA et le problème du SIDA sans le VIH… passionnant, à lire dans le bouquin néanmoins.]

Peter Duesberg m’a dit ceci : “Si le VIH causait des infections, vous n’auriez pas besoin d’un PCR, d’une machine qui multiplie des segments génétiques du VIH un milliard de fois pour voir ’si une personnes est ‘infectée’.’ L’infection serait aussi évidente qu’une infection de la grippe ou de la polio. Le corps du malade serait littéralement envahi de microbes.

[…]

Mon but ici n’est pas de prendre parti, encore moins de résoudre la dispute qui a jusqu’ici défié toute résolution depuis des décennies ; mais plutôt de partager quelque chose que peu de personnes ont été permises de savoir : à savoir qu’il y a dispute, contentieux et que Tony Fauci n’a aucunement permis toute étude qui pourrait résoudre cette affaire. Mon espoir demeure en faisant la chronique du rôle de Tony Fauci en tant que grand-prêtre d’une orthodoxie qui soutient aujourd’hui une entreprise commerciale mondiale représentant des milliards de dollars de revenus. Au fil des années, le dr Fauci a paré, échappé au débat scientifique et transformé des théories en un dogme quasi-religieux tout en punissant, réduisant au silence tout désaccord de la même manière que l’inquisition punissait l’hérésie. Le médecin chef de l’Amérique n’a jamais donné au contribuable américain, ou aux malades du SIDA, dont 53% aux Etats-Unis sont des personnes de couleur, la moindre preuve que l’AZT ou les antiviraux qui lui ont succédé fournissent un impact favorable sur la mortalité. Il semble opportun et juste, sinon dangereux, de demander cette preuve.

tic-tac-tic-tac

« Le véritable Anthony Fauci, Bill Gates Big Pharma et la guerre globale contre la démocratie et la santé publique » Robert F Kennedy Jr (Chapitre 1 / 1ère partie)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, ingérence et etats-unis, média et propagande, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 18 décembre 2021 by Résistance 71

RFK_RealFauci

Le véritable Anthony Fauci, Bill Gates, Big Pharma et la guerre globale contre la démocratie et la santé publique

Larges extraits

Robert F. Kennedy Jr

Skyhorse Publishing, novembre 2021, 450 pages

~ Traduit de l’anglais par Résistance 71 ~

Décembre 2021

La présentation de ce projet de traduction (Résistance 71)

Introduction

Chapitre 2

Chapitre 1 : mauvaise gestion de pandémie

Note des traducteurs : ce chapitre est le plus long du livre, il fait 95 pages + 22 pages de notes bibliographiques. Ce chapitre très important représente à lui seul 25% du bouquin… Tout est à lire, aucune longueur, il fut très très difficile de sélectionner des passages pour la traduction, nous avons fait de notre mieux pour en tirer ce que nous pensons être le plus important à diffuser le plus rapidement possible. De fait, par souci de cohérence narrative et devant la somme des informations présentées, nous avons décidé de traduire plus qu’originellement prévu. Devant la longueur de ce chapitre et pour ne pas faire trop attendre le public francophone qui se doit de connaître cette information, nous avons décidé de publier ce long chapitre en 3 parties… Bonne lecture !

[1] [2] [3]

I – Décrets arbitraires : médecine sans science

La stratégie de gestion de la pandémie COVID du Dr Fauci a été de supprimer la transmission virale par le port du masque obligatoire, la distanciation sociale, la mise en quarantaine de gens sains (mesure connue sous le nom de “confinement”), tout en instruisant les patients atteints de la maladie de retourner chez eux sans rien faire (NdT: à par le p’tit coup de doliprane usuel…), de ne recevoir aucun traitement, jusqu’à ce que des difficulté respiratoires ne les renvoient à l’hôpital pour y recevoir du remdevisir en intra-veineuse (I.V) et être placés sous respirateur. Cette approche pour mettre fin à une maladie infectieuse contagieuse n’a aucun précédent médical en santé publique et un soutien scientifique des plus anémiques. De manière tout à fait prévisible, ce fut totalement inefficace : les Etats-Unis eurent le plus haut taux de mortalité au monde.

Des médicaments étaient disponibles contre la COVID, des médicaments sûrs et très bon marché, qui auraient empêchés des centaines de milliers d’hospitalisations et auraient sauvé autant de vies si seulement nous les avions utilisés dans ce pays. Mais le Dr Fauci et ses collaborateurs de Big Pharma supprimèrent délibérément ces traitements pour rendre service à leur objectif à sens unique : que l’Amérique attende d’être sauvée par leurs nouveaux vaccins coûtant des milliards de dollars.

[…]

Le dr Fauci savait pertinemment que ses décrets sur le port du masque étaient contraire à l’essentiel de ce qu’en disait la science.

[…] Consistant avec les premières déclarations de Fauci, la littérature scientifique peer reviewed a toujours refusé de soutenir le port du masque pour les gens en bonne santé comme étant une manière efficace de limiter la transmission virale. Une étude compréhensive de décembre 2020 menée à Wuhan en Chine sur une échantillon de 10 millions de personnes, a confirmé l’assertion originelle de Fauci que la transmission asymptomatique du COVID était extrêmement rare.

[…]

Les obligations de distanciation sociale sont aussi fondées sur une base scientifique des plus douteuses. En septembre 2021, l’ex-commissaire à la FDA, le Dr Scott Gotleib a admis que la règle des 2m de distanciation imposée par le Dr Fauci et ses collègues du Human Health Service (HHS) était “arbitraire” et non pas fondée sur une base scientifique étayée.. “Ceci est un exemple parfait du manque de rigueur sur la façon dont le CDC fait ses recommandations.” a poursuivi l’intéressé.

[…] Finalement, le confinement des gens sains fut une mesure si “innovatrice” que les protocoles officiels de gestion de pandémie de l’OMS ne le recommandait pas du tout. Certains officiels de l’OMS étaient passionnés par le sujet…

[…] Il n’y a aucune différence convaincante en ce qui concerne les infections par la COVID et la mortalité résultante entre les juridictions qui prônèrent le laisser-faire et celles qui obligèrent coercitivement des confinements stricts de gens sains et et le port du masque.

[…]

Le Dr Fauci expliqua au journal du New York Times, qu’il avait révisé à la hausse ses estimations de couverture vaccinale nécessaire pour obtenir “l’immunité de troupeau” de 70% en mars à 80-90% en septembre, non pas sur une base scientifique, mais plutôt en réponse à un sondage qui indiquait une augmentation de l’acceptation de la vaccination dans le public. Il adopta une position publique pour dire que l’immunité naturelle ne contribue pas à protéger une population. Il a soutenu l’injection des gens ayant déjà été infectés par la maladie, en défi de massive preuve scientifique démontrant que des inoculations post-COVID étaient non seulement inutiles mais même dangereuses.. Questionné sur le sujet le 9 septembre 2021, le Dr Fauci a admis qu’il ne pouvait trouver aucune justification scientifique de sa position et de sa politique.

[…]

A l’origine de la pandémie, le dr Fauci a utilisé un modèle informatique de prédiction particulièrement imprécis qui a surestimé les morts aux Etats-Unis de 525%. L’escroc et fabricant de pandémie, Neal Ferguson, de l’Imperial College of London en était l’auteur, avec un financement de la fondation Bill & Melinda Gates (FBMG) de 48,8 millions de dollars. Le dr Fauci a utilisé ce modèle comme justification de sa politique des confinements.

[NdT : la “science des modèles informatiques” a essentiellement remplacé la science des faits et de l’observation depuis plusieurs décennies. Ceci est tout aussi vrai dans d’autres domaines comme par exemple celui de l’escroquerie au changement climatique anthropique, ce que malheureusement RFK Jr n’a pas encore intégré… On fait dire ce qu’on veut à des “modèles” en bidouillant les données qu’on leur sert pour leur calcul, le bidouillage a souvent lieu par omission de données importantes, ce qui maxime les résultats voulus]

Le Dr Fauci a acquiescé aux changements de protocole de sélection du CDC lors de l’établissement des certificats de décès, de façon à surgonfler le nombre des morts dû à la COVID et donc de surgonfler le taux de mortalité de la maladie. Le CDC a plus tard admis que seulement 6% des décès COVID se produisirent chez des sujets au demeurant sains. Le reste des 94% souffraient en moyenne de 3,8 facteurs de co-mortalité potentielle.

Les régulateurs utilisèrent mal les tests PCR ce que le CDC sur le tard a admis, en août 2021, et être de fait incapables de distinguer la COVID d’une autre maladie virale. Le Dr Fauci a toléré leur utilisation à des niveaux d’amplification de manière inappropriée très hauts de 37 à 40 cycles de reproduction (Ct), parfois même jusqu’à 45 cycles, alors même que le Dr Fauci avait dit à Vince Racaniello que les tests employant un seuil de cycle (Ct) au dessus de 35 avaient très peu de chance de signifier la présence de virus vivant qui pourrait être répliqué. En juillet 2020, le Dr Fauci fit remarquer qu’à ce niveau de réplications, un résultat positif “n’est que nucléotides morts, point barre.” Pourtant, il ne fit rien pour modifier les tests de manière à être plus précis. En tant que tsar pour les Etats-Unis du COVID, le Dr Fauci ne s’est jamais plaint au sujet de la décision du CDC ne pas pas faire d’autopsies après les cas de décès attribués aux vaccins. Cette pratique a permis au CDC d’affirmer continuellement, que toutes les morts après les injections “n’ont aucun lien avec la vaccination”. Le CDC a aussi refusé d’ouvrir des enquêtes et de suivre les gens déposant une notice pour “blessures suite à vaccination”. Inspiré par de belles récompenses pour classer tout décès hospitalier comme “mort du COVID19”, Medicare a payé 39 000 dollars par patient placé en réanimation en cours de traitement COVID19 et seulement 13 000 US$ [3 fois moins] pour tout patient placé en réanimation pour déficience respiratoire simple. Ainsi les hôpitaux contribuèrent à la manipulation et mensonges sur les chiffres. Une fois de plus le Dr Fauci fit un clin d’œil et acquiesça à cette fraude.

[…]

Les auditeurs de CNN et lecteurs du New York Times furent désinformés de manière catastrophique au sujet des faits réels entourant la COVID19 durant toute l’année 2020. Des sondages successifs réalisés par Gallup ont montré que le démocrate moyen croyait que 50% des infections COVID19 résultaient en hospitalisation. Le véritable chiffre étant moins de 1%…

[…]

Les groupies du dr Fauci, incluant le président Biden, ainsi que les journalistes phares des grands médias télévisés, conseillèrent aux Américains de “faire confiance aux experts”. Un tel conseil est anti-démocratique et anti-science. La science est dynamique. Les “experts” souvent diffèrent de point de vue sur des questions scientifiques et leurs opinions peuvent varier en accord avec des demandes politiques, ou des intérêts de pouvoir ou financiers. Dans quasiment toutes les procédures judiciaires dans lesquelles j’ai officié en tant qu’avocat, celles-ci mettaient en lice les uns contre les autres, des “experts” des côtés opposés de l’argument, tous témoignant sous serment de positions diamétralement opposées, le tout basé sur la même série de faits. Dire aux gens de “croire les experts” est soit naïf ou complètement manipulateur, ou les deux.

[…]

Je fus choqué durant les premiers mois de la COVID19, que LE docteur de l’Amérique, apparemment préoccupé par sa seule solution, le vaccin, fit bien peu pour dire aux Américains comment renforcer leur système immunitaire.

[…]

Le 30 avril 2021, le Canadian Ontario College of Physicians and Surgeons (École de médecine de l’Ontario) a menacé de radier tout médecin qui prescrirait des stratégies de santé anti-COVID non vaccinale, incluant la prescription de vitamine D. “Ils sont en train d’essayer d’effacer la notion d’immunité naturelle”, a dit la chercheuse canadienne en immunologie vaccinale, la dr Jessica Rose. Ph.D, MSc, BSc.

[…]

En 2020, avant l’arrivée des vaccins, 99,99% des systèmes immunitaires naturels des gens protégeaient leurs propriétaires de maladies graves et de la mort. Le CDC, l’OMS, et en fait toutes les autorités de santé mondiales ont reconnu que des gens sains ayant un système immunitaire sain, sont à risque très minimum du COVID. En fait, la plupart des gens possèdent un système immunitaire suffisant pour ne même pas savoir qu’ils ont la COVID.

[…]

Le plus troublant furent les politiques du Dr Fauci de totalement ignorer et de supprimer les traitements précoces de la maladie chez les patients symptomatiques qui étaient souvent terrifiés. “Les meilleures pratiques pour vaincre une épidémie de maladie infectieuse dictent la mise en quarantaine et le traitement thérapeutique des gens malades, de protéger les gens les plus vulnérables et  de développer une pratique agressive de réaffectation des médicaments et d’utiliser des protocoles de traitements précoces afin d’éviter les hospitalisations.” dit l’épidémiologiste de Yale Harvey Risch, qui est une des autorités mondiales sur les protocoles de traitement clinique des maladies infectieuses.

[…] Le Dr Peter McCullough va en se sens : “Seul un virus hautement transmissible comme celui de la COVID, peut établir une tête de pont dans une population et ce sera inévitable qu’il se propagera à toute personne n’ayant pas ou peu d’immunité. Vous pouvez ralentir la contagion, mais pas l’empêcher, tout comme vous ne pouvez pas empêcher la marée de monter.” Dr McCullough est interne cardiologue du Baylor University Medical Center et du Baylor Heart and Vascular Hospital de Dallas au Texas. Il a publie plus de 600 articles peer-reviewed, faisant de Peter McCullough le médecin le plus publié de l’histoire de la médecine dans le domaine des pathologies rénales dues aux pathologies cardiaques., des séquelles mortelles en l’occurrence de la COVID19.

[…]

McCullough observe que “Nous aurions pu considérablement réduire les morts du COVID et les hospitalisations en utilisant les protocoles de traitement précoce et en réassignant thérapeutiquement des médicaments comme l’ivermectine et l’hydroxychloroquine et bien d’autres.” Le Dr McCullough a traité personnellement plus de 2000 patients atteints de la COVID avec ces thérapies. Il a indiqué que des centaines d’études peer-reviewed montrent maintenant que le traitement précoce de la maladie aurait pu empêcher quelques 80% des morts attribués à la COVID. “La stratégie dès le départ aurait du être de mettre en place des protocole de traitement pour empêcher les hospitalisations des Américains qui auraient été testés positifs, mais étaient toujours asymtomatiques. Si nous avions fait cela, nous aurions repoussé le taux de mortalité plus bas que celui que nous observons avec la grippe saisonnière et aurions stoppé les engorgements des hôpitaux. […] L’utilisation de médicaments réassignés aurait mis fin à cette pandémie vers mai 2020 et aurait sauvé quelques 500 000 vies américaines, mais cela s’est heurté à la vision dogmatique de Dr Fauci sur les vaccins et le remdevisir.

[…]

Risch, McCullough et Kory font partie d’un large chœur d’experts (incluant le prix Nobel de médecine Luc Montagnier) qui argumente qu’en ayant traité les patients infectés à la maison durant les premières étapes de la maladie, nous aurions pu éviter ces confinements cataclysmiques et trouver des ressources médicales pour protéger les populations vulnérables tout en encourageant la contagion dans les groupes d’âge à très bas risque afin d’obtenir une immunité de groupe naturelle permanente. Ils font aussi remarquer que l’immunité naturelle dans tous les cas de figures connus, est bien supérieure à une immunité induite par la vaccination, l’immunité naturelle étant de longue durée (souvent le long de toute une vie) et bien plus large, c’est à dire qu’elle offre aussi une protection substantielle contre les variants possibles d’un virus. “Vacciner les citoyens ayant déjà une immunité naturelle n’aurait jamais du être notre politique de santé publique.” dit le Dr Kory.

La stratégie du Dr Fauci a impliqué des centaines de milliards de dollars des ressources sociétales sur un pari à risque du développent d’une nouvelle technologie de vaccins et pratiquement rien vers le développement de la réassignation de médicaments existants et efficaces contre la COVID. “Cette stratégie a mis en attente le traitement médical mondialement pendant un an complet alors qu’un virus respiratoire au traitement connu ravageait des populations”, dit Kory. “Il est choquant qu’il n’a pas recommandé d’assistance et de traitement médicaux aux patients à domicile, pas même de la vitamine D, malgré le fait qu’il en prend lui-même et que la vaste majorité du pays est en carence de vitamine D.

[…]

Les médecins de terrain qui furent en première ligne ont très rapidement reconnu que la maladie se propageait selon plusieurs voies, chacun demandant un traitement et un protocole appropriés. McCullough nous dit : “Il y avait trois parties dans la maladie : 1) le virus se multipliait pour une durée aussi longue que deux semaines (incubation), 2) Il y avait une incroyable inflammation dans tout le corps, et 3) ceci était suivi de formations de caillots sanguins.” Il ajoute : “Dès avril 2020, la plupart des médecins avaient compris qu’un seul médicament ne serait pas suffisant pour traiter cette maladie. Nous devions donc utiliser des médicaments en les combinant.”

“Nous avons très rapidement développé trois principes de base, les voici :

  • Utiliser des médicaments pour ralentir le virus
  • Utiliser des médicaments pour atténuer ou réduire l’inflammation
  • S’occuper impérativement de la formation des caillots sanguins

[…] McCullough fait la chronique de la rapidité avec laquelle les médecins de terrain découvrirent une riche pharmacopée de remèdes efficaces contre la COVID. Des études anciennes de l’HHS soutenaient l’efficacité de l’hydroxychloroquine contre les coronavirus depuis 2005 et dès mars 2020, des médecins de New York à l’Asie l’utilisèrent avec une grande efficacité. Ce mois-là, McCullough et d’autres médecins organisèrent dans son centre de traitement et avec la FDA, des protocoles prophylactiques (préventifs) contre la COVID en utilisant l’hydroxychloroquine.

Nous avions aussi de super données concernant l’ivermectine en provenance du Bengladesh et d’ailleurs, ce dès le début de l’été 2020. dès lors nous avions deux médicaments génériques bon marché.” McCullough et son équipe de quelques 50 médecins de terrain découvrirent également que tandis que l’HCQ et l’IVM fonctionnaient très bien contre la COVID, ajouter d’autres médicaments aux protocoles renforçaient la rapidité et l’efficacité des résultats. Ces médicaments incluaient l’azithromycine ou la doxycycline, le zinc, la vitamine D, Celebrex, bromhexine, NAC, la vitamine C en I.V et la quercetine.

[…] McCullough continue : “Nous avons encore plus appris d’experts à UCLA et ailleurs en regard des caillots sanguins et du besoin d’agents liquéfiant du sang comme l’aspirine par exemple. Nous avons aussi eu le feu vert pour les anticorps monoclonaux. On a appris plus tard qu’à la fois la fluvoxamine et la famotidine pouvaient jouer un rôle dans un traitement multi-médicamenteux.

[…]

Les Chinois ont publié leur propre protocole de traitement le 3 mars 2020, utilisant les mêmes catégories de prophylactiques (préventifs) et médicaments de traitement précoce annoncés par McCullough : choloroquine (cousine de l’hydroxychloroquine, antibiotiques, anti-inflammatoires, anti-histaminiques, une variété de stéroïdes et substances probiotiques pour stabiliser et fortifier le système immunitaire, ainsi que des médicaments de la pharmacopée de la médecine traditionnelle chinoise, des vitamines et suppléments minéraux, incluant une variété de composants contenant de la quercitine, du zinc et des précurseurs gluthation. Les Chinois ont fait du traitement précoce leur stratégie centrale anti-COVID. Ils ont utilisé une surveillance et un traçage d’identification des patients et de leurs contacts, certes parfois intrusifs et ont immédiatement hospitalisé et traité tous les cas d’infection COVID. Le traitement précoce a aidé les Chinois à mettre fin à leur pandémie dès avril 2020 (NdT: premier cas fin novembre 2019, épidémie enrayée moins de 5 mois plus tard…). “Nous aurions pu faire la même chose” dit le Dr McCullough.

[…]

[A l’automne 2020] plus de 200 études scientifiques soutenaient le traitement par hydroxychloroquine et 60 études soutenaient l’ivermectine. “Nous avons combiné ces médicaments avec la doxycycline et l’azithomycine pour supprimer l’infection”, dit McCullough. Une autre méta-analyse soutenanait l’utilisation de prednisone et d’hydrocortisone et autres largement disponibles stéroïdes pour combattre l’inflammation.

[…]

Le Dr David Brownstein m’a dit : “J’ai eu une réunion avec mon personnel soignant et mes six associés. Je leur ai dit : ‘nous allons resté ouvert et allons traiter la COVID.” Ils m’ont demandé comment. Je leur ai dit “Nous avons traité ici des maladies virales depuis plus de 25 ans, la COVID ne peut pas être si différente. Dans toute cette période nous n’avons pas perdu un seul patient à la grippe ou autre maladies similaires. Nous avons traité les gens dans leurs voitures avec des vitamines A, C et D par voies orales et iodine. Nous avons fait de l’intraveineux en extérieur tout l’hiver avec des IV de peroxyde d’hydrogène et de la vitamine C…

[…] Nous avons traité 715 patients, nous n’avons eu que 10 hospitalisations, aucun mort. Le traitement précoce fut la clef de toute l’affaire. On nous a empêché d’en parler. Tout l’establishment médical essayait d’étouffer le traitement précoce de la maladie et de réduire au silence tous les médecins qui en parlait avec succès. Toute une génération de médecins a juste cessé de pratiquer la médecine.

[…]

Personne ne voulait que les Américains sachent que vous n’aviez pas à mourir de la COVID. Cette maladie est traitable à 100%”, dit le Dr Brownstein. “Nous l’avons prouvé, personne ne devait mourir.” Il ajoute : “Dans le même temps, nous avons vu beaucoup de très mauvais effets secondaires dus aux vaccins qui affectaient nos patients. Nous avons sept AVC, certains se terminant en paralysie sévère. Nous avons trois cas d’embolie pulmonaire, deux thromboses, deux cas de maladie de Graves et un mort.”

[…]

Nous n’avons pas eu une seule institution universitaire ou médicale qui soit parvenue à établir un simple protocole de traitement.” a dit le Dr McCullough. “Ils n’ont même pas essayé. Harvard, John Hopkins, Duke, quelle qu’elles soient. Pas un seul centre médical n’a même mis une tente pour traiter les patients et empêcher les hospitalisations et la mort des gens. Il n’y a pas eu un gramme de recherche originale qui est sortie de l’Amérique pour combattre et traiter la COVID, rien d’autre que les vaccins.” Toutes ces universités dépendent grandement des milliards de dollars qu’elles reçoivent du NIH. Comme nous allons le voir, toutes ces institutions vivent dans la terreur absolue d’insulter Anthony Fauci et cette peur les a paralysé dans cette pandémie.

[…]

Au lieu de soutenir le travail de McCullough, le NIH et autres régulateurs fédéraux ont commencé à activement censurer l’information en ce domaine des remèdes efficaces. Les médecins qui tentèrent d’ouvrir la discussion sur les bénéfices du traitement précoce de la maladie se virent lourdement et inexpliquablement censurés. Le dr Fauci a travaillé avec Mark Zuckerberg de Facebook et autres médias sociaux pour museler toute discussion sur les remèdes à la maladie. La FDA envoya une lettre de mise en garde disant que la N-acetyl-L-cystéïne (NAC) ne pouvait pas être promue légalement comme supplément alimentaire après des décennies d’accès de la substance dans les rayons des magasins de santé et nutrition et supprima la vitamine C en I.V, que les Chinois utilisèrent avec un très grand succès.

[…]

Des médecins et scientifiques reconnus, incluant quelques uns les plus publiés et plus expérimentés de la nation et des spécialistes de terrain anti-COVID comme les Dr McCullough, Kory, Ryan Cole, David Brownstein et Risch pensent que la suppression par le Dr Fauci du traitement précoce et des remèdes hors patentes, fut responsable de près de 80% des décès attribués à la COVID. Ces cinq médecins m’ont dit la même chose de manière indépendante. La charlatanerie incessante de délibérément empêcher les traitements précoces efficaces de la COVID, la coercition pour l’utilisation du remdesivir, ont sans doute tué inutilement quelques 500 000 Américains dans les hôpitaux.

[…]

Le Dr Cole a supervisé ou aidé à faire plus de 125 000 tests COVID pendant la pandémie. […] “Pour le dire simple et direct : le traitement précoce de la COVID sauve des vies. Si la profession médicale avait eu une pensée progressiste et pratique de l’affaire et se soit focalisée sur la maladie, avec une approche multi-médicamenteuse des patients en ambulatoire, sachant que la COVID-19 est une maladie imflammatoire coagulante, des centaines de milliers de vies auraient été sauvées aux Etats-Unis.

Jamais dans l’histoire de la médecine, le traitement précoce d’une maladie n’a été aussi négligé de manière ouverte par la profession médicale et sur une si grande échelle.” Le dr Cole ajoute : “Ne pas traiter, spécifiquement dans une épidémie de maladie contagieuse potentiellement mortelle, c’est nuire.

[…]

Cole fait remarquer que “Si vous avez moins de 70 ans et que vous n’avez pas d’autres maladies sévères, il est très difficile pour vous de mourir de la COVID. Il n’y a pas de taux de mortalité qui puisse être réduit… et pour les gens qui sont âgés et ont des maladies pré-existantes, comme nous l’avons appris du Dr McCullough et de ses collègues, il y a des médicaments très efficaces pour traiter ce virus pour que le taux de mortalité diminue de 70 ou 80%, ce qui veut dire qu’il n’y a aucune urgence en quoi que ce soit. Mais ceci est une grave menace pour le cartel vaccinal et du remdesivir.”

[…]

Le Dr McCullough dit qu’en traitant les patients précocement à la maison, les médecins peuvent de fait mettre totalement fin à la pandémie.

[…]

Ce sont les médecins indépendants qui ont de la compassion et qui innovent pour utiliser ce que nous appelons le principe de précaution. Ils utilisent leur meilleur jugement médical et meilleures données scientifiques pour mettre en application une thérapie immédiate et ainsi pratiquer l’art de soigner. Pour tous nos collègues universitaires qui ont dit “Dr McCullough, nous devons attendre de plus larges études et essais randomisés”, nous leur avons toujours répondu ceci “Ecoutez, ceci est un évènement de masse. Les gens meurent ici et maintenant. Ils sont hospitalisés maintenant. Nous ne pouvons pas attendre pour de plus larges essais randomisés. Nous devons être des médecins. Nous devons commencer à soigner les gens.

II. Tuer l’hydroxychloroquine

[…]

Il n’y a pas d’aspect plus révélateur dans cette crise COVID des intentions malveillantes d’un puissant cartel vaccinal, emmené par le Dr Fauci et Bill Gates, pour prolonger la pandémie et amplifier ses effets mortels afin de promouvoir leurs inoculations malfaisantes.

Dès le départ, l’hydroxychloroquine (HCQ) et autres thérapies ont posé une menace existentielle au projet de 48 milliards de dollars de vaccination anti-COVID du Dr Fauci et de Bill Gates et aussi particulièrement à leur médicament vaniteux (et dangereux) qu’est le remdesivir, dans lequel Gates a beaucoup investi.

Sous la loi fédérale américaine, de nouveaux vaccins ou nouveaux médicaments ne peuvent pas bénéficier du label d’ “Autorisation d’Utilisation d’Urgence” ou AUE, s’il y a un médicament approuvé par la FDA qui soit efficace contre cette même maladie. […] Ainsi donc quelque médicament que ce soit comme l’HCQ ou l’ivermectine soit prouvé efficace contre la COVID, alors les labos pharmaceutiques ne seraient plus permis de faire passer en urgence une utilisation de leur projet vaccinal de milliards de dollars. Ces vaccins devraient au contraire passer par la très longue procédure méthodologique de mise sur le marché. Cela signifierait moins de bénéfices, plus d’attente, plus d’aléas et une triste fin pour cette ruée vers l’or de la vaccination anti-COVID. Le dr Fauci a investi 6 milliards de dollars du contribuable américain juste dans le vaccin Moderna. Son agence est co-détentrice du brevet et se positionne pour engranger une véritable fortune en droits et royalties. Au moins quatre des adjoints sélectionnés de Fauci sont en attente de collecter des dividendes de l’ordre de 150 000 US$ par an du succès de Moderna et ceci s’ajoutant à leurs salaires déjà payés par le trésor public américain.

[…]

Enormément de gens en Afrique et en Inde prennent de l’HCQ durant toute leur vie. Comme la recommandation du protocole anti-COVID le demande, il ne s’agit que d’une prise du médicament pendant une semaine. La révélation soudaine du dr Fauci disant que ce médicament est dangereux est au mieux bizarre.

D’après le Dr McCullough, “Il n’y a pas à ce jour de rapport crédible que ce médicament augmente le risque de mortalité chez les patients de la COVID-19 lorsqu’il est prescrit par des médecins compétents qui comprennent son profil de sécurité.

[…]

Le premier grand champion de l’HCQ fut le professeur français Didier Raoult, icône de la recherche sur les maladies infectieuses, qui a publié plus de 2700 articles et est célèbre pour avoir découvert 100 micro-organismes, incluant le pathogène causant la maladie de Whipple. Le 17 mars 2020 [NdT : date du commencement du premier confinement en France], le Dr Raoult a fourni un rapport préliminaire sur 36 patients traités avec succès à l’hydroxychloroquine et parfois avec de l’azithromycine dans son institution médicale marseillaise.

en avril 2020, le Dr Vladimir (Zev) Zelenko, médecin de terrain  dans l’état de New York et très tôt utilisateur de l’HCQ, a reproduit les succès du Dr Raoult en réduisant systématiquement le taux attendu de mortalité chez plus de 800 patients que Zelenko traita avec le cocktail HCQ.

[…] En mai 2020, le Dr Harvey Risch, médecin, a publié l’étude la plus compréhensive sur l’efficacité de l’HCQ contre la COVID. Risch est professeur d’épidémiologie à l’université de Yale, expert mondial de l’analyse des données médicales et cliniques.

[…]

Le Dr Risch a démontré plus avant et avec grande spécificité, comment les critiques de l’HCQ, largement financés par la fondation B&M Gates et le Dr Fauci, ont mal interprété, mal énoncé, et mal rapporté les résultats négatifs d’études employant des protocoles erronés, dont la plupart décrivaient l’efficacité de l’HCQ sans administration de zinc, connu pour renforcé l’efficacité et du zithromax, aussi connu comme agent favorisant l’action médicamenteuse de l’HCQ. Mais leur truc favori pour s’assurer de l’échec des protocoles fut d’attendre que la maladie soit très avancée chez les patients avant d’administrer l’HCQ, dans cette période tardive où la substance est la plus inefficace.

[…]

McCullough montre que l’efficacité du cocktail d’HCQ est basée sur la pharmacologie de l’ionophore de l’hydroxychloroquine qui agit comme le “flingue” et le zinc comme “la balle”, tandis que l’azithromycine potentialise l’effet anti-viral

[…]

Le 13 janvier 2020, lorsque des rumeurs sur la maladie grippale de Wuhan COVID-19 commencèrent à circuler, le gouvernement français prit alors la plus bizarre et sans précédent des décisions et de plus très suspicieuse, de réassigner l’hydroxychloroquine, jusqu’ici un médicament que l’on pouvait se procurer en pharmacie sans ordonnance médicale, ce depuis des décennies, en médicament sujet à prescription. Sans citer quelque étude scientifique que ce soit, les fonctionnaires du ministère de la santé français ont changé le statut pharmacologique de l’HCQ en la reclassant “substance vénéneuse liste II” et en interdirent la vente libre. Cette remarquable coïncidence se reproduisit de la même manière lorsque les officiels de la santé canadienne firent la même chose, retirant en catimini le médicament des étagères des pharmacies.

[…]

La compagnie mère de Google, Alphabet, possède plusieurs entreprises de vaccins, incluant Verily ainsi que VacciTech, une entreprise qui compte sur les vaccins de la grippe, le cancer de la prostate et la COVID. Google a des partenariats très lucratifs avec de très grands fabricants de vaccins incluant un partenariat à hauteur de 715 millions de dollars avec le laboratoire GlaxoSmithKline (GSK). Verily possède aussi une entreprise qui teste pour l’infection COVID. Google ne fut pas la seule plateforme de média en ligne qui censura les contenus qui contredisaient le narratif officiel contre l’HCQ. Facebook, Pinterest, Instagram, Youtube, MailChimp et quasiment toutes les grosses plateformes en ligne de Big Tech commencèrent à faire disparaître l’information démontrant l’efficacité de l’HCQ, la remplaçant par la propagande de l’industrie pharmaceutique générée par des agences de santé publique contrôlées par Fauci et Gates : Le HHS, NIH et l’OMS.

[…]

En juillet 2020, Bill Gates endorsa la censure des recommandations de l’HCQ après qu’une vidéo démontrant son efficacité contre les coronavirus ait accumulé des dizaines de millions de vues. Gates qualifia cette vidéo de “scandaleuse” et félicita Facebook et Youtube de l’avoir rapidement escamotée. Il se plaignit néanmoins en disant : “Vous ne pouvez pas la trouver directement sur ces services, mais tout le monde envoie le lien, car on peut toujours la trouver et la voir sur internet.” Gate dit à Yahoo News que cela révélait un défaut persistant de ces plateformes  “leur incapacité à arrêter les choses avant que cela ne se propage, ils auraient probablement du améliorer tout ça”, a fustigé Gates.

[…]

Gates continua avec la promotion du remdesivir de Gilead Science comme étant la meilleure alternative à la COVID, ce malgré les résultats minables de ce médicament comparé à ceux de l’HCQ. Il ne mentionna néanmoins pas le fait qu’il avait de gros investissements dans Gilead Science qui engrangerait des millions de dollars si Fauci arrivait à faire passer le remdesivir au travers du parcours du combattant régulateur.

[…]

Le Lancetgate

Cela demeure un mystère que de savoir quelles grandes figures ont causé aux deux plus grands magazines scientifiques The Lancet et le New England Journal of Medicine (NEJM), de publier des études si ouvertement frauduleuses depuis une base de données inexistante, propriété d’une entreprise jusqu’alors inconnue. Anthony Fauci et le cartel vaccinal célébrèrent les publications du Lancet et du NEJM le 22 mai 2020 comme étant le clou final dans le cercueil de l’hydroxycholoroquine.

[…]

Le titre d’un exposé de toute l’affaire par le journal anglais “The Guardian” a exprimé le choc mondial dans la communauté scientifique à la vue du niveau de corruption au sein de ces deux piliers de la publication scientifique dans le monde : “The Lancet a effectué une des plus grosses rétractations d’information de l’histoire moderne. Comment cela a t’il pu se produire ?” Les journalistes du Guardian de Londres accusèrent ouvertement The Lancet de faire la promotion de la fraude : “Le nombre incroyable et la magnitude des choses qui se sont mal passées ou ont été escamotées est bien trop énorme pour être attribué à une simple incompétence.”. Le journal commenta : “Ce qui est incroyable, c’est que les éditeurs de ces publications soient toujours en poste, les données sous-jacentes à ces études sont aussi mauvaises que cela.

La capacité de leur maîtres de Big Pharma de tordre le bras et de forcer ces deux plus grands journaux médicaux au monde, le NEJM et The Lancet, de souscrire à une recherche mortelle et dans le même temps publier des articles si ouvertement frauduleux au milieu d’une pandémie, atteste de l’incroyable pouvoir de ce cartel et de son caractère sans pitié. Il n’est plus du tout controversif que de dire et de reconnaître que les fabricants de médicaments contrôlent de manière rigoureuses les publications médicales et que The Lancet, le NEJM  et le Journal of the American Medical Association (JAMA) sont des instruments dûment corrompus au service de Big Pharma. Le rédacteur en chef du Lancet, Richard Horton confirme : “Les journaux médicaux se sont résolus au blanchiment de l’information au service de l’industrie pharmaceutique.” La Dr Marcia Angell, qui fut éditrice au NEJM pendant 20 ans dit que les journaux médicaux sont “essentiellement une machine de marketing des produits. Big Pharma a coopté et corrompu toute institution qui pourrait se tenir sur sa route.

[…]

Ces rétractations historiques passèrent pratiquement inaperçues dans les médias de masse de l’inculture scientifique, qui continuèrent à fortifier la propagande officielle COVID. Des manchettes de journaux continuèrent de blâmer l’HCQ pour de faux décès plutôt que les chercheurs délibérément traîtres qui donnèrent aux malades, personnes âgées et aux patients à l’immunité compromise des doses de médicaments toxiques.

[…]

En mars, alors que des patients mouraient à un rythme de 10 000 par semaines, le dr Fauci déclara que l’HCQ ne devait être utilisée que dans le cadre d’essais cliniques en hôpitaux. Pour la première fois dans l’histoire américaine, un haut-fonctionnaire du gouvernement passait par dessus le jugement de milliers de médecins traitants et ordonnait aux médecins d’arrêter de pratiquer la médecine comme alliée du bien commun. Le dr Fauci continua à déclarer péremptoirement et sans relâche : “la preuve conclusive est que les études randomisées proprement exécutées ne montrent aucune efficacité thérapeutique de l’hydroxychloroquine.” Il ne mentionna néanmoins pas qu’AUCUN des essais qu’il avait utilisés comme base de l’expression de sa conviction n’avait impliqué l’absorption par les patients d’HCQ dans les 5 à 7 jours après les premiers symptômes. Au lieu de cela, tous ces essais randomisés ciblaient des patients avancés dans la maladie et déjà hospitalisés.

Les gens qui voulaient être traités dans cette toute première phase critique de la maladie n’avaient pas de chance car le dr Fauci interdit alors aux patients de recevoir un remède sauveur de vies pendant la fenêtre propice du traitement, alors que la science et l’expérience accumulée démontraient la molécule être efficace dans le soin de la maladie.

[…]

Le NIAID a arrêté un essai clinique du médicament pour les patients en ambulatoire en juin 2020, seulement un mois après l’avoir commencé et en n’ayant enrôlé que 20 patients sur les 2000 planifiés. La FDA a bloqué l’accès à des millions de doses d’HCQ et de chloroquine (CQ) que le labo Sanofi et autres fabricants de médicaments avaient donné au Strategic National Stockpile (dons déductibles des impôts). Sanofi a de plus annoncé qu’il ne produirait plus le médicament pour utilisation en traitement de la COVID. Le dr Fauci et ses sbires de l’HHS ont décrété que les stocks de médicaments pourrissent dans les hangars alors que les Américains deviennent inutilement malades et meurent de la COVID-19

Le 17 juin 2020, l’OMS, dont Bill Gates et le plus grand pourvoyeur de fonds après les Etats-Unis et sur laquelle Gates et Fauci exercent un strict contrôle, a appelé à l’arrêt des essais cliniques dur l’HCQ dans des centaines d’hôpitaux du monde entier. Le patron de l’OMS, Tedros Adhanom Ghebreyesus a ordonné aux nations d’arrêter d’utiliser l’HCQ et la CQ. Le Portugal, la France, l’Italie et la Belgique ont banni le traitement de la COVID-19 par HCQ.

[…]

Une méta-revue de 58 études peer-reviewed par des médecins chercheurs en Espagne, Italie, France et Arabie Saoudite a trouvé que l’HCQ réduit de manière dramatique le taux de mortalité lié à la COVID, tandis que des articles émanant de médecins turcs, canadiens et américains ont trouvé que la toxicité cardiaque de l’HCQ est négligeable.

[…]

De manière similaire et ce malgré le fait que l’hygiène dans les pas invoqués soit souvent inférieure, il y a bien moins de morts par habitants en Ethiopie, au Mozambique, Niger, Congo et Côte d’Ivoire qu’aux Etats-Unis. Dans ces pays, le taux de mortalité oscille entre 8 et 47,2 morts pour 1 million d’habitants, données au 24 septembre 2021. Par contraste, les pays occidentaux à qui on a refusé l’accès à l’HCQ font l’expérience d’un taux de mortalité bien plus élevé pour la maladie, de 220 par millions en Hollande à 2000 par million aux Etats-Unis et 850 par million en Belgique. Dr Meryl Nass a observé : “Si les gens dans ces pays à paludisme renforçaient leur système immunitaire avec du zinc, de la vitamine C et D, le taux de mortalité serait encore plus bas…

[…]

En 2013, lorsque le dr Fauci avait soutenu l’utilisation de la ribavirin / interferon contre le MERS ou Syndrome Respiratoire du Moyen-Orient, le double remède contre l’hépatite C était, d’après le NIH, extrêmement dangereux, occasionnant des dégâts chez pratiquement tous les patients qui prenaient le cocktail, qui provoque un syndrome de fatigue chronique par anémie hémolytique et une augmentation des malformations de naissance ainsi que des enfants morts-nés. La ribavirin est toxique pour les gènes, mutagène et un carcinogène potentiel.

Quoi qu’il en soit, en 2013, le dr Fauci recommandait cette thérapie malgré le manque total d’étude randomisée avec placebo dans des essais cliniques contrôlés et en fait le manque totale de donné de l’utilisation de ce cocktail sur des humains dans le traitement du MERS.

Les vaccins qui qualifient pour une Autorisation d’Utilisation d’Urgence incluent ces nouvelles plateformes ARNm et ADN sans aucun profil de sécurité connu. D’autres utilisent des adjuvants toxiques comme le squalène et l’aluminium ou de nouveaux adjuvants ayant des risques prouvés de haut risque de blessure sérieuse.

[…] Les vaccins sont si dangereux que l’industrie de l’assurance a refusé de les couvrir ! Et les fabricants refusent de les produire sans la couverture d’une immunité légale contre toute responsabilité civile et criminelle. Bill Gates qui est le principal investisseur dans bon nombre de ces vaccins anti-COVID a stipulé que le risque est si grand qu’il ne les fournirait pas aux gens à moins que les gouvernements ne le protègent contre toute poursuite judiciaire.

[…]

L’inconsistance et le constant foulage aux pieds de l’éthique du dr Fauci vont de paire avec sa longue histoire de la promotion de produits brevetés par Big Pharma et donc plus profitables et de l’utilisation de son pouvoir d’influence pour faire avancer son agenda sans aucun égard pour la santé publique. Le rôle de meneur du dr Fauci dans ce scandale mortel est tout a fait consistant avec sa longue histoire de discrédit des thérapies qui entrent en concurrence avec les vaccins et autres produits pharmaceutiques brevetés.

Grâce à la campagne stratégique du dr Fauci, la plupart des Américains sont toujours incapables d’obtenir de l’HCQ pour un traitement précoce de la COVID-19, encore moins d’Américains ne peuvent y avoir accès à titre préventif et encore moins sont au courant de ses bénéfices curatifs.

[…]

Le professeur Risch pense que le dr Fauci a sciemment menti au sujet de l’hydroxychloroquine et qu’il a utilisé son influence au sein de la FDA pour la faire supprimer parce que lui et d’autres bureaucrates “sont au lit avec d’autres forces qui leur font prendre des décisions qui ne sont pas fondées sur la science et qu’ils tuent des Américains.

De plus, le dr Risch affirme spécifiquement, que Fauci et la FDA ont provoqué la mort de centaines de milliers d’Américains qui auraient parfaitement pu être sauvés avec l’hydroxychloroquine.

A suivre…

roulettevaccinale

Dictature sanitaire par les chiffres de la peur de la fraude des tests PCR. Informons et mettons-y fin ! (Dr Nicole Delépine)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , on 1 décembre 2021 by Résistance 71

La Dr Delépine enfonce un clou de plus dans le cercueil de cette fumisterie à test PCR dont nous avons par ailleurs déjà dénoncé la fraude il y a un an (voir le superbe PDF de Jo ici). A faire circuler au grand large. En une phrase lapidaire : Les tests PCR sont l’outil de la fabrication de la peur et du « consentement » forcé aux mesures sanitaires dictatoriales… La PCR n’a pas été inventé (Par Karry Mullis, qui obtint le prix Nobel de chimie pour son invention) pour être un test thérapeutique des instructions mêmes de son inventeur, mais un outil de reproduction de matériel génétique à des fins de recherche. Qu’on se le dise une bonne fois pour toute ! Réflexion – Union – Action – Rébellion ! Il est plus que grand temps !..
~ Résistance 71 ~

RT-PCR1
La fraude test PCR

Mr Véran, Un “cas” n’est pas un malade ! Sans test PCR il n’existe pas de vagues. Stop mesures antiCOVID

Dr Nicole Delépine

26 novembre 2021

source:
https://www.mondialisation.ca/mr-veran-un-cas-nest-pas-un-malade-sans-test-pcr-il-nexiste-pas-de-vague-stop-mesures-anticovid/5662654

Une nouvelle fois les mesures annoncées par le ministre reposent sur des « cas » dépistés par tests et non sur des malades.

VAGUE DE « CAS » FONDÉS SUR TESTS PCR DÉNONCÉS PAR LA FDA, MAIS PAS DE MALADES

Les nouvelles annonces d’O. Véran reposent comme depuis plus d’un an sur les « cas » et la mystification, qui consistent à confondre cas dépistés par des tests fallacieux et de vrais malades.

Et comme les médias diffusent en continu la propagande gouvernementale sans dénoncer la différence entre un test positif et un vrai malade (que le réseau sentinelle dépiste), la panique et ses conséquences funestes continuent sur tous les plans, médical, mais aussi psychologique, économique et politique. Pendant que des pays aussi différents que le Texas ou la Côte d’Ivoire ont repris des vies normales depuis des mois, la France continue de s’enfoncer dans la désespérance et la régression générale.[1]

Qu’a dit Véran ?

« Le pass sanitaire ne sera plus valide sans la 3e dose à partir du 15 janvier.

La 3e dose de vaccin anti-Covid est ouverte à tous les Français de plus de 18 ans dès 5 mois après la 2e injection. Le pass sanitaire sera désactivé 7 mois après la 2e dose.

– Le gouvernement a exclu toute mesure de restriction stricte de type confinement et couvre-feu, compte tenu de la pression hospitalière qui reste modérée.

– La durée de validité des tests PCR et antigéniques, qui permettent d’obtenir le pass sanitaire sans vaccination, sera réduite à 24 h.

– Le port du masque est à nouveau obligatoire dans tous les établissements recevant du public, et dans les lieux de brassage de population à l’extérieur sur décisions des préfets.

– Les classes d’école ne seront plus fermées dès détection d’un cas de Covid-19. En cas de nouveau cas détecté, les élèves seront tous testés, ceux présentant un résultat négatif resteront admis en classe.

Les tests seront gratuits et pourront être faits par les parents à l’extérieur de l’école »

Cerise sur le gâteau : passe obligatoire pour les marchés de Noel !! .

LES ÉVEILLÉS : OUVREZ LES YEUX CONTRE LES TESTS PCR ET INFORMEZ !

Quand les « éveillés » vont-ils ouvrir leurs propres yeux et ceux de la population sur la vague de tests et l’absence d’augmentation du nombre de malades ? Ce test est l’arme de terreur du pouvoir qui permet de tenir le peuple dans l’angoisse de cette fameuse nouvelle vague qu’ils attendent tant elle est annoncée. Et tant que la population ne fera pas la différence entre cas et malades, ils recommenceront encore et encore.

Il faut dénoncer la supercherie qui nous trompe depuis janvier 2020. Elle a été clairement démontrée par maître Reiner Fuellmich dès octobre 2020[2] et par le tribunal de Lisbonne qui a fort longuement expliqué qu’un diagnostic est un acte médical qui repose sur une consultation, des signes cliniques et éventuellement confirmé par les examens paracliniques.[3] Nous avions espéré que ces petites victoires juridiques aideraient à faire cesser cette tromperie mondiale, mais rien n’y a fait : le cirque continue, entretenant la peur même chez les soi-disant éveillés qui vont se faire tester pour se rassurer, et même chez certains médecins lanceurs d’alerte qui incluent le test PCR dans leurs algorithmes.

LE LEURRE DES CONTAMINATIONS DOIT CESSER

LES CAS NE SONT NI DES MALADES NI DES MORTS

Et le ministre l’avoue puisqu’il n’envisage pas de confinement ni couvre-feu en l’absence de pression hospitalière. Pas de malades, pas de morts.

Il vient de se faire prendre la main dans le sac, obligé de reconnaître que la soi-disant surcharge insupportable de nos hôpitaux de 2020 n’a rempli que 2 % des lits en moyenne et donc même si c’est 19 % au moment des pics, on reste très loin du tsunami décrit chaque soir par notre croque-mort de service toujours en place à ce jour. Donc il attend un peu que l’effet négatif médiatique soit oublié. Quelques journalistes n’ont pas apprécié le mensonge éhonté.

Le test PCR

ne dépiste que des virus, proches ou équivalents au SARS-CoV-2, des résidus de virus plus ou moins récents, mais ne démontre en aucun cas une nouvelle vague de Covid19.

Tous ceux qui tentent d’informer sur les vérités et mensonges dans ce scénario catastrophe de plandémie depuis bientôt deux ans doivent le hurler, le répéter, l’expliquer, etc. et ne jamais le laisser oublier ! Et n’oubliez jamais que les bien portants appelés asymptomatiques ne transmettent pas le virus : ceci fut définitivement démontré par l’étude chinoise sur dix millions de personnes et aussi vite oublié. C’est la deuxième arme du trucage du scénario Covid.[4]

LE TEST PCR EST L’ARME DU POUVOIR POUR NOUS MUSELER, PIQUER, ENFERMER, TRACER

Laissons raconter cette supercherie des tests PCR par le Dr Édouard Broussalian

Extrait de son magnifique récit de cette pandémie[5]:

« Sans tests PCR il n’y avait point de pandémie[6] et le test était parfaitement vérolé de manière à détecter un maximum de “cas”. Mais c’était tout ce qu’il fallait pour aller dans le sens de la nouvelle définition de “pandémie”, juste des “cas”, pas forcément des vrais malades et encore moins de mortalité. Un document qui vient d’être publié par la Food and Drug Administration (FDA) des États-Unis admet ouvertement que le fameux test PCR pour le coronavirus de Wuhan (Covid-19) a été mis au point non pas à partir d’échantillons réels du virus chinois, mais plutôt à partir de ce qui semble être du matériel génétique d’un virus du rhume. Dans le document de la FDA, il est clairement indiqué que le matériel génétique ordinaire de la grippe saisonnière a été utilisé comme marqueur de test dans les kits de test PCR.[7]

De manière parfaitement incroyable, l’article de Corman-Drosten a été soumis à Eurosurveillance le 21 janvier 2020 et accepté pour publication le 22 janvier 2020. Le 23 janvier 2020, l’article était en ligne. »

« Plus incroyable encore, le protocole de test Drosten, qu’il avait envoyé à l’OMS à Genève le 17 janvier 2020, avant même que l’article ne soit publié[8] a été officiellement recommandé par l’OMS comme test mondial pour déterminer la présence du coronavirus de Wuhan.»

Que dire du scandale des cycles d’amplification ? L’OMS et Drosten ont recommandé un CT de 45 cycles. Il n’est pas étonnant que, alors que le nombre de tests augmente au début de la saison grippale hivernale, les “positifs” PCR en Allemagne et ailleurs explosent. Comme le soulignent les auteurs critiques, si les autorités sanitaires devaient spécifier 35 cycles maximum, selon l’article de Jaafar à l’IHU à 35 cycles, il ne resterait plus que 3 % de vrais positifs ! Ils notent, « un résultat analytique avec une valeur CT de 45 est scientifiquement absolument dénué de sens (une valeur CT raisonnable ne doit pas dépasser 30). »

Le 27 novembre 2020, un groupe très respecté de plus de 20 virologues, microbiologistes et scientifiques du monde entier a publié un appel à Eurosurveillance pour retirer l’article du 23 janvier 2020 du « Dr » Christian Drosten, l’inventeur du dit « test » PCR. Leur analyse minutieuse de la pièce originale est accablante. Le leur est un véritable « examen par les pairs ». Ils accusent Drosten d’incompétence scientifique « fatale » et de failles dans la promotion de leur test.

Il est même possible que ce test fourré au fond du nez serve rapidement à ficher toute la population avec l’ADN des frottis. Une firme britannique entend gagner ainsi beaucoup d’argent.

Que seule la complicité servile des mé(r)dias — hormis en France l’exception notable de France Soir et quelques rares autres — soutenue par une censure féroce dans tous les réseaux sociaux a permis d’installer la doxa officielle dans les cerveaux d’une population hypnotisée, abasourdie. Toute forme de pensée critique, quelle qu’elle soit, est immédiatement accusée d’être complotiste, la plupart des professionnels compétents sont muselés par la peur du dénigrement.

« Le grand test que fut la grippe H1N1 a appris aux mondialistes que le contrôle absolu des médias conditionnait la réussite du projet. C’est aujourd’hui chose faite. Devant des médias complices de la conspiration, débitant ad nauseam la doxa du système, la censure systématique — notamment sur les réseaux sociaux — et la ridiculisation de toute voix discordante à l’aide d’étiquettes telles que « complotisme » ou « anti-vax ». La censure organisée sur tous les réseaux sociaux et dans la pressetituée nous a prouvé très tôt l’existence d’un projet, d’une volonté, d’une coordination du crime, avec les fameux « fact-checkers » — simples informaticiens ou joueurs de jeux vidéo autoproclamés défenseurs de la « science » — formant les bataillons de la répression afin de maintenir à tout prix la vision et les ordres de l’OMS. »

Notons que cette nouvelle version de l’historique confirme une fois de plus les récits de Denis Rancourt et Pascal Sacré dans mondialisation.ca entre autres, et ceux de Reiner Fuellmich dans nombre de vidéos et de bien d’autres ; tous travaux que nous avons tenté de répercuter pour rassurer et faire stopper cette double tromperie, imposture, duperie, falsification, fraude, dans un silence et une indifférence intersidérale.

D’où vient la valeur magique de ce bout de coton enfoncé au fin fond de votre nez, alors qu’on vous raconte que ce virus malin est fort contagieux et qu’il faut porter un masque pour éviter de contaminer les autres, même en forêt ou à la plage voire seul sur le mont Blanc ?

Appelez le test PCR du nom de votre choix, fraude médicale étant peut-être encore le plus approprié, mais informez, que cette plandémie puisse cesser avec son cortège de drames, de malades cancéreux et autres non traités, de suicides, de faillites, de ruptures, etc.

En résumé

Les tests PCR doivent être abandonnés et les malades diagnostiqués par les médecins comme pour n’importe quelle grippe.

Les cas ne sont pas des malades.

Les asymptomatiques ne sont pas malades et ne sont pas contagieux.

Les pseudovaccins géniques ne protègent pas des contaminations ni des formes graves, comme le nombre élevé d’hospitalisés double-vaccinés en Israël ou en Angleterre le démontre. Leurs effets secondaires sont importants, bien supérieurs aux autres « vaccins ».

En France, le syndrome Tchernobyl et la peur du conseil de l’ordre et des supérieurs hiérarchiques bloquent l’information qui ne doit néanmoins être guère différente des autres pays.

Pour désarmer le ministre sans violence, il faut le priver de la croyance en son test PCR et de ce narratif mensonger.

Et pour tous ceux qui se sont fait injecter pour retrouver la liberté, si vous ne vous réveillez pas, vous avez pris un abonnement pour perpet…[9]

Dre Nicole Delépine

Notes :

[1] Faites vos jeux, rien ne va plus ! Comment le gouvernement peut-il parler de cinquième vague ? — Nouveau Monde (nouveau-monde.ca)

[2] Nuremberg-Covid : un crime contre l’humanité qui doit être jugé ! — Riposte LaïqueRiposte Laïque (ripostelaique.com)

[3] Vers le faire-part de décès des tests PCR (francesoir.fr)

Un tribunal portugais juge que les tests PCR sont « peu fiables » et les quarantaines « illégales » (profession-gendarme.com)

[4] Les bien-portants, dits « asymptomatiques », ne transmettent pas le Covid19 : étude chinoise sur 10 millions de personnes ! (francesoir.fr)

[5] Un Plan Pour Le Monde — Nouveau Monde (nouveau-monde.ca) et

Planète Homéopathie • Un Plan Pour Le Monde (planete-homeopathie.org) avec toutes les références

[6] résumé par Fuellmich lui-même : « Le fait est que les tests PCR comme méthode de mesure des infections ne sont pas seulement une absurdité scientifique, mais a apparemment été programmé intentionnellement de manière à créer le plus grand nombre possible de faux positifs, et donc à semer la panique dans le monde. Cela est prouvé par un article de rétractation rédigé par 22 scientifiques internationaux très respectés, qui demande à l’éditeur de la revue de rétracter immédiatement ces absurdités. Il a été consulté environ 18 millions de fois jusqu’à présent ». « En outre, l’affirmation de Drosten, selon laquelle il existe des infections asymptomatiques, est également fausse.Parce qu’il n’y a rien de tel, comme l’a récemment prouvé une grande étude de Wuhan, concernant 10 millions de personnes ». « Une personne qui ne présente aucun symptôme est en bonne santé — n’en déplaise au bon Docteur Knock. Cela signifie qu’aucun de nous ne doit avoir peur des personnes qui ne présentent aucun symptôme et les forcer à porter des masques, ni avoir peur qu’un résultat positif signifie forcément qu’il est infecté. Les images d’horreur des hôpitaux avec des lits dans les couloirs, qui réapparaissent maintenant, existent en fait chaque année pendant la vague de grippe tout à fait normale. Elles ne sont utilisées maintenant qu’à dessein, afin d’alimenter davantage la panique. Il n’y a toujours pas de surmortalité en Allemagne. Plus de gens meurent en hiver : c’est tragique, mais c’est malheureusement “normal” ». « Alors, de quoi s’agit-il vraiment s’il n’y a pas de problème de santé qui diffère de la vague de la grippe habituelle ? À cet égard, nous avons pu nous forger une opinion sur la base des auditions qui ont eu lieu, ainsi que des informations complémentaires.

[8] Et donc sans possibilité de relecture par ses pairs.

[9] élargissement de la dose de rappel à tous.

– Réduction du délai de 6 à 5 mois pour faire prendre sa dose de rappel ;

– À partir du 15 décembre, le pass sanitaire pour les +65 ans ne sera plus actif si l’injection de rappel n’aura pas été prise dans un délai de 7 mois après la dernière dose ;

– À partir du 15 janvier 2022, le pass sanitaire ne sera plus valide pour toutes les autres classes d’âges n’ayant pas pris leur dose de rappel.

Pour toutes et tous ceux qui croyaient que se faire injecter, c’était le retour à la liberté, vous voilà rassurés.

Vous venez de prendre pour perpet ». Via libreetinsoumis sur telegram

= = =

Lire notre page « Coronavirus, guerre contre l’humanité »

La fraude des tests RT-PCR (PDF)

mort_par_medicament

vax_BD

Dictature sanitaire et Nouvel Ordre Mondial : confirmation si besoin était de la fraude des tests RT-PCR pour COVID19 (Dr Nicole Delépine)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, désinformation, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , on 20 novembre 2021 by Résistance 71

resistance1

Nous avons dénoncé cette falsification des chiffres à coup des tests RT-PCR  et publié des articles depuis novembre 2020 avec rappel en mars 2021 sur la base de la fraude chiffrée que constitue les “tests” PCR qui ne sont pas des tests, mais un outil de duplication de matériel génétique pour pouvoir cultiver et travailler sur des échantillons. Ceci des mots mêmes de leur inventeur le Pr Karry Mullis, prix Nobel de chimie 1993 pour cette découverte.
De fait, nous avions relayé en août 2020 un article du journaliste Jon Rappoport traduit en français, mais dont la publication en anglais remontait à avril 2020, c’est à dire au tout tout début de la “pandémie” : “Les tests COVID19 sont une fraude !”
Le seul moyen de déclarer une “pandémie” est de :

1- changer la définition d’une “pandémie” ce qu’a fait l’OMS un paquet de fois depuis la “pandémie” H1N1 qui avait fait un gros “flop”

2- Falsifier les chiffres des données. Deux méthodes employées efficacement dans le cas de la fraude COVID19 : 

a) L’utilisation d’algorithmes et de “modèles informatiques”, c’est à dire ne plus baser la science sur l’observation des faits, mais extrapoler sur des modèles informatiques, qui “projettent” des résultats en fonction d’algorithmes et de données intégrés qui peuvent parfaitement être erronées, insuffisantes ou simplement falsifiés. Ainsi nous avait-on prédit 500 000 morts en France selon les “modèles” et qu’urgence il y avait.
Nous vivons depuis des lustres dans un monde de la “science des modèles”,  manipulatrice à souhait, un des meilleurs exemples étant celui de la fraude (une de plus !) de la théorie du réchauffement climatique anthropique, basée sur des modèles informatiques (sciemment) erronés… Le cas COVID n’est qu’un symptôme de plus de cette maladie qui ronge la science au profit de desseins vils, veules et criminels.

b) L’utilisation de “tests” frauduleux ayant pour vocation de donner des résultats dans le sens escompté, en l’occurence une marée de “cas positifs”, surgonflant les chiffres et facilitant la réaction à une peur synthétique, fabriquée à coup d’algorithmes et de “tests” erronés. Ceci permet la mise en place du pilotage émotionnel des masses et de proposer des “solutions” toutes pus liberticides les unes que les autres…
Mais il ne faut pas s’arrêter en si bon chemin. Tout ceci n’est qu’outil pour finaliser un objectif : celui de la mise en place d’une dictature technotronique, qui par le contrôle numérique se voudra résoudre et contrôler toutes les “crises” fabriquées (COVID, crise économique, crise “climatique”, crise démographique}, bien évidemment sous le couvert pernicieux de “sécurité, de “bien commun”, de “santé publique” et de “bien-être pour tous” dans un meilleur des mondes pré-digéré pour nous par un ramassis de criminels psychopathes qui essaient coûte que coûte de sauver, de transmuter le système qui les maintient au pouvoir et qui arrive au bout du bout du banc, en un Nouvel Ordre Mondial de l’horreur eugéniste et transhumaniste, sur toile de fond de d’immortalité et de “fontaine de jouvence” élitiste.
Il est plus que grand temps que nous, les peuples de la Terre, unis, ne les mettions eux et le système qui les génère, hors d’état de nuire.
Notre page “coronavirus” s’intitule depuis le tout début 2020 “Coronavirus, guerre contre l’humanité”. Nous ne l’avons pas intitulée de la sorte par pure coïncidence… Nous sommes sous attaque directe du système oligarchique par excellence. Nous sommes, depuis 2020, entrés de pleins pieds dans la phase terminale de mise en place et à terme, ce sera eux ou nous. Ils ne reculerons pas et nous sommes, nous les peuples de monde, plus que jamais en état de légitime défense permanente.
Il nous faut d’abord vaincre mentalement et physiquement l’oppression qui nous accable, puis immédiatement, dans le même temps mettre en place un système social des associations libres et de mise en avant du véritable bien commun, hors état, hors marchandise, hors argent et hors salariat. Ceci est la seule solution viable pour la réalisation de notre humanité. La condition pour l’espèce humaine de devenir enfin adulte au-delà de toutes les chimères et impostures du monde étatico-marchand en fin de cycle et voués aux oubliettes de l’Histoire.
Il n’en tient qu’à nous. La solution est en nous, unis et solidaires.
~ Résistance 71 ~

“La question sociale est une question agraire” (Gustav Landauer)

RT-PCR1
Test bidon + données bidon = vraie peur fabriquée !!

RÉVÉLATIONS CAPITALES DE LA FDA

Invention du récit Covid

Dr Nicole Delépine

18 novembre 2021

url de l’article original:

La mystification par le test PCR pour créer le mythe de la pandémie et entretenir la peur

La mystification par l’usage inapproprié du test PCR, dénoncée depuis octobre 2020 par l’avocat Reiner Fuellmich continue malgré sa condamnation en justice en octobre 2020 au Portugal.[1][2]

Partout dans les pays riches, les gouvernants imposent son usage mortifère grâce à la corruption de nombreux scientifiques et médecins, médias auxquels on laisse la parole, les nombreux autres étant diffamés menacés et muselés.

Actuellement, un simple test positif vous fait qualifier de « cas »,[3][4][5] vous déclare dangereux pour les autres, vous interdit de travail, d’école ou de sport et vous expose à des interrogatoires dignes de l’inquisition (la torture physique en moins) pour que vous dénonciez ceux que vous avez rencontrés, qui seront aussitôt déclarés cas contact et soumis à leur tour à la folie d’exclusion et de tests répétitifs.

Pour casser la chaîne de transmission, il faut isoler les vrais malades, ceux qui présentent des signes cliniques (fièvre, toux, fatigue, anosmie…) chez lesquels le test peut être utile pour confirmer le diagnostic d’infection virale (et guère plus) et laisser vivre normalement les asymptomatiques (qui ne sont que très exceptionnellement contaminateurs).

Chez une personne ne présentant aucun signe clinique, la positivité d’un test PCR n’indique absolument pas qu’elle est malade, ni qu’elle le deviendra, ni qu’elle est porteuse de virus, ni qu’elle peut le transmettre.

Ces constatations ont initialement été faites sur 3790 cas positifs.[6]

Leur confirmation définitive en a été réalisée lors du dépistage colossal (10 millions de personnes testées) autour de Wuhan[7] où aucun des 300 asymptomatiques positifs en PCR ne s’est révélé porteur de virus, ni contaminant, ni atteint par la maladie après un mois de surveillance.

Nous savons, ils savent, et nous savons qu’ils savent.[8]

Un document récent de la FDA admet enfin que le test PCR « Covid » a été développé sans échantillons viral spécifique isolé pour l’étalonnage des tests, admettant qu’il teste autre chose,[9] quelques séquences d’ARN insuffisamment spécifiques du virus

Le tristement célèbre test PCR pour le coronavirus (Covid-19) n’a pas été développé avec des échantillons réels, mais plutôt avec ce qui semble être du matériel génétique provenant d’un virus du rhume.

Dans le document de la FDA, il est clairement indiqué que le matériel génétique ordinaire de la grippe saisonnière a été utilisé comme marqueur de test dans les kits de test PCR.

Pourtant les autorités savaient que de nombreuses personnes seraient testées « positives », leur permettant ainsi d’utiliser ces résultats pour créer le récit « Covid ».

Il n’existe aucun test légitime permettant d’identifier avec précision la présence du SRAS-CoV-2.

Une autre révélation dans le document récent est l’admission par la FDA que les résultats des tests sont « regroupés » et donc produisent des chiffres inexacts. La FDA fabrique littéralement des données pour soutenir un faux récit.

AINSI : « nous sommes maintenant à la croisée des chemins dans le monde entier. Le moment est à nous de décider si nous allons permettre à ce type de fascisme médical de persister et d’avoir un impact sur l’avenir de nos enfants. Ou si nous allons enfin dire non à la politique tyrannique du gouvernement. »[10]

Extraits choisis du document de la FDA de janvier 2020 et revu régulièrement (dernier en juillet 2021)

« Since no quantified virus isolates of the 2019-nCoV were available for CDC use at the time the test was developed and this study conducted, assays designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA (N gene; GenBank accession : MN908947.2)

« Étant donné qu’aucun isolat de virus quantifié du 2019-nCoV n’était disponible pour une utilisation par les CDC au moment où le test a été développé et que cette étude a été menée, des tests conçus pour la détection de l’ARN 2019-nCoV ont été testés avec des stocks caractérisés d’ARN transcrit in vitro sur toute la longueur (gène N ; Accession GenBank : MN908947.2) de titre connu (copies d’ARN/μL) enrichi en un diluant constitué d’une suspension de cellules A549 humaines et d’un milieu de transport viral (VTM) pour imiter l’échantillon clinique.[11]

CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel[12]

« Les résultats concernent l’identification de l’ARN du SRAS-CoV-2.

L’ARN du SRAS-CoV-2 est généralement détectable dans les échantillons des voies respiratoires supérieures et inférieures pendant l’infection. Les résultats positifs sont révélateurs d’une infection active par le SRAS-CoV-2, mais n’excluent pas une infection bactérienne ou une co-infection par d’autres virus. L’agent détecté peut ne pas être la cause définitive de la maladie. Les laboratoires aux États-Unis et dans leurs territoires sont tenus de rapporter tous les résultats aux autorités de santé publique compétentes.

Les résultats négatifs n’excluent pas l’infection par le SRAS-CoV-2 et ne doivent pas être utilisés comme seule base pour le traitement ou d’autres décisions de prise en charge des patients. Les résultats négatifs doivent être combinés avec des observations cliniques, des antécédents du patient et des informations épidémiologiques. »

Autre extrait :

“NE PAS JETER : Informations importantes spécifiques au produit *** LIMITATIONS Ce test n’a pas été approuvé par la FDA. Ce test a été autorisé par la FDA en vertu d’une EUA pour une utilisation par des laboratoires autorisés. Ce test n’a été autorisé que pour la détection de l’acide nucléique à partir du 2019-nCoV, et non pour d’autres virus ou agents pathogènes.

Ce test n’est autorisé que pour la durée de la déclaration selon laquelle il existe des circonstances justifiant l’autorisation de l’utilisation d’urgence de diagnostics in vitro pour la détection et/ou le diagnostic du SARS-CoV-2 en vertu de l’article 564(b)(1) de la Federal Food, Drug, and Cosmetic Act, 21 U.S.C. § 360bbb-3(b)(1), à moins que l’autorisation ne soit résiliée ou révoquée plus tôt.”

“Mea Culpa de l’OMS”

L’OMS en avril 2021 avait attiré l’attention de l’invalidité de trop des tests PCR surtout lorsque les laboratoires utilisent fallacieusement des amplifications du signal trop élevées. Aucun compte n’a été tenu de cette mise en garde, du moins dans la plupart des labos français.[13]

Vous trouverez ci-dessous la ‘rétractation’ soigneusement formulée par l’OMS. Le texte intégral avec le lien vers le document original est en annexe« [14]

“Le document d’orientation de l’OMS sur les Tests diagnostiques pour le dépistage du SARS-CoV-2 souligne que les résultats faiblement positifs doivent être interprétés avec prudence.

La valeur de cycle seuil (Ct) nécessaire pour détecter le virus est inversement proportionnelle à la charge virale du patient. Lorsque les résultats du test ne correspondent pas au tableau clinique, il convient de prélever un nouvel échantillon et de répéter le test en utilisant une méthode d’amplification des acides nucléiques identique ou différente.

L’OMS rappelle aux utilisateurs de DIV[15] que la prévalence d’une maladie altère la valeur prédictive des résultats de test ; à mesure que la prévalence diminue, le risque de faux positifs augmente.

Cela signifie que la probabilité qu’une personne ayant obtenu un résultat positif (SARS-CoV-2 détecté) soit réellement infectée par le SARS-CoV-2 diminue à mesure que la prévalence diminue, quelle que soit la spécificité déclarée du test. (emphase ajoutée par l’auteur).”

Estimations erronées 

Ce n’est pas une question de “faibles positifs” ou de “risque de faux positifs”. L’enjeu relève au point de départ en janvier 2020 de la mise en application par l’OMS d’une méthodologie trompeuse et erronée qui conduit à des estimations qui n’ont aucune base scientifique. 

Ce que cette déclaration contradictoire de l’OMS confirme, c’est que l’estimation du Covid positif à partir d’un test PCR (avec un seuil d’amplification de 35 cycles ou plus) est tout simplement invalide. Dans ce cas, l’OMS recommande de répéter le test PCR :

il convient de prélever un nouvel échantillon et de répéter le test…”.

“Retester, On s’est trompé…”. Cette recommandation de RÉPÉTER LE TEST n’a aucun sens. C’est une impossibilité. Des millions de personnes dans le monde entier ont déjà été testées, à partir du début février 2020. Il s’agit néanmoins de conclure que la recommandation contradictoire de l’OMS de “retester” confirme sans équivoque QUE CES ESTIMATIONS PCR RELATIVES À LA Covid SONT TOUT SIMPLEMENT ERRONÉES.[16]

Au point de départ en janvier 2020, le test PCR fut (de manière routinière) appliqué à un seuil d’amplification Ct de 35 ou plus, conformément aux recommandations de l’OMS. Cela signifie que la méthodologie PCR appliquée dans 193 pays membres des Nations Unies a mené au cours des 12 à 14 derniers mois à la compilation de statistiques Covid surestimées et trompeuses.

Et ce sont ces statistiques (erronées) qui servent à mesurer l’évolution de ladite “pandémie”.

Au-dessus d’un cycle d’amplification de 35 ou plus, le test ne détectera pas spécifiquement les segments du virus . Par conséquent, ces chiffres n’ont aucun sens.

Il s’ensuit qu’il n’y a aucune base scientifique pour confirmer l’existence d’une pandémie.

Ce qui signifie également que le verrouillage (confinement) ainsi que les mesures économiques qui ont entraîné la panique sociale, l’accroissement extrême de la pauvreté et le chômage (dont l’objectif annoncé par les gouvernements était de freiner la propagation du virus) n’ont aucune justification ».

Par ailleurs d’autres scandales éclatent par rapport au test PCR[17]

La US Food and Drug Administration a émis « le type de rappel le plus sérieux » pour des kits de test à domicile populaires qui indiquent si une personne est infectée par le coronavirus. Au moins 2,2 millions de produits pourraient avoir donné de faux positifs.

Quelques 2 212 335 kits produits par la société de biotechnologie Ellume, basée en Australie, et distribués aux États-Unis, présentent potentiellement des résultats faussement positifs au test de dépistage du SARS-CoV-2, a indiqué l’agence de santé publique dans un communiqué récent en novembre 21.

La FDA a averti que l’utilisation de kits défectueux « peut entraîner de graves conséquences néfastes pour la santé ou la mort », qualifiant le cas de « rappel de classe I ».

En conclusion, la confirmation que les tests PCR ne sont pas fiables et ne devraient en aucun cas être utilisés par les gouvernements comme preuve de la « pandémie » vient de la FDA elle-même.

Il est grand temps que nos dirigeants reviennent aux moyens classiques d’évaluer les épidémies : 

le comptage des malades et celui des morts de la maladie.

Notes :

[1] Vers le faire-part de décès des tests PCR (francesoir.fr)

[2] La grande supercherie des tests PCR, 90 % des cas positifs ne sont pas malades ni contagieux (francesoir.fr)

[3] *Elena Surkova, Vladyslav Nikolayevskyy, Francis Drobniewsk

False-positive Covid-19 results: hidden problems and costshttp://www.thelancet.com/respiratory Vol 8 December 2020

[4] https://latribunedissidente.over-blog.com/2020/10/la-pertinence-des-tests-pcr-dr-pascal-sacre.html

[5] Covid : La PCR nasale peut-elle mentir ? Dr Pascal Sacré, AIMSIB, 30 août 2020

[6] Rita Jaafar Corrélation entre 3790 échantillons positifs de réaction en chaîne de polymérase quantitative et cultures de cellules positives, y compris 1941 isolats de coronavirus 2 du syndrome respiratoire aigu sévère Maladies infectieuses cliniques, 28/9/2020 ciaa1491,

https://doi.org/10.1093/cid/ciaa1491

[7] France info avec AFP : Après avoir mobilisé plus de 28 000 soignants sur plus de 2 800 sites, les autorités de Wuhan (Chine) ont réalisé la plus vaste opération de dépistage du Covid-19 chez onze millions d’habitants pour un prix de 127 millions de dollars lundi 9 août 2020…

[8] L’archipel du goulag, Soljenitsyne

[9] https://www.fda.gov/media/134922/downloadwww.fda.gov

[10] https://rightsfreedoms.wordpress.com/2021/10/27/fda-document-admits-Covid-pcr-test-was-developed-without-isolated-samples-for-test-calibration-e

[11] https://www.fda.gov/media/134922/downloadwww.fda.gov

[12] Centers for Disease Control and Prevention Division of Viral Diseases 1600 Clifton Rd NE Atlanta GA 30329 CDC-006-00019, Revision: 07 CDC/DDID/NCIRD/ Division of Viral Diseases Effective: 07/21/2021

[13] L’OMS confirme que le test Covid-19 PCR est invalide, les estimations des « cas positifs » sont sans fondement. Le confinement n’a aucune base scientifique. | Mondialisation — Centre de Recherche sur la Mondialisation

[14] WHO Information Notice for Users 2020/05

[15] Diagnostic in vitro

[16] Le Pr Prof Michel Chossudovsky mentionne qu’il existe plusieurs autres défauts concernant le test PCR qui ne sont pas abordés dans cet article. (Voir le livre électronique de Michel Chossudovsky :

The 2020 Worldwide Corona Crisis: Destroying Civil Society, Engineered Economic Depression, Global Coup d’État and the Great Reset(Chapitre II).

[17] FDA recalls millions of Covid test kit over false results – Asume Tech 11 Nov 21

= = =

Lire notre page “Coronavirus, guerre contre l’humanité” et y voir les articles répertoriés vers le bas de page remontant à novembre 2020 et mars 2021 sur la fraude des “tests” PCR

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

poster3

resistance1

desobeissance-civile

Novembre 2021 : Petit bilan de l’escroquerie COVID19 et du crime contre l’humanité que constitue sa gestion par une clique de psychopathes dictatoriaux (Résistance 71)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 15 novembre 2021 by Résistance 71

BigPharma_credo

Résistance 71

15 novembre 2021

Que savons-nous en bref de cette affaire de « pandémie COVID » débutée en février 2020 (sources sur notre page spéciale dont le lien est sous le texte):

  • Que le virus SRAS-CoV-2 a été créé en laboratoire et lâché dans la nature
  • Que les chiffres concernant les hospitalisations et la mortalité dans le monde ont été surgonflés à dessein depuis le départ
  • Que les « tests » RT-PCR sont une vaste fumisterie et ne peuvent pas détecter le virus, encore moins la charge virale des patients, surtout à des niveaux de cycles de reproduction > 20. La plupart des pays testant à Ct 35 ou 40, le résultat donnant de l’ordre de 97% de faux-positifs, ce qui est parfait pour générer la peur voulue
  • Que des traitements efficaces de la maladie avec des médicaments déjà existant et peu coûteux (Ivermectine, Hydroxychloroquine etc…) ont été supprimés et interdits afin de pousser à une utilisation d’urgence de soi-disants « vaccins » non testés et à technologie ARNm jamais utilisée chez l’humain
  • Que les mesures de confinement de populations saines sont en contradiction totale avec toute la littérature médicale épidémique depuis des siècles
  • Que le ciblage des enfants est une absurdité, ceux-ci n’étant pas vecteurs de la maladie
  • Que le port du masque en extérieur ne sert à rien
  • Que les masques commercialisés n’empêchent pas la pénétration d’un virus bien plus petit que le maillage filtre du masque
  • Que les « vaccins » n’en sont pas. Qu’ils sont des injections à ARNm, des manipulations génétiques faisant produire la « spike protéine » du virus SRAS-CoV-2 aux cellules du corps pour un laps de temps indéfini. Que ces « vaccins » n’auront fini la phase de test qu’en 2023, ce qui veut dire que tous les injectes sont des cobayes humains à l’échelle planétaire (dans le meilleur des cas…) sans le savoir
  • Que les injections OGM sont chargées de nanoparticules lipidiques qui diffusent le code de reproduction de la « spike protéine » dans tout le corps et provoquent des effets secondaires désastreux (caillots sanguins / thromboses, micro-thromboses, thromboses symptômatiques, myocardites et péricardites chez les jeunes injectés de moins de 30 ans, maladies auto-immunes diverses, réactions anaphylactiques, réactions neuro-musculaires et autres syndromes affiliées)
  • Que ces injections OGM sont plus que vraisemblablement responsables de la mutation rapide du virus
  • Que dans bien des pays maintenant, la très vaste majorité des personnes hospitalisées en lien avec le COVID sont des double ou triple injectées sujets à des réactions adverses plus ou moins graves, certaines ayant entraînées la mort, d’autres l’hospitalisation des sujets test
  • Que les statistiques depuis le début de la « pandémie » ont été falsifiées
  • Que les chiffres sortent maintenant, donnant pour la France par exemple un taux de 2% des gens hospitalisés en France en 2020 pour des raisons liées au COVID, alors que médias et gouvernement abreuvaient la population de chiffres falsifiés à des fins anxiogènes pour justifier des mesures « sanitaires » dictatoriales mises en place
  • Que les mesures sanitaires prises en 2020 et 2021 ne le furent pas sur des bases scientifiques ou médicales mais ne furent que des décisions POLITIQUES ayant un agenda bien particulier dans les domaines politique, économique et social
  • Que les mesures « vaccinales » sont des mesures abusives, coercitives sans aucun fondement scientifique
  • Que l’OMS change constamment les définitions de termes comme « épidémie », « pandémie », « vaccins », « immunité naturelle », afin de faire passer le non-sens total de décisions et de mesures abusives prises à l’échelle planétaire
  • Rajouter à cette liste ce qui vous semble pertinent, celle-ci n’étant en rien exhaustive…

Que faire donc ?

Arrêtons de nous laisser diviser. Unissons-nous dans le boycott de toutes les mesures dictatoriales sanitaires qui sont en train de verrouiller sur nous la grille de contrôle de la dictature technotronique du Nouvel Ordre Mondial / Grande Réinitialisation pondue par le FEM de Davos, outil du système étatico-capitaliste.
Il suffit de dire NON ! Ensemble et de nous unir dans la formation des associations libres.

BOYCOTT des mesures sanitaires, BOYCOTT du « passe sanitaire », BOYCOTT de toute dose d’injection transgénique et de pseudo-vaccins non testés, à ARNm ou pas. BOYCOTT des institutions et du vote.

CREATION des associations libres confédérées reprenant en main les affaires politiques de nos communautés et DETERMINATION de défendre le nouveau paradigme politique de réflexion et d’action ainsi créé, par tous les moyens envisageables…
COMPREHENSION qu’il n’y a pas de solution au sein du système et qu’il ne saurait y en avoir, cette crise fabriquée du COVID19 en est une autre preuve s’il en fallait encore une.

A lire :

Notre page « Coronavirus, guerre contre l’humanité »

Notre article de septembre 2021 : « Fraude et crime CIVID en bande organisée : résumé et perspectives hors système »

Nos articles de juillet 2020 : « Le masque, rituel de la soumission » et sa suite

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

resistance1

poster4

La saga de Bébert Corona : un coup j’te vois, un coup j’te vois pas…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, désinformation, guerres hégémoniques, média et propagande, militantisme alternatif, pédagogie libération, police politique et totalitarisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , on 18 octobre 2021 by Résistance 71

xenomorph_velo
Il est parti par-là… sur un vélo orange !

Entretien des plus intéressants qui ne peut que titiller l’attention et les méninges. A quel niveau de mensonge sommes-nous soumis et évoluons-nous au fil du temps ? Nous avons été confronté depuis un an à des personnes disant que le virus n’existait pas et n’avait jamais été isolé chez des patients. A cela venaient répondre les recherches entre autres, de l’IHU de Marseille et du service du Pr. Raoult faisant état de milliers de séquences génétiques étudiées depuis des souches de patients locaux. Les Chinois disent aussi avoir séquencé le SRAS-CoV-2 à Wuhan dès le début 2020. Le Pr. Montagnier affirme depuis plus d’un an que le code génétique du virus chimérique SRAS-CoV-2 contient des séquences du parasite du paludisme et du virus VIH, de là peut-on rebondir sur la question : Le virus VIH a t’il été isolé chez des patients ?… La polémique existe toujours.
Où est la vérité ? Pour la connaître, il faudrait que la science sorte de l’emprise et de l’assujettissement au fric et au pouvoir qui la contraignent depuis des lustres. Quand on voit le flot de mensonges dont le public est abreuvé par les instances tant politiques que scientifiques depuis le début de cette crise, entre autre, l’article / entretien ci-dessous ne peut que nous interpeler, nous faire dresser l’oreille et nous faire poser une fois de plus certaines questions fondamentales dont celle-ci qui est essentielle à notre sens : à quoi, dans notre monde de la pourriture de dégénérescence étatico-capitaliste, tient le simple fait de “l’existence” ? Une question bien plus profonde qu’elle n’en a l’air…
~ Résistance 71 ~

CoVStEx

Le virus inexistant : une interview explosive avec Christine Massey

Christine Massey avec Jon Rappoport

15 octobre 2021

url de l’article en français :
https://www.mondialisation.ca/le-virus-inexistant-une-interview-explosive-de-christine-massey/5661427

Avec une formation en biostatistique, Christine Massey a utilisé les demandes de liberté d’information (FOIA) comme un outil de recherche, comme une fraise à diamant, pour découvrir la vérité sur le SARS-CoV-2. C’est-à-dire : Le virus existe-t-il ?

Son approche a donné des résultats choquants.

Dans un monde à moitié sain d’esprit, le travail de Christine remporterait de nombreux prix et bénéficierait d’une large couverture médiatique. Dans le monde actuel, de plus en plus de personnes, de leur propre chef, s’éveillent à ses découvertes et révisent complètement leur perception de la “pandémie”.

Voici mon récent entretien avec la brillante et implacable Christine Massey :

Q : Vous et vos collègues avez adressé de nombreuses demandes de communication d’informations aux agences de santé publique du monde entier. Vous avez demandé des documents qui montrent que le virus SARS-CoV-2 existe. Comment avez-vous développé cette approche ?

R : En 2014, une dame d’Edmonton a soumis une demande de liberté d’information à Santé Canada, demandant des études relatives à l’ajout d’acide hydrofluorosilisique (acide fluorure résiduel industriel) à l’eau potable publique (fluoration de l’eau). La réponse de Santé Canada indiquait qu’elle ne disposait d’aucune étude pour étayer ses affirmations selon lesquelles cette pratique est sûre ou efficace.

Quelques années plus tard, des études de grande qualité financées par le gouvernement ont montré que les niveaux courants d’exposition au fluorure pendant la grossesse sont associés à un QI inférieur et à des symptômes accrus de trouble du déficit de l’attention chez les enfants. Néanmoins, les dentistes et la communauté de la santé publique ont continué à promouvoir et à défendre la soi-disant “grande réussite de santé publique” consistant à imposer ce traitement dentaire préventif controversé à des communautés entières, et ont fait fi de ces études. J’ai donc eu recours à des demandes de liberté d’information pour montrer que diverses institutions promouvant et défendant la fluoration de l’eau en Ontario, en Alberta et dans l’État de Washington n’ont pas pu fournir ou citer ne serait-ce qu’une seule étude primaire indiquant l’innocuité de ces résultats.

Ainsi, lorsque j’ai appris de la part de personnes comme David Crowe, le Dr Andrew Kaufman, le Dr Stefan Lanka et le Dr Thomas Cowan que le prétendu virus [Coronavirus] n’avait jamais été isolé (purifié) à partir d’un échantillon de patient, puis caractérisé, séquencé et étudié au moyen d’expériences comparatives, et que son existence n’avait donc jamais été démontrée, j’ai réalisé que les demandes de liberté d’information pouvaient être utilisées pour vérifier leurs affirmations.

La plupart des gens ne vont pas prendre le temps de vérifier toutes les études sur la soi-disant “isolation du virus” par eux-mêmes, donc les demandes de liberté d’information étaient un moyen de 1) s’assurer que rien n’avait été oublié, et 2) d’aller droit au but et de confirmer ce que ces messieurs [Kaufman, Cowan, Crowe, Lanka] disaient, s’ils étaient effectivement corrects.

Ainsi, en mai 2020, j’ai commencé à soumettre des demandes d’accès à l’information pour tout document détenu par l’institution concernée décrivant l’isolement/la purification du prétendu “virus du COVID-19” à partir d’un échantillon non altéré prélevé sur un patient malade, par quiconque, n’importe où sur la planète.

Q : Combien d’agences de santé publique et d’agences gouvernementales avez-vous interrogées dans le cadre de demandes FOIA ?

R : J’ai personnellement posé des questions et reçu des réponses de 22 institutions canadiennes. Il s’agit d’institutions de santé publique, d’universités qui prétendent avoir “isolé le virus”, et de 3 services de police – en raison de leur application des restrictions liées au “COVID-19”. J’ai également reçu personnellement des réponses de plusieurs institutions à l’extérieur du Canada, y compris les Centres américains de contrôle et de prévention des maladies et le National Institute of Allergy and Infectious Diseases (NIAID) d’Anthony Fauci. J’attends les réponses d’un certain nombre d’autres institutions.

De nombreuses personnes à travers le monde ont obtenu des réponses à des demandes identiques, similaires ou connexes de la part d’institutions de leur propre pays. Une personne qui a beaucoup travaillé sur ce sujet en Nouvelle-Zélande et dans d’autres pays est mon collègue Michael S. Un collègue nommé Marc Horn a également obtenu de nombreuses réponses au Royaume-Uni. Une poignée d’autres personnes ont obtenu plusieurs réponses, et beaucoup de gens en ont obtenu une ou deux.

J’ai compilé toutes les réponses qui m’ont été envoyées sur ma page FOI[archive cv19], et au moment où je tape ces lignes (4 octobre 2021), nous avons des réponses FOI de 104 institutions dans plus de 20 pays, toutes relatives à la purification/existence du prétendu virus. En outre, il y a des documents judiciaires d’Afrique du Sud et du Portugal. Au total, 110 instructions sont représentées en ce moment sur mon site web. Il y a des réponses FOI d’autres institutions que je n’ai pas encore eu l’occasion de mettre en ligne.

Q : Comment qualifieriez-vous les réponses que vous avez reçues de ces agences ?

R : Toutes les institutions sans exception ont omis de fournir ou de citer ne serait-ce qu’un seul document décrivant la purification du prétendu virus à partir d’un seul échantillon de patient.

Vingt et un des 22 établissements canadiens ont admis sans détour qu’ils ne possédaient pas de tels documents (comme l’exige la législation canadienne). De nombreuses institutions à l’extérieur du Canada ont admis la même chose, y compris le CDC (2 novembre 2020), le ministère de la Santé de l’Australie, le ministère de la Santé de la Nouvelle-Zélande, le ministère de la Santé et des Soins sociaux du Royaume-Uni…

Et dans certains cas, des excuses stupides ont été fournies. Par exemple, la réponse de la Direction norvégienne de la santé a été qu’elle ne possède pas, ne stocke pas et ne contrôle pas les documents contenant des informations sur les patients. La Direction de la santé publique du Pays de Galles a répondu au Dr Janet Menage qu’elle n’avait pas produit de tels documents et que, même si elle était normalement disposée à l’orienter vers des documents relevant du domaine public, ce serait trop difficile dans ce cas.

L’agence brésilienne de réglementation de la santé (Anvisa), qui approuve les injections à la manière de la FDA, a déclaré à Marcella Picone qu’elle ne disposait d’aucun dossier sur la purification du virus et qu’elle n’y était pas tenue par la loi, de sorte qu’il n’est pas de son ressort de s’assurer que le virus existe réellement.

Q : Quel est le texte exact de vos demandes FOIA ?

Le texte a quelque peu varié au fil du temps. Par exemple, au début, j’utilisais le mot “isolation”. Mais comme ce terme est tellement galvaudé par les virologues, je m’en tiens maintenant à “purification”.

Dans toutes mes demandes, j’ai spécifié exactement ce que j’entendais par “isolement/purification” (séparation du prétendu virus de tout le reste), et que les particules purifiées devaient provenir directement d’un échantillon prélevé sur un être humain malade, l’échantillon du patient n’ayant pas été préalablement altéré par une autre source de matériel génétique (c’est-à-dire les cellules rénales de singe, alias cellules Vero, et le sérum bovin fœtal qui sont généralement utilisés dans les études bidon d’”isolement de virus”).

J’ai toujours précisé que je ne demandais pas de dossiers où les chercheurs n’ont pas purifié le prétendu virus et ont plutôt cultivé quelque chose et/ou effectué un test PCR et/ou séquencé quelque chose. J’ai également précisé que je demandais des documents rédigés par n’importe qui, n’importe où – et pas seulement des documents créés par l’institution en question. Et j’ai demandé des citations pour tout document de purification détenu par l’institution mais déjà disponible au public ailleurs.

La dernière itération [de la demande FOIA] est publiée sur une page de mon site Web où j’encourage les autres à soumettre des demandes aux institutions de leur propre pays : Template for “SARS-COV-2 isolation” FOI requests.

Q : Ces agences disent toutes qu’elles n’ont pas de dossiers prouvant l’existence du SARS-CoV-2, mais en même temps, certaines de ces agences parrainent et financent des études qui affirment que le virus existe. Comment expliquez-vous cette contradiction ?

Je vais aborder cette question à l’aide d’un exemple.

L’Agence de la santé publique du Canada (ASPC) est la seule institution canadienne qui n’a pas fourni de réponse directe ” aucun dossier ” jusqu’à présent. Au lieu de cela, elle m’a fourni ce qu’elle prétendait être des documents recevables.

Il s’agit de quelques courriels et d’une étude de Bullard et al. qui a été soutenue par l’ASPC et son Laboratoire national de microbiologie, ainsi que par Santé Manitoba et le Laboratoire provincial Cadham du Manitoba.

Ni l’étude ni les courriels ne décrivent la purification du prétendu virus à partir d’un échantillon de patient ou de quoi que ce soit d’autre. Le mot “isoler” (ou “isolation” / “purifier” / “purification”) n’apparaît même pas, sauf dans le manuscrit de l’étude dans le contexte de l’isolement de personnes, pas d’un virus.

…dans la section Matériaux et méthodes, nous constatons que ces chercheurs ont effectué des “tests” PCR pour une partie de la séquence du gène E (pas un virus), et qu’ils ont incubé des échantillons de patients (pas un virus) sur des cellules Vero (cellules rénales de singe) supplémentées avec du sérum bovin fœtal, de la pénicilline/streptomycine et de l’amphotéricine B, et qu’ils ont surveillé les dommages causés aux cellules de singe.

Aucun virus n’a été recherché ou purifié dans les échantillons des patients. Aucun groupe de comparaison, de quelque nature que ce soit, n’a été mis en place dans les procédures relatives aux cellules de singe. Aucun virus n’a été requis ou démontré comme étant impliqué dans l’étude, mais “il” a été accusé de tout dommage aux cellules de singe et “il” a été mentionné à plusieurs reprises tout au long de l’étude (j’ai compté 26 occurrences).

Néanmoins, il s’agissait du seul document fourni par l’Agence de santé publique du Canada.

Et bien que les chercheurs n’aient pas prétendu avoir “isolé” le prétendu virus dans cet article, ils ont effectué le même genre de procédure de culture cellulaire et de travaux sur les singes que les virologues de tous les pays font passer pour un “isolement du virus”. (Parce que la virologie n’est pas une science).

…Notez l’admission dans le résumé [de l’étude] : “La RT-PCR détecte l’ARN, pas le virus infectieux”.

…J’ai donc écrit à l’Agence de la santé publique du Canada pour l’informer qu’aucun des documents qu’elle m’a fournis ne décrit réellement la séparation du prétendu virus de tout le reste dans un échantillon de patient, et que j’exige une réponse précise indiquant qu’elle n’a aucun document à ce sujet.

Dans sa réponse révisée, l’Agence a insisté sur le fait que l’essai de référence utilisé pour déterminer la présence d’un virus intact dans les échantillons de patients est l’effet cytopathique visible [destruction des cellules] sur les cellules dans une culture cellulaire, et que “la PCR confirme en outre la présence d’un virus intact”.

…Comme vous l’avez souligné à vos lecteurs à maintes reprises : Personne n’a isolé/purifié “le virus”. Ils supposent simplement que les échantillons de patients le contiennent (sur la base de tests PCR sans signification). Ils falsifient les échantillons de patients avec du matériel génétique et des médicaments toxiques, affament les cellules, puis accusent de manière irrationnelle le “virus” de nuire aux cellules. Ils montrent du doigt quelque chose qui n’a jamais été purifié, caractérisé, séquencé ou étudié scientifiquement, dans une culture cellulaire et insistent sur le fait que “c’est le virus”. Ils fabriquent les “génomes” à partir de zillions de séquences détectées dans une soupe. Ce ne sont que des spéculations et des hypothèses sauvages, aucune science.

Les personnes responsables des affirmations manifestement frauduleuses faites par ces institutions sont donc soit extrêmement incompétentes, soit intentionnellement menteuses.

-fin de l’interview-

***

Pour soutenir les derniers commentaires de Christine, ces agences répondront aux demandes de FOIA par : “nous n’avons pas de dossiers sur la purification du virus” – et parraineront ensuite des études qui prétendent que le virus A ÉTÉ purifié et découvert, parce que…

Les normes de purification du virus dans les études ne sont pas des normes du tout. Elles sont totalement irrationnelles.

Cependant, parce que Christine est très précise et exacte dans ses demandes FOIA, quand il s’agit de ce que signifie la purification, les agences sont obligées de répondre …

“Eh bien, dans ce cas, nous n’avons aucune trace de purification du virus…”

Ce qui veut dire : Il n’y a pas de documents montrant que le virus a été isolé ; il n’y a pas de documents montrant que le virus existe.

***

Lire notre page : « Coronavirus, guerre contre l’humanité »

science_cauchemar

CoV2
Bouh !… Le vilain Bébert…

COVIDLAND : le documentaire en 5 parties sur l’escroquerie planétaire de la crise fabriquée de toute pièce du SRAS-CoV-2 ~ 1ère partie : le confinement ~ (Vidéo)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologie, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , on 10 octobre 2021 by Résistance 71

covidland_le confinement

Résistance 71

10 octobre 2021

Voici la première partie d’un documentaire en 5 parties réalisé par l’équipe d’InfoWars et Alex Jones : COVIDLAND: le confinement

1,8 millions de vues en à peine 48 heures. Durée: 1h48
Nous l’avons visionné, si nous n’avons rien appris d’essentiel que nous ne savions déjà, ce documentaire  est très bien réalisé avec des intervenants de qualité.
Nous espérons, qu’il sera sous-titré en français au plus tôt et diffusé au grand large de la francophonie.
Il en vaut la peine. Pour ceux qui comprennent l’anglais…

Le documentaire en anglais:

https://freeworldnews.tv/watch?id=615f96b3aa816336dbd21792

La seconde partie concernera les masques, à suivre donc…

A lire, notre page « Coronavirus, guerre contre l’humanité »

con-plot-iste-rien

Dictature sanitaire en marche : Non au traçage, aux injections géniques et aux centres de rétention pseudo-sanitaires ! Il suffit de dire NON ! Ensemble !

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, militantisme alternatif, neoliberalisme et fascisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , on 21 juin 2021 by Résistance 71

 

 

xenomorph_velo
Dictature sanitaire: ça roule !…

 

Les infos présentées ci-dessous ratissent large et ne représentent pas forcément les vues de R71, comme par exemple l’opinion présenté que les variants COVID seraient faux, imaginaires. Nous pensons qu’ils sont réels, ils ont été génétiquement séquencés notamment à l’IHU de Marseille par l’équipe du Pr. Raoult depuis plus d’un an. 

Nous attirons toujours l’attention sur le fait que s’il est bien entendu important de développer sa connaissance critique sur ce qui se passe, il ne faut pas perdre de vue les solutions à y apporter, tout en gardant présent à l’esprit qu’il n’y a pas de solution au sein du système et qu’il ne saurait y en avoir. Nous, les peuples, devons reprendre ce qui nous a été retiré depuis quelques 5000 ans : le pouvoir, c’est à dire la capacité de prendre les décisions par et pour nous-mêmes. Là réside toute la clef des affaires politico-économico-sociales de ce monde. Il suffit de dire NON ! à ce ramassis de baltringues criminels soi-disant en charge par notre délégation “volontaire” et de reprendre en compte le décisionnaire afin d’œuvrer, enfin, pour le bien commun sur cette planète.

Dans cette optique :

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

-[]-[]-[]-[]-[]-

Le billet du jour…

Non au traçage et retro-traçage ! Le but : piqouzer 70% de la population française d’ici fin juillet en raflant les faux positifs sur la base de tests PCR 100% faux. La marche en avant des centres de rétention COVID sous la menace de pertes civiques

Anonyme

21 juin 2021

Leur faux vaccin une arme biologique 

https://olivierdemeulenaere.wordpress.com/2021/06/18/premier-cas-detude-post-mortem-dun-patient-vaccine-contre-le-covid-19-arn-viral-trouve-dans-chaque-organe-du-corps/

https://olivierdemeulenaere.wordpress.com/2021/06/17/vaccinobide-belge-une-maison-de-retraite-decimee/

https://resistance71.wordpress.com/2021/05/11/therapies-geniques-la-spike-proteine-du-sras-cov-2-repliquee-par-larnm-des-pseudo-vaccins-est-mortifere/

https://jbl1960blog.files.wordpress.com/2021/06/dossier-pour-dire-non-a-linjection-transgenique-experimentale-jbl1960-juin-2021.pdf

https://www.francesoir.fr/societe-sante/nous-avons-fait-une-erreur-la-proteine-spike-est-elle-meme-toxique-et-dangereuse-pour

avec immunité juridique pour les labos et médecins qui piqouzent

https://resistance71.wordpress.com/2021/05/30/lacademie-de-medecine-francaise-refuse-toute-responsabilite-dans-les-effets-nefastes-des-injections-geniques-anti-covid-en-violation-du-serment-dhippocrate-et-pousse-a-lobligation-vaccinale/

Tracer 7 jours de contacts de contacts de contacts de contacts de contacts de contacts  de contacts d’un faux positif => le principe de la proposition de la “vaccination en anneau”

Retro-tracer 10 jours de contacts de contact de contact de contacts de contacts de contacts de contacts de contacts de contacts de contacts d’un faux positif

https://olivierdemeulenaere.wordpress.com/2021/06/19/foutage-de-gueule-suite-le-retro-tracing-du-covide/#comment-186205

ils veulent accélérer leur programme de piqouze, vu qu’ils veulent injecter 70% des français adultes pour fin juillet

https://www.la-croix.com/Monde/70-dadultes-vaccines-Europe-dici-juillet-est-realisable-2021-04-24-1201152508

leur plan: donner des faux positifs de variants imaginaires à 70% des adultes français, pour les forcer à s’isoler dans les covid hotels remplis de militaires où ils pourront leur forcer  la piqouze à l’insu de tous, et ensuite faussement attribuer la mort au variant (parce que le type sera entré avec un faux test positif de variant), alors que ce sera la piqouze mortelle la responsable.

Il est urgent pour les français de traduire en justice ces tests PCR bidons 100% faux dès que possible, afin qu’ils arrêtent leur arnaque dont leur seul objectif c’est la rafle dans les camps de concentration ou covid hotels pour la piqouze et ceux qui refusent c’est coupure de leur carte bancaire et titre de transport voir plus encore

https://olivierdemeulenaere.wordpress.com/2021/06/11/covid-et-dictature-lincroyable-rapport-du-senat/

22 chercheurs et doctorants scientifiques: le test PCR est inutile à 100% pour détecter les virus

https://odysee.com/@delafaye-naturopathe:d/PCR-test-is-USELESS.:d

les avocats allemands pourchassent en justice le test PCR

https://odysee.com/@LugNassad:0/KLA.TV—Le-test-PCR-au-tribunal—les-avocats-poursuivent-en-justice-!:6

la fraude du test PCR en termes  simples

https://odysee.com/@danielpilonchroniqueur:1/la-fraude-du-test-pcr-en-termes-simples:4

le gouverneur de Floride demande une enquête sur l’arnaque des tests PCR :

https://odysee.com/@AlexJonesChannel:c/Florida-Governor-Demands-Full-Disclosure-in-Covid-Test-Fraud:0

Karry Mullis (inventeur du test PCR et prix Nobel de chimie) les tests PCR ne sont pas fait pour détecter des maladies

https://youtu.be/OK1-rgpu5cA

Mort suspecte de l’ inventeur du test PCR  » Kary Mullis  » . Test PCR qui a bien entendu multiplier le nombre de faux positif

https://odysee.com/@Alpha77:3/c55faa:c

avant sa mort (août 2019), Karry Mullis disait que Fauci (pantin de Bill Gates) était une fraude car voulait utiliser les tests PCR pour détecter les virus

https://odysee.com/@QuantumRhinoQ:c/Kary-Mullis_-PCR-Test-Inventor-Calls-Dr-Fauci-A-Fraud:3

NUREMBERG 2: Journalist to Hospital: You’re Committing Crimes Against Humanity With PCR Test Fraud

https://odysee.com/@TimTruth:b/Journalistcallshospitalnuremberg2-1:8

même l’eau est positive au covid avec l’arnaque des tests PCR

https://odysee.com/@ChangingTimes:4/PCR-TEST-FRAUD-EVEN-WATER-TESTED-POSITIVE-FOR-COVID:8

la papaye positive au test

https://odysee.com/@kikei:e/PCR-Dr-Alejandro-Souza-John-Magufuli-:d

Fauci l’avoue, les asymptômatiques ne donnent pas de virus

https://cdn.lbryplayer.xyz/api/v4/streams/free/4012/96d32b61989679965ed33eee9c2705c69812c028/b1fd72

https://odysee.com/@Abracadabra:3/En-aucun-cas-une-e%CC%81pide%CC%81mie-ne-peut-e%CC%82tre-provoque%CC%81e-par-une-personne-asymptomatique:a

les vaccins rendent symptomatiques…

https://odysee.com/@BobTremblay:6/3977:b

des médecins attestent que les tests PCR actuels sont 100% faux!

https://odysee.com/@LifeMoneyTech:5/Another-biggest-proof-Doctors-Explain-the-COVID-19-Models-Are-False-COVID-Tests-Are-Falsely-Calibrated-PLANDEMIC:7

Bientôt des cartes de transports ou des comptes bancaires bloqués en cas de 

Refus des tests PCR 100% bidons et de l’isolement dans les camps nazis de la piqouze forcé https://www.nexus.fr/actualite/news/cartes-comptes-bloques/

La Fraude des Tests RT PCR permet la mise en place de la Dictature Sanitaire – Version PDF N° 224 de 18 pages ► https://jbl1960blog.files.wordpress.com/2020/12/dossier-special-fraude-tests-rt-pcr.pdf

Morgellons sur les tests PCR c’est du faux coton tige

https://stoplinkyblc.blogspot.com/2021/04/qui-sont-ces-intrus-dans-les-masques-et.html

https://profidecatholica.com/2021/03/13/tests-experimentaux-sur-lhumanite-pass-sanitaire-medecine-genomique-video/

Deux présidents africains ont osé sortir leurs pays de l’OMS, critiquer l’arnaque des tests PCR, des masques, contre les faux vaccins. Et ils sont morts mystérieusement, remplacés par des pantins de Bill Gates

https://off-guardian.org/2020/07/14/coronavirus-and-regime-change-burundis-covid-coup/

https://reseauinternational.net/le-president-tanzanien-john-magufuli-a-t-il-ete-assassine-pour-avoir-denonce-la-pandemie-de-covid-19/

https://reseauinternational.net/le-defunt-president-tanzanien-magufuli-negationniste-de-la-science-ou-menace-pour-lempire/

PCR Fraud: Tests Recycled Into Lies

https://odysee.com/@DavidKnightShow:1/PCR-Fraud–Tests-Recycled-Into-Lies:a

BBC Undercover Reporter EXPOSES The PCR TEST FRAUD.

https://odysee.com/@Truthspreader:3/Alright-Then,-…—Look-At-The-Clouds—THIS-IS-FAIR-USE-UNDER-COPYRIGHT-RIGHT-LAW:3

une association québécoise a déjà commencé son procès contre le test PCR

https://www.cielvoile.fr/2021/06/debriefing-avec-l-avocat-quebecois-me-dominic-desjarlais.html

un tribunal portugais a déjà invalidé les tests PCR

https://cv19.fr/2020/11/21/un-tribunal-portugais-juge-que-les-tests-pcr-sont-peu-fiables-et-contraires-a-la-loi-pour-mettre-les-personnes-en-quarantaine/

en gros : « cas confirmé »= test bidon PCR faux positif

et « cas à risque »= cas contact d’un test bidon PCR faux positif

Bref tout cet arsenal big brother, liberticide à ondes cancérigènes dangereuses pour affaiblir des gens en bonne santé qui n’ont rien

Fuellmich dénonce l’arnaque des tests PCR qu’il va traduire en justice

https://textup.fr/553088Vs

https://rumble.com/vh9w9d-ils-vont-se-faire-coincer-les-uns-aprs-les-autres-.html

et qu’ils prennent responsabilités sur les dégâts sanitaires que leurs écouvillons font mais comme par hasard tout comme les labos des vaccins (qui font aussi les tests PCR)

les fabricants des tests PCR sont aussi protégés par l’immunité juridique pour pas qu’on puisse les pourchasser en justice quand on découvre que leurs tests PCR sont une fraude et peut causer des dommages sanitaires

https://www.phe.gov/emergency/events/COVID19/COVIDvaccinators/Pages/PREP-Act-Immunity-from-Liability-for-COVID-19-Vaccinators.aspx

Dommages sanitaires des écouvillons tests PCR:

-les tests PCR peuvent causer des méningites (mais nos renards le mettront sur le compte de covid et variants)

https://olivierdemeulenaere.wordpress.com/2021/04/10/tests-covid-des-lesions-peuvent-etre-a-lorigine-de-meningites-academie-de-medecine/

-les tests sont bidons et ne valent rien et sont contaminés tous

http://www.cielvoile.fr/2020/05/kits-de-tests-contamines-aux-etats-unis.

html

http://www.cielvoile.fr/2020/04/des-kits-de-test-destines-au-royaume-uni-contamines-au-covid-19.html http://www.cielvoile.fr/2020/05/kits-de-tests-contamines-au-canada.html,

https://www.ouest-france.fr/sante/virus/coronavirus/coronavirus-des-tests-de-depistage-commandes-par-le-royaume-uni-contamines-par-le-covid-19-6798277

https://ici.radio-canada.ca/nouvelle/1696091/test-depistage-ecouvillons-covid-19-contamines-chine-quebec

http://www.rfi.fr/fr/afrique/20200516-coronavirus-institut-pasteur-reconna%C3%AEt-dysfonctionnements-tests-analyse

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

Pourquoi? Parce qu’il y a des nanoparticules sur les tests PCR

et ces nanoparticules contiennent le covid lui même (ou variant)!

« Les chercheurs synthétisent des protéines de virus et les stockent dans des nanoparticules, qui sont délivrées plus efficacement en se fixant sur la muqueuse nasale. »

https://www.lesechos.fr/pme-regions/innovateurs/le-vaccin-anti-covid-par-voie-nasale-teste-par-biomap-1311266

https://odysee.com/@DentyAndShaz:8/COVID-PCR-Test-Swabs,-Metals-And-Ethylene-Oxide:1

https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

Maintenant on comprend pourquoi les fabricants de tests PCR ont l’immunité juridique

https://www.phe.gov/emergency/events/COVID19/COVIDvaccinators/Pages/PREP-Act-Immunity-from-Liability-for-COVID-19-Vaccinators.aspx

– les écouvillons peuvent être préalablement contaminés http://stoplinky28.blogg.org/test-covid-moyen-d-infecter-ou-d-inserer-un-implant-a199701306, permettant aux morgellons d’entrer dans le trou de la lame criblée, de se balader dans le cerveau et d’atteindre la glande pinéale, qui régule le sommeil, le système immunitaire et bien d’autres choses.

https://stoplinkyblc.blogspot.com/2021/04/qui-sont-ces-intrus-dans-les-masques-et.html

– N’oublions pas que les tests PCR, ce sont des écouvillons de 15 cm qui peuvent couper les nerfs olfactifs situés au fond de la fosse nasale, et ainsi causer la perte d’odorat et la reporter ensuite faussement sur le variant ou covid

source commentaires sous http://stoplinky28.blogg.org/confirmation-les-nanoparticules-migrent-vers-le-cerveau-a202369628

et une fois les nerfs olfactifs coupés, les trous qu’ils occupent dans la cavité nasale dans la lame criblée sont vides, et permet la fuite de liquide céphalo-rachidien vers le nez, comme cela été le cas pour une américaine ici https://www.lci.fr/sante/un-test-pcr-provoque-une-fuite-de-liquide-cephalo-rachidien-chez-une-americaine-2166157.html

– substances cancérigènes sur les tests PCR

https://odysee.com/@OurFreeSociety:2/PCR-Test—Ethylene-Oxide:e

https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

-nanoparticules et substance cancérigène ehtylène oxide sur les écouvillons

Metals And Ethylene Oxide

les dangers de ces nanoparticules dans le nez cités à partir de 2;37 de la vidéo

https://odysee.com/@DentyAndShaz:8/COVID-PCR-Test-Swabs,-Metals-And-Ethylene-Oxide:1

https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

les nanoparticules causent la perte d’odorat, et devinez, il y a des nanoparticules sur les écouvillons PCR selon une étude scientifique indépendante

https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

– ils vaccinent les gens aussi à travers le test, comme cela, ils attribueront la mort aux variants imaginaires révèle un docteur en Israel

https://odysee.com/@decentraleyes:2/Red-Alert!-Cows-Are-Vaccinated-With-a-Swab-in-the-Nose-%E2%80%93-Dr.:d

Cela explique les nanoparticules sur les tests PCR qui sont en réalité la vaccination

-l es tests PCR causent la perte d’odorat, car contiennent des nanoparticules la preuve des nanoparticules sur les tests PCR dans cette étude scientifique indépendante https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

– nanoparticules dans les tests PCR

https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

les nanoparticules aspirés par le nez vont vers le cerveau, aspirés par la bouche vont vers les poumons (nanoparticules dans les masques

https://www.inrs.fr/media.html?refINRS=NT 2

https://www.lelibrepenseur.org/covid-19-des-ong-alertent-leurope-sur-les-masques-contenant-du-graphene-nanoparticules/)

les nanoparticules abiment l’odorat selon une étude scientifique

 https://tsg-referendum.ch/fr/le-test-pcr-covid-19-une-dose-de-nanoparticules-pour-votre-cerveau/

les nanoparticules abiment les poumons selon une étude scientifique

http://stoplinky28.blogg.org/nanoparticules-attention-danger-a203100824 (mais cela on savait, puisque la pollution contenant des nanoparticules abiment les poumons)

– Si on dépose des nanoparticules sur les bouts du nerf olfactif, elles migreront directement dans les trous de la lame criblé séparant nez et cerveau pour aller dans le cerveau

http://stoplinky28.blogg.org/confirmation-les-nanoparticules-migrent-vers-le-cerveau-a202369628

-Un bébé meurt après avoir saigné du nez à la suite d’un test COVID-19 par écouvillonnage ; la mère porte plainte

court par Arshiya Chopra / 15:48 pm on 28 Aug 2020,Friday

Une femme a déposé une plainte contre les médecins de l’hôpital Tripura environ deux semaines après la mort de son bébé de trois jours, suite au prélèvement de ses échantillons pour le test COVID-19. Le bébé était en bonne santé jusqu’au prélèvement de ses échantillons par écouvillonnage, à la suite de quoi son nez a commencé à saigner, selon la plainte.https://inshorts.com/en/news/baby-dies-after-nose-bleed-following-covid19-swab-test-mother-files-complaint-1598609886138 (article à enregistrer avant censure)

-un test covid cause la mort d’un enfant, l’écouvillon de 15 cm a causé une hémorragie fatale dans la profondeur du nez

https://english.alarabiya.net/en/coronavirus/2020/07/15/Coronavirus-Saudi-child-dies-due-to-a-COVID-19-test-swab-breaking-in-his-nose (article à enregistrer avant censure)

« Un enfant saoudien d’un an et demi est mort lors d’un test PCR à cause de la tige  qui s’est brisé dans sa cavité nasale »

https://jbl1960blog.wordpress.com/2020/09/21/refusons-en-masse-lecouvillonnage-profond/comment-page-1/#comments

-masques et tests contaminés par les nanoparticules

https://odysee.com/@R%C3%A9cents:9/ALERTE–Masques-et-Tests-contamin%C3%A9s-par-des-nanos-vers-!:f?

masque et tests contaminés par morgellons

https://odysee.com/@wakeup:71/Morgellons2:1

https://stoplinkyblc.blogspot.com/2021/04/qui-sont-ces-intrus-dans-les-masques-et.html

https://profidecatholica.com/2021/03/13/tests-experimentaux-sur-lhumanite-pass-sanitaire-medecine-genomique-video/

Catherine Hill de l’université d’Harvard qui veut la dépopulation de la planète preuve ici https://www.hsph.harvard.edu/population-development/research/, veut utiliser une autre méthode pour forcer la piqouze https://olivierdemeulenaere.wordpress.com/2020/12/29/catherine-hill-cette-dingue-qui-appelle-a-ne-rien-rouvrir-du-tout-et-a-vacciner-ferocement/, enfermer les gens dans des camp pour cela , tester les gens asymptomatiques (donc en bonne santé donc tests faux positifs bidons) de force en s’introduisant chez eux de force https://www.bfmtv.com/sante/covid-19-l-epidemiologiste-catherine-hill-appelle-a-ne-rien-rouvrir-du-tout-et-a-tester-massivement_AV-202012280128.html, leur donner des tests positifs bidons https://redstate.com/michael_thau/2020/09/03/ny-times-up-to-90-of-people-who-tested-positive-for-c19-not-infected-truth-a-whole-lot-worse-pt-3-n253332, enfermer les gens en bonne santé asymptomatique dans des hôtels, et ensuite les piqouzer de force et ensuite attribuer faussement leur mort au covid, alors qu’ils auront été piqouzés contre leur gré dans les hotels dont personne ne connait la localisation pour qu’ils puissent violer les droits de l’homme à leur gré et que personne sache qu’ils ont été piqouzés, comme cela, ils pourront faussement attribuer leur mort aux variants ou covid selon leur fantaisie imaginaire qu’ils peuvent réaliser à souhait avec leurs tests 100% faux.

Voilà leur language trompeur à connaitre pour repérer leur arnaque de duperie de la population

-cas confirmé

testés en bonne santé positifs (variant ou covid selon leur fantaisie) sur leur test 100% faux

– cas suspect 

contact de contact d’un faux positif en bonne santé sur leur test 100% faux

– cas à risque

contact d’un faux positif en bonne santé sur leur test 100% faux

Manifestation nationale du peuple français contre ces tests PCR bidons truqués et toute la dictature zanitaire basé sur les tests PCR 100% faux de l’arnaqueur Drosten qui a fait même une étude bidonnée (avec une femme prétendant se faire passer pour une asymptomatique alors qu’elle prenait des médicaments en cachette comme l’a révélé l’enquête indépendante de Fuellmich) pour faire passer les asymptomatiques pour des malades

https://rumble.com/vh9w9d-ils-vont-se-faire-coincer-les-uns-aprs-les-autres-.html

Fauci l’avoue, les asymptomatiques ne donnent pas de virus

https://cdn.lbryplayer.xyz/api/v4/streams/free/4012/96d32b61989679965ed33eee9c2705c69812c028/b1fd72

https://odysee.com/@Abracadabra:3/En-aucun-cas-une-e%CC%81pide%CC%81mie-ne-peut-e%CC%82tre-provoque%CC%81e-par-une-personne-asymptomatique:a

Une étude de Wuhan sur 10  millions de personnes asymptomatiques prouve qu’ils ne donnent pas de virus

https://www.presseteam-austria.at/fr/Une-%C3%A9tude-prouve-que-la-quarantaine-asymptomatique-non-contagieuse-n%27est-pas-tenable/

Marre de ces tyrans arnaqueurs dont le seul but est d’enfermer les faux positifs en bonne santé de leur test arnaque dans les camps de concentration nazis pour atteindre leur objectif de piqouzer 70% des français adultes pour fin juillet 2021.

 

QR_doigt

Contrôle, achat, vente d’influence, gestion de la pensée unique, covidisme et manipulation par la dictature marchande… Qui construit la doxa du COVID ?

Posted in actualité, coronavirus CoV19, crise mondiale, désinformation, documentaire, guerres hégémoniques, ingérence et etats-unis, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , on 24 février 2021 by Résistance 71

 

 

 

Qui construit la doxa du COVID ?

 

22 février 2021

 

Source:
https://jdmichel.blog.tdg.ch/archive/2021/02/22/qui-construit-la-doxa-du-covid-313137.html

 

Commentaire d’un ami journaliste au sujet de la publication qui suit, adressant la question posée en titre :

« Une excellente analyse fouillée et pointue de Laurent Mucchielli sur son blog de Médiapart du rôle hallucinant des médias dans la fabrique du consentement, leur liens avec le politique (subventions) et le business (rachat des titres, publicité) :

   1) une pandémie menace la survie de l’humanité entière,

   2) il n’existe aucune thérapeutique pour guérir les malades,

   3) il faut confiner les populations,

   4) la délivrance viendra uniquement d’un vaccin.

La stratégie de l’OMS est bien décortiquée : « écarter les rumeurs et fausses informations » et se faire référencer en tête des moteurs de recherche avec la complicité de Google.

Pour comprendre comment une désinformation planétaire a été imposée, faisant exploser les repères éthiques, déontologiques et intellectuels des médias, des gouvernements et des autorités sanitaires.

Une contribution de haut vol d’un des grands sociologues contemporains, qui met le doigt là où le drame actuel se joue.

—————————————————————

Qui construit la doxa du Covid ?

Lien vers l’article original sur le blog de Laurent Mucchielli.

La crise de la Covid a été l’occasion d’un processus historiquement inédit de contrôle de l’information à l’échelle mondiale. Quatre types d’acteurs y ont des intérêts convergents : 1) les gouvernements occidentaux libéraux, 2) le tandem que forment l’OMS et son grand financeur Bill Gates, 3) les « géants du numérique » qui contrôlent les réseaux sociaux mais aussi et de plus en plus 4) les médias.

Dans les démocraties, la plupart des questions de sociétés font l’objet de débats publics contradictoires plus ou moins intenses et plus ou moins polémiques. Pourtant, si elle monopolise les commentaires dans les médias, la « crise sanitaire » ouverte par l’épidémie de coronavirus au début de l’année 2020 se caractérise par une fermeture inédite du débat public, une absence de véritable débat contradictoire, des phénomènes de censure et d’ostracisation pour le moins inhabituels. En France, tout se passe comme si le discours du gouvernement ne pouvait souffrir aucune contradiction majeure, toute personne se risquant à énoncer de telles contradictions étant renvoyée vers des catégories stigmatisantes dont la principale est le « complotisme » (1). Chose particulièrement étonnante : tandis que les journalistes devraient être les premiers organisateurs de tels débats contradictoires, beaucoup se révèlent au contraire être devenus des sortes de policiers de la pensée traquant les alternatives pour mieux les rejeter hors de l’espace légitime de discussion. Quant à Internet et aux réseaux sociaux, sensés initialement constituer une avancée dans la démocratie d’expression (2), ils accompagnent désormais pleinement ce mouvement de fermeture et illustrent quotidiennement des formes de nouvelles censures. Comment comprendre une telle situation de fait ?

La fabrique du consentement

Dans Manufacturing Consent. The Political Economy of the Mass Media, paru en 1988, Noam Chomsky et Edward Herman expliquent comment les principaux médias (radios, télévisions et presse écrite) participent désormais activement à la propagande des élites politiques et économiques dont ils sont devenus très largement dépendants (3). La démonstration des auteurs s’appuie principalement sur l’analyse de la couverture médiatique des mouvements de contestation internes ainsi que des guerres menées par les Etats-Unis durant la seconde moitié du 20ème siècle. Ils montrent la dépendance croissante des journalistes envers des sources gouvernementales qui leur facilitent le travail (communiqués de presse, dépêches, dossiers documentaires, etc.) et leur incapacité à engager de véritables investigations toujours longues et coûteuses. Ils soulignent également que les médias ont perdu peu à peu leur indépendance financière. D’une part, beaucoup appartiennent désormais à des grands groupes industriels et/ou des milliardaires, ou bien ne survivent que grâce aux publicités que ces groupes leur payent. D’autre part, ils reçoivent d’importantes subventions gouvernementales. Dans cette double dépendance, les médias ont perdu toute capacité à représenter un « quatrième pouvoir ». Ils sont, au contraire, structurellement sous influence des puissances économiques et politiques dont ils relayent de fait la vision du monde et les intérêts. Enfin, Herman et Chomsky étudient la manière dont opèrent cette production d’informations et cette diffusion de messages à destination de la population. Ils montrent que si le mécanisme de base est le contrôle de la diffusion des informations à destination des journalistes, une autre dimension majeure consiste à contrôler et utiliser toute une série d’« experts » faussement indépendants, qu’ils soient de simples « consultants », des journalistes spécialisés, des animateurs de think tanks ou même des universitaires dont les recherches sont financées par ailleurs par le gouvernement ou les industriels (4). Ces « experts » se comportent alors comme des « influenceurs » comme l’on dit de nos jours.


Qui est derrière ?…

Contrôle des médias et police de la pensée numérique

La situation française correspond en grande partie à ce modèle de double dépendance des médias. D’un côté, on retrouve des processus de concentration et de rachat qui font que la plupart des journaux, des radios et des télévisions sont aujourd’hui la propriété de quelques milliardaires (Vincent Bolloré, Bernard Arnault, Claude Perdiel, François Pinault, Xavier Niel…) et autres « grandes familles » (Bouygues, Dassault, Baudecroux, Baylet, Bettencourt, Lagardère…) (5). Ce processus de concentration est tel que dix sociétés contrôlent 90% de la presse écrite, 55% des parts d’audience de la télévision et 40% des parts d’audience de la radio (6). De l’autre côté, outre le maintien d’un ensemble de médias audio-visuel publics (Radio France et France Télévision), l’État finance également les entreprises de presse qui, ainsi, en dépendent. En 2017 (dernière donnée disponible), le ministère de la Culture publiait ces montants d’aides directes à la presse : 8,3 millions d’euros pour Aujourd’hui en France, entre 5 et 6 millions pour Libération, Le Figaro et Le Monde, entre 4 et 5 millions pour La Croix, Ouest-France et L’Humanité et entre 1 et 2 millions pour une petite dizaine de titres de la presse quotidienne régionale ainsi que pour Le Parisien et le Journal du Dimanche (7). Par ailleurs, dans son rapport de 2013, la Cour des comptes proposait un inventaire de ces aides et attirait notamment l’attention sur le cas de l’Agence France Presse (AFP), énorme entreprise de fabrication d’informations à destination de la totalité des médias français et étrangers, qui a un statut juridique d’établissement public autonome et dont l’État est à la fois une des instances dirigeantes et le premier client (assurant environ 40% des recettes de l’agence) (8). On remarque enfin que la presse a été largement bénéficiaire des aides exceptionnelles de l’État liées à la crise actuelle, avec près d’un demi-milliard d’euros annoncés dans le plan de relance en août 2020 (9).

L’ensemble de ces données dessinent les contours d’un tissu de relations et de liens d’intérêts entre le monde économique (les propriétaires des médias), le monde politique (leur subventionneur) et les rédactions en chef des médias. Nombre de journalistes ont d’ailleurs décrit de l’intérieur ces liens (10). Mais à cela s’ajoute désormais l’entrée en jeu des multinationales du numérique que sont en particulier Google et Facebook.

Sous la menace d’un lourd redressement fiscal en 2012, Google a eu l’idée de créer l’année suivante un « fonds d’aide au développement de la presse écrite » en France, afin de « soutenir un journalisme de qualité grâce aux technologies et à l’innovation ». C’est ainsi que, en 2019, 21 médias français ont reçu des subventions à hauteur de 6,4 millions d’euros. Ont alors fleuri sur les sites Internet des principaux médias quantités d’infographies, d’analyses de type « big data » ainsi que les rubriques de « fact check », traque des « fake news » et sites « complotistes » (11). Une des réalisations les plus connues en France est le « Decodex » du journal Le Monde, qui prétend établir un classement de la fiabilité de tous les sites Internet d’information.

Google n’est pas la seule multinationale numérique à exercer cette sorte de police de la pensée sur Internet. Facebook le fait aussi depuis 2017, toujours par le biais de la chasse aux « fake news » (12). « Nous, on travaille pour Facebook, comme un certain nombre de médias en France travaillent pour Facebook. On est rémunéré pour faire le ménage dans les contenus qui circulent », déclare ce journaliste de Libération le 30 décembre 2017 (13). De fait, huit médias français ont ainsi signé un partenariat avec Facebook : les quotidiens Libération, Le Monde et 20 Minutes, l’hebdomadaire l’Express, la chaîne de télévision BFMTV ainsi que l’AFP et le service public de l’audiovisuel à savoir le groupe France Télévisions (inclus France Info qui est à la fois une chaîne de télévision, une radio et un important site Internet) et France médias monde (qui regroupe la chaîne de télévision France 24, Radio France Internationale et détient une participation dans TV5 Monde). Pour les financer, Facebook achète au prix fort des espaces publicitaires, de même qu’il diffuse des contenus vidéos de ces médias via des applications pour smartphones dont Facebook garde le contrôle et partage les profits générés par les publicités (14).

En France comme dans d’autres pays (notamment aux États-Unis après l’élection de Donald Trump en 2016, marquée par des soupçons d’ingérence de la Russie, faisant trop vite oublier le scandale Cambridge Analytica impliquant directement Facebook [15]), ces opérations ont été activement soutenues par l’État. Dans ses vœux à la presse, en janvier 2018, Emmanuel Macron annonçait une loi pour lutter contre la diffusion des fausses informations sur Internet en période électorale. Ce sera la loi du 22 décembre 2018 « relative à la lutte contre la manipulation de l’information », adoptée malgré l’opposition du Sénat et avec des réserves d’interprétation du Conseil constitutionnel. Cette loi, toutefois, ne concerne pas que l’information en contexte électoral. Elle donne de nouveaux pouvoirs de censure au Conseil Supérieur de l’Audiovisuel (CSA) et organise la coopération avec les géants d’Internet (Facebook, Google, YouTube, Twitter) afin de lutter contre toute production d’informations qui serait susceptible de « troubler l’ordre public » (16). Cette nouvelle forme de censure d’Etat, et les dangers potentiels pour la liberté d’expression et d’information qu’elle porte, furent à l’époque critiqués en vain par le Syndicat National des Journalistes (SNJ), Reporters Sans Frontières (RSF), le Syndicat de la presse indépendante d’information en ligne (SPIIL), des associations de défense de la liberté numérique comme la Quadrature du Net et des chercheurs spécialisés (17).

Remarquons que cette nouvelle avancée dans la société de contrôle de l’information repose sur une justification très fragile car les recherches sociologiques ne confirment pas cette centralité des fake news dans l’évolution d’un débat public, et encore moins d’une élection (18). Le développement majeur de cette façon de faire du journalisme (le fact checking) a donc d’autres raisons. Inventé au départ pour vérifier la véracité des discours politiques (19), ce style de journalisme fait partie d’une tentative de reconquête de crédibilité des médias traditionnels lors même qu’il se situe à l’opposé du journalisme d’investigation puisqu’il permet de s’affranchir de toute démarche d’enquête sur le terrain (les articles pouvant s’écrire entièrement depuis son bureau à l’aide d’un ordinateur et d’un téléphone). Le fake checking est peu coûteux. Subventionné par les géants d’internet, il devient même rentable économiquement.

Les nouveaux habits de la censure

La lutte contre la propagande terroriste et les « contenus haineux » d’extrême droite a été au cœur du développement de nombreuses techniques de censure développées par ces géants d’Internet en collaboration avec les Etats. Puis, elle s’est étendue peu à peu à d’autres formes de censure de contenus plus politiques, au point d’exercer une véritable police de la pensée : « les grandes plateformes du web, de par leur position oligopolistique sur le marché de l’information, exercent ce pouvoir à trois niveaux distincts. En mettant à disposition des outils de prise de parole, elles les contraignent en même temps qu’elles les rendent possible, en leur appliquant un format. Leurs algorithmes, ensuite, ordonnent ces prises de parole disparates en distribuant la visibilité dont elles ont besoin pour toucher leur public. Enfin, leurs dispositifs de modération, qui articulent détection automatique et supervision humaine, exercent des fonctions de police en définissant ce qui peut ou non être dit, et en punissant les discours (ou les images) qui contreviennent aux règles » (20).

Cela étant, la censure n’est que le versant le moins présentable de processus de contrôle de l’information plus globaux. Comme le disait déjà Roland Barthes (Sade, Fourier, Loyola, 1971), « la vraie censure ne consiste pas à interdire (à couper, à retrancher) […] mais à étouffer, engluer dans les stéréotypes […] à ne donner pour toute nourriture que la parole consacrée des autres, la matière répétée de l’opinion courante » (21). Désormais, « la censure ne doit plus être seulement pensée comme le résultat de pressions directes et concrètes exercées sur les différents maillons de la chaîne de sens par les détenteurs identifiés de l’autorité d’État ou d’Église, mais comme le processus toujours et partout à l’œuvre de filtrage des opinions admises. Bien plus, cette ‘nouvelle censure’ […] passerait moins par l’interdit jeté sur la parole dissidente que par la promotion d’une parole conforme aux intérêts des institutions et des groupes qui les dominent » (22). La censure, au sens sociologique large comme au sens juridique réduit, est donc inséparable de la doxa qu’elle sert.


Bill la piquouze

L’OMS et la Fondation Bill Gates : deux puissances supranationales qui joignent leur influence

Les géants de l’Internet ne sont pas les seuls à s’immiscer dans le contrôle de l’information par le biais du financement des médias. C’est aussi le cas de la super-puissance que constitue la Fondation Bill & Melinda Gates. Le fondateur de Microsoft et Windows est devenu la personnalité la plus riche du monde au milieu des années 1990 (il a été récemment détrôné par le propriétaire d’Amazon, Jeff Bezos). Avec une fortune personnelle approchant les 100 milliards de dollars, il est plus riche que la plupart des pays du monde et, entre autres investissements, il finance de nombreux médias. En France, il subventionne en particulier Le Monde (2,13 millions de dollars pour l’année 2019) (23). Cette fondation consacre par ailleurs une partie très importante de ses dons (défiscalisés) à la santé, avec un prisme techno-industriel précis : « dans le domaine de la santé, la Fondation mène des actions de grande ampleur contre le sida, la tuberculose et le paludisme, traduisant son obsession pour la technologie par un intérêt tout particulier pour les vaccins, au mépris de solutions moins industrielles et potentiellement tout aussi efficaces » (24). En outre, la fondation de Bill Gates est devenue extrêmement influente au sein de l’OMS dont elle est le premier des contributeurs privés du budget avec 455 millions de dollars en 2019. Dans le classement général des financeurs, la Fondation est encore dépassée de peu par la Grande-Bretagne (464 millions de dollars en 2019) et surtout les États-Unis (853 millions de dollars en 2019) (25). Toutefois, le quatrième financeur dans ce classement (avec 389 millions de dollars en 2019) n’est autre que l’Alliance GAVI (Global Alliance for Vaccines and Immunization), organisation internationale de promotion des vaccins dont la Fondation Gates est également le principal financeur. Enfin, le neuvième et le dixième plus importants financeurs de l’OMS (respectivement 168 et 116 millions de dollars en 2019) sont deux associations caritatives internationales basées aux États-Unis : le Rotary International et le National Philanthropic Trust. Et la Fondation Bill Gates est aussi l’un des premiers financeurs de ces deux associations par le biais des dons défiscalisés. Dès lors, si l’on additionne les principaux quatre financements dans lesquels elle est impliquée (et ce ne sont pas les seuls), il apparait que la Fondation de Bill Gates est devenue en réalité le premier financeur de l’OMS.

L’OMS a joué un rôle particulièrement actif dans la tentative de maîtriser la communication sur l’épidémie de coronavirus. Depuis le classement de la Covid-19 en « urgence de santé publique internationale » le 30 janvier 2020, son directeur tient des conférences de presse quasi quotidiennes. L’organisation a mis par ailleurs en place tout un système de communication afin de contrer ce qu’elle appelle une « infodémie » qui se caractériserait par la multiplication de « rumeurs et fausses informations ». Son directeur général, Tedros Adhanom Ghebreyesus estimait même que « Notre plus grand ennemi à ce jour, ce n’est pas le virus lui-même. Ce sont les rumeurs, la peur et la stigmatisation » (26). Pour faire prédominer ses messages, l’OMS a mis sur pieds une stratégie de communication mondiale supervisée par Sylvie Briand, directrice du Département des pandémies et épidémies, et pilotée par Andrew Pattison, responsable des « solutions numériques », en lien avec une équipe de six personnes au siège de Genève. Un accord a d’abord été passé avec un partenaire ancien, Google, « pour faire en sorte que les personnes recherchant des informations sur le coronavirus voient les informations de l’OMS en tête de leurs résultats de recherche ». Ensuite, l’équipe de communication s’est assurée le concours des principaux réseaux sociaux (Facebook, Twitter, Instagram, Pinterest, Tencent, Tik Tok) et mêmes de sociétés comme Uber et Airbnb afin qu’ils diffusent les « bons messages » (27). Enfin, l’OMS et ses partenaires ont recruté des « influenceurs » ou relais d’opinion (28), afin de s’assurer du contrôle des réseaux sociaux et de YouTube, leader mondial de la vidéo en ligne (plus de deux milliards d’utilisateurs mensuels en 2020) et propriété de Google (29).

Conquérir le monopole de l’information légitime

La crise sanitaire ouverte par l’épidémie de Sars-CoV-2 aura été l’occasion d’une tentative historiquement inédite de contrôle de l’information à l’échelle mondiale, d’autant plus importante à comprendre que cette épidémie a fait l’objet d’une couverture médiatique sans précédent dans l’histoire (30). Dans cet article, nous avons passé en revue les composantes de ce processus international de normalisation éditoriale visant à assurer ce que Bourdieu appelait « le monopole de l’information légitime » (31). Ce système de contrôle est destiné à assurer la prédominance médiatique, et derrière le consentement des populations, à l’égard du contenu d’un message général qui pourrait être résumé ainsi : 1) une pandémie menace la survie de l’humanité entière, 2) il n’existe aucune thérapeutique pour guérir les malades, 3) il faut confiner les populations, 4) la délivrance viendra uniquement d’un vaccin.

Par ailleurs, la doxa n’est pas seulement la pensée dominante et présentée comme légitime par les élites de la société à un moment donné. Elle est aussi une vision du monde qui concourt à protéger l’ordre social et politique établi (32). Elle contient en effet une deuxième prémisse qui consiste à penser en substance que « le gouvernement fait ce qu’il peut », « il n’y a pas grand-chose d’autre à faire », voire même à en déduire que « c’est une obligation morale que de soutenir l’action du gouvernement dans ce moment exceptionnellement difficile ». Et autres variantes. La doxa prend alors la dimension de ce que Bourdieu appelait une sociodicée : « Max Weber disait que les dominants ont toujours besoin d’une ‘théodicée de leur privilège’, ou, mieux, d’une sociodicée, c’est-à-dire d’une justification théorique du fait qu’ils sont privilégiés » (33). En l’occurrence, il s’agit de faire accepter « une philosophie de la compétence selon laquelle ce sont les plus compétents qui gouvernent » (34).

Pour que la sociodicée fonctionne, il est ainsi crucial de contrôler l’information. Dans cet article, nous avons argumenté l’hypothèse selon laquelle quatre ensembles d’acteurs ont, de fait, des intérêts convergents à organiser ce contrôle et s’assurer du succès du message qu’ils ont choisi de faire passer. 

Le premier est représenté par le tandem désormais indissociable que forment l’OMS et son nouveau grand financeur la Fondation Bill Gates, dont le programme de vaccination mondiale constitue la pierre angulaire de la pensée sanitaire. Le second ensemble est constitué par la plupart des gouvernements occidentaux de type libéraux, qui ont été incapables de penser une autre stratégie que le confinement général, qui redoutent à présent les conséquences électorales et juridiques de leur gestion de la crise sanitaire et veulent donc s’assurer que leur version de l’histoire ne sera pas fondamentalement remise en question. Le troisième ensemble d’acteurs est constitué par les médias traditionnels qui sont confrontés de façon croissante à une crise de confiance majeure dans les populations (35), et pour qui le contrôle et si possible l’exclusivité de la diffusion de l’information légitime sur la crise sanitaire constitue presque une question de survie. Enfin, le quatrième type d’acteurs sont les « géants du numérique » qui contrôlent de nos jours non seulement les réseaux sociaux mais aussi et de plus en plus les médias traditionnels, et qui profitent de la crise sanitaire pour accroître encore leur emprise sur la vie numérique (36), ainsi que leurs profits publicitaires (37).

Il resterait cependant à investiguer plus en détail les liens entre ces quatre acteurs, les supposés « experts » dont ils s’entourent et les industries pharmaceutiques, premières concernées financièrement par la gestion de la crise du Covid, et dont les stratégies de lobbying et de trafic d’influence sont connues par ailleurs (38).

Références

(1) L. Mucchielli, « Le complotisme pour les nuls (à l’occasion d’un récent documentaire) », Mediapart. Le blog, 16 novembre 2020 [en ligne].

(2) P. Flichy, « Internet et le débat démocratique », Réseaux, 2008, 4, p. 159-185.

(3) E. Herman, N. Chomsky, La fabrication du consentement. De la propagande médiatique en démocratie, Marseille, Agone, 2008.

(4) Voir aussi D. Frau-Meigs, « Le journalisme aux États-Unis : une profession sous influences », Parlement[s], Revue d’histoire politique, 2004, 2, p. 64-79.

(5) « Médias français : qui possède quoi ? », Le Monde Diplomatique, décembre 2020.

(6) A. Rousseaux, « Le pouvoir d’influence des dix milliardaires qui possèdent la presse française », Basta Mag, 7 avril 2017.

(7) Ministère de la Culture, « Tableaux des titres et groupes de presse aidés en 2017 » [en ligne].

(8) Voir le rapport de la Cour des comptes, Les aides de l’Etat à la presse écrite, Paris, 2013, p. 45sqq.

(9) F. Schmitt, « La presse obtient à son tour un plan de relance », Les Echos, 27 août 2020.

(10) S. Halimi, Les nouveaux chiens de garde, Paris, Raisons d’Agir, 1997 ; F. Ruffin, Les petits soldats du journalisme, Paris, Les Arènes, 2003 ; P. Merlant, L. Chatel, Médias. La faillite d’un contre-pouvoir, Paris, Fayard, 2009 ; A. Ancelin, Le Monde libre, Paris, Les liens qui libèrent, 2016 ; L. Mauduit, Main basse sur l’information, Paris, Don Quichotte, 2016.

(11) D.-J. Rahmil, « Google finance les médias et dessine les nouvelles tendances du journalisme », L’ADN, 2 avril 2019.

(12) G. Pépin, « ‘Fake news’ : Facebook va rémunérer des éditeurs français et fait sa publicité dans la presse », NextInpact, 26 avril 2017 ; voir aussi Le Canard enchaîné, 3 janvier 2018.

(13) Lors du Journal de 13h de France Inter.

(14) L’Observatoire du journalisme, « Tout ce que les éditeurs perdent, Facebook et Google le gagnent », 21 janvier 2018 [en ligne : https://www.ojim.fr%5D. On sait que le modèle économique de Facebook est tout entier basé sur la publicité : cela a représenté 98% de ses recettes en 2019 (R. Badouard, Les nouvelles lois du web, Op.cit., p. 73).

(15) I. Bokanovski, Internet. Une plongée dans le web de l’influence, Paris, Balland, 2020, p. 61sqq.

(16) En ce qui concerne le CSA, un exemple de cette nouvelle forme de censure est survenu au tout début du mois de janvier 2021 lorsque cette agence a sanctionné la radio RMC pour avoir invité en août 2020 le professeur Christian Perronne à s’exprimer lors même que « cet invité était le seul membre du corps médical présent en plateau » et que « ces déclarations n’ont pas fait l’objet d’une contradiction suffisante ». « Dès lors, l’éditeur ne peut être regardé comme ayant fait preuve d’honnêteté et de rigueur dans la présentation et le traitement de l’information sur la pandémie » (« Le CSA met en demeure RMC pour une émission avec le professeur Perronne », 20 minutes, 6 janvier 2021). On notera toutefois que l’ensemble des médias passent leur temps à inviter des médecins depuis le mois de mars dernier et que le CSA n’a jamais relevé une absence de « contradiction suffisante » lorsque ces médecins expriment des propos qui coïncident avec le discours gouvernemental. Il s’agit d’une part d’un « deux poids, deux mesures » flagrant, et d’autre part d’un acharnement sur un médecin qui venait d’être démis de sa chefferie de service par le directeur de l’AP-HP (AFP, 17 décembre 2020).

(17) L. Haéri, « Loi contre les fake news : chasse aux fausses informations ou nouvelle censure ? », Le Journal Du Dimanche, 7 juin 2018. L’article interviewe notamment le sociologue Romain Badouard, auteur de Désinformation, rumeur et propagande, Limoges, FYP éditions, 2017.

(18) Y. Benkler, R. Faris, H. Roberts, Network Propaganda. Manipulation, Disinformation, and Radicalization in American Politics, Oxford, Oxford University Press, 2018.

(19) L. Bigot, Fact-checking vs fake news. Vérifier pour mieux informer, Paris, INA Éditions, 2019.

(20) R. Badouard, Les nouvelles lois du web. Modération et censure, Paris, Seuil, 2020, p. 12.

(21) Cité par P. Roussin, « Liberté d’expression et nouvelles théories de la censure », Communications, 2020, 1, p. 26.

(22) L. Martin, « Censure répressive et censure structurale : comment penser la censure dans le processus de communication ? », Questions de communication, 2009, 15, p. 71.

(23) « Le quotidien Le Monde a reçu plus de 4 millions de dollars de la fondation de Bill Gates », Covidinfos, 11 mai 2020 [en ligne : https://covidinfos.net/].

(24) L. Astruc, L’art de la fausse générosité. La Fondation Bill et Melinda Gates, Arles, Actes Sud, 2020, p. 12.

(25) https://www.who.int/fr/about/planning-finance-and-accountability/how-who-is-funded

(26) Cité par I. Mayault, « La rumeur, l’autre épidémie qui préoccupe l’OMS », Le Monde, 6 mars 2020. (27) M. Richtel, « W.H.O. Fights a Pandemic Besides Coronavirus: An ‘Infodemic’ », New York Times, 6 février 2020 ; cf. aussi F. Magnenou, « Comment l’OMS s’efforce de contenir l’infodémie qui entoure l’épidémie », France TV Info, 8 février 2020.

(28) Parmi ces influenceurs, côté francophone, on peut citer par exemple Lê Nguyên Hoang (près de 200 000 abonnés sur sa chaîne YouTube « Science4All », Thibaud Fiolet (et son site « Quoi dans mon assiette »), le groupe « Osons causer » (près de 300 000 abonnés sur YouTube et près d’un million sur Facebook) ou encore Jérémy Descoux, (98 000 abonnés sur sa chaîne « Asclépios », président du Collectif « FakeMed », un réseau de médecins militants souvent très virulents, qui s’est fait connaître par sa lutte contre l’homéopathie). Certains de ces influenceurs apparaissent dans une vidéo intitulée « Coronavirus : chaque jour compte », postée sur YouTube le 14 mars 2020, et dont la liste des intervenants est en ligne : https://docs.google.com/document/d/1x-euHB-V72ipNttBj1KP6O_aEBGK0qKafqphMRBZK1I/edit#heading=h.3bjrhorulj7v Il est probable que Facebook « sponsorise » certains influenceurs dans sa stratégie de promotion de contre-discours (R. Badouard, les nouvelles lois du web, Op.cit., p. 97), mais on ignore lesquels.

(29) Sur ce phénomène typique des années 2010-2020, cf. D. Frau-Meigs, « Les youtubeurs : les nouveaux influenceurs ! », Nectart, 2017, 5 (2), p. 126-136.

(30) A. Bayet, N. Hervé, « Information à la télé et coronavirus : l’INA a mesuré le temps d’antenne historique consacré au Covid 19 », INA. La revue des médias, 24 mars 2020 [en ligne] ; N. Hervé, « Coronavirus. Etude de l’intensité médiatique », Working paper, 30 juin 2020 [en ligne : http://www.herve.name/coronavirus].

(31) P. Bourdieu, Sur la télévision, Paris, Seuil, 1996, p. 82.

(32) P. Bourdieu, La Distinction. Critique sociale du jugement, Paris, Minuit, 1979, p. 549-550.

(33) P. Bourdieu, « Le mythe de la ‘mondialisation’ et l’Etat social européen », repris dans Contre-feux, Paris, Raisons d’agir, 1998, p. 49.

(34) Ibid., p. 48.

(35) De la dernière enquête Kantar/La Croix, il ressort un niveau inégalé de défiance vis-à-vis des journalistes, 68 % des personnes interrogées considérant qu’ils ne sont pas assez indépendants des pouvoirs politiques, et 61 % qu’ils ne sont pas assez indépendants vis-à-vis des « pressions de l’argent » (A. Carasco, « Baromètre médias : pourquoi 4 Français sur 10 boudent l’information », La Croix, 15 janvier 2020).

(36) S. Zuboff, L’âge du capitalisme de surveillance, Paris, Zulma, 2020. Sur la banalisation des technologies de surveillance de masse pendant la « crise sanitaire », cf. O. Tesquet, Etat d’urgence technologique. Comment l’économie de la surveillance tire parti de la pandémie, Paris, Premier Parallèle, 2021.

(37) R. Vitt, « Vacciné contre la Covid-19, Google bat tous les records en 2020 », Presse Citron, 27 décembre 2020 ; « En pleine crise, les GAFA affichent des profits flamboyants », Frenchweb, 30 octobre 2020 en ligne]

(38) L. Mucchielli, « Trafic d’influence : le rôle de l’industrie pharmaceutique dans la controverse sur le traitement médical de la Covid », Les Cahiers du CEDIMES, 2021, 16, p.76-86.

= = =

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir ! (Résistance 71)

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 


Police de la pensée et de l’info
BOYCOTT !

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »