Archive pour coronavirus eugénisme nouvel ordre mondial

Communiqué de presse de l’association Réaction 19 concernant la plainte pénale déposée contre l’utilisation des vaccins

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, guerres hégémoniques, Internet et liberté, média et propagande, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , on 5 janvier 2021 by Résistance 71

 

 


+ Moderna + AstraZeneca… L’humanité en péril

 

Association Réaction 19

 

4 janvier 2021

 

Communiqué de l’Association Réaction 19

4 janvier 2021

L’Association RÉACTION 19, co-présidée par Messieurs Carlo Alberto BRUSA et Riccardo MEREU, est une association loi 1901 qui compte aujourd’hui près de 40 000 adhérents et plus de 60 000 sympathisants, dont l’objet est de veiller au respect des libertés fondamentales, notamment dans le cadre de l’épidémie de la COVID-19.

L’Association RÉACTION 19 a, le 16 décembre 2020, déposé une plainte concernant les thérapies géniques Pfizer/BioNTech et Moderna, communément dénommées « vaccins ». Des chefs de :

  • mise en danger délibérée de la vie d’autrui ;
  • tromperie aggravée ;
  • abus de faiblesse ;
  • extorsion aggravée.

Déjà plus de 5 000 personnes ont déclaré s’associer à cette plainte, ce chiffre ne cessant de croître. Leurs interventions volontaires seront déposées auprès du Procureur de la République dans les prochains jours.

La plainte, enregistrée sous le numéro 20351000746, demeure entre les mains de la Justice et du Procureur de la République de Paris.

L’Association RÉACTION 19 a également adressé aux prescripteurs desdits « vaccins », notamment à l’ensemble des députés et sénateurs, au président de la République, au premier ministre, au ministre de la Santé et aux médecins, une déclaration d’engagement de responsabilité civile et pénale quant aux effets secondaires de ces « vaccins » pouvant aller jusqu’à la mort.

À ce jour, aucun des prescripteurs susdits n’a signé cette déclaration et n’a donc accepté d’engager sa responsabilité personnelle sur les conséquences de cette politique vaccinale.

Fait à Paris, le 30 décembre 2020.

Pour l’Association RÉACTION 19
Monsieur Carlo Alberto BRUSA
Président
63, rue la Boétie – 75008 PARIS
Mail : reaction19fr@gmail.com

= = =

Format PDF :

Communiqué-de-presse-relatif-à-la-plainte-pénale-rel-ative-aux-vaccins

 

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Dictature COVID-19 : Les labos poussent les gouvernements à les exonérer de toute responsabilité pour leurs vaccins chimériques…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

 

 

 

Les labos pharmaceutiques s’exonèrent de toute responsabilité sur les effets secondaires des vaccins covid

 

Anonyme

 

25 décembre 2020

https://www.lefigaro.fr/societes/vaccins-covid-19-l-ue-nbsp-indemnisera-les-laboratoires-en-cas-de-problemes-20200827

Bill Gates admet que ses vaccins changeront le génome

https://youtu.be/ksEVaO806Oo (vidéo à enregistrer avant censure)

Fauci le pantin de Bill Gates qui veut imposer les vaccins aux américains avoue que les vaccins covid peuvent être pires que le covid lui même

https://metro.co.uk/2020/05/12/americas-top-coronavirus-doctor-warns-vaccine-make-covid-19-worse-12692519/?ito=cbshare (article à enregistrer avant censure)

Bill Gates admet que ses vaccins peuvent tuer

https://www.armstrongeconomics.com/world-news/corruption/gates-admits-700000-people-may-die-from-his-vaccine/?__cf_chl_jschl_tk__=62eb6c7077991213fdafe4e84df29c5a07ebf0d4-1608836399-0-AVlKQVPOLfSy9QfQp3lKiMepwzABRTxxWMfww9Whtf27OPGp9Pysbzlln1vrkzWizhdh6sdzI5srwLQcRmU9Oi9E1O19KBS-t2bK9oY-kqIXxvzXo1evnUHmG-l9_fyt9BC82pusuzl4UQGKD99EyWzQQE8WO-spDIG2E8X-kqGWxXx7WeDjvlfQDbMemduSicRT22up-wqnYkzixyqrGvZ03FPAlCreAGCM0rYoEZcLZFPQFUVk7yyvxEUB6t1kl0wF9_gLrccxEoZtTl5ZLrhwVLAEPphfWMbYdrMIwW4CSEJyIQAnGO-mLBLRZV7otU94GN1ZQNccruGGk4-J3LKg0QjK58r7il0j3drDYjegmDieMGRAHBb3V7spLOlqZnk9Cg6q0UHKS6L_4uc_z1gDYNjz hY4WhEzoc4E6tfrWFkISoYiR0iLFQWZLiVk4z0GdxWuZPk33MketC3pa9do

https://resistance71.wordpress.com/2020/10/06/coronavirus-vaccin-covid19-et-controle-mondial-de-la-population/

les labos des vaccins AstraZeneca (NYSE: AZN), GlaxoSmithKline (NYSE: GSK), Janssen (NYSE: JNJ), Merck (NYSE: MRK), Novavax (NASDAQ: NVAX), Pfizer (NYSE: PFE), Sanofi Pasteur (NASDAQ) : SNY), Takeda (NYSE: TAK), Abbott (NYSE: ABT) et CureVac (NASDAQ: CVAC) ont tous demandé à être exonérés de toute responsabilité sur les effets secondaires de leurs vaccins OGM à ADN ou ARN

https://seekingalpha.com/news/3608810-coronavirus-vaccine-makers-seek-eu-liability-protections

AstraZeneca , GlaxoSmithKline, Janssen , Merck, Novavax , Pfizer , Sanofi , Takeda, Abbott CureVac sont tous financés par Bill Gates ou d’autres géants du web (comme le milliardaire Dietmar Hopp, co-fondateur du géant allemand du logiciel SAP https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html). ou collaborent avec lui

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2016/10/OPP1156831

https://observer.com/2020/05/coronavirus-vaccine-update-novavax-merck-bill-gates-funding/

https://nypost.com/2020/09/15/bill-gates-says-pfizer-has-best-shot-at-early-covid-19-vaccine/

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2015/10/OPP1127586

https://america-wake-up.com/2020/05/04/the-anthony-fauci-bill-gates-george-soros-sanofi-pasteur-china-corona-virus-vaccine-connection/

https://www.fiercebiotech.com/biotech/sanofi-pasteur-announces-vaccine-discovery-collaboration-bill-melinda-gates-foundation

https://www.takeda.com/newsroom/newsreleases/2016/takeda-receives-$38-million-grant-from-the-bill–melinda-gates-foundation-to-support-polio-eradication-in-developing-countries/

https://edition.cnn.com/2020/08/14/investing/curevac-ipo-coronavirus-vaccine-bill-melinda-gates/index.html

Pourquoi les géants du web investissent dans les vaccins?

Tout simplement parce que le but des vaccins c’est de donner une identité numérique, marque de la bête connecté à la 5G

https://www.kla.tv/Coronavirus-fr/16685

une autre vidéo qui en parle a été censurée sur

http://stoplinkyvarest.canalblog.com/archives/2020/09/21/38547121.html

vaccin connecté à la 5G

https://resistance71.wordpress.com/2020/10/09/dictature-technotronique-en-marche-vaccin-covid-arnm-hydrogel-enzyme-luciferase-cocktail-modificateur-genetique/

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

https://resistance71.wordpress.com/2020/12/16/laffaire-du-vaccin-contre-la-covid-19-nest-pas-une-affaire-sanitaire-mais-celle-de-la-normalisation-de-lidentite-numerique-philippe-guillemant-physicien-cnrs/

 

Déclaration de responsabilité civile et pénale pour l’administration du vaccin Pfizer / BioNTech ou Moderna dans le cadre de la COVID-19 (Association Réaction19, format PDF)

Posted in actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 26 décembre 2020 by Résistance 71


Mais que diable vont-ils nous injecter ?…

POUR DIFFUSION IMMEDIATE

Résistance 71

26 décembre 2020

Devant la menace sanitaire de ces vaccins OGM à ARNm dont personne ne peut savoir ce qu’ils génèreront sur le long terme sur le génome humain et le manque de transparence total les concernant, ainsi que l’ineptie totale pour les gouvernements et surtout l’UE d’avoir totalement exonéré de toute responsabilité légale les labos pharmaceutiques Pfizer / BioNTech, Moderna, voici un document de responsabilité civile ayant valeur légale que ceux qui désirent se faire vacciner peuvent faire signer au médecin et chargé de mission sanitaire les injectant.
Le document est réalisé par l’association REACTON19, Paris 8ème, rue de la Boétie, « pour toute personne concernée par le « vaccin » Pfizer/BioNTech ou Moderna ».

Ne faites confiance à aucune des instances promouvant cette saloperie, elles sont noyées ainsi que les individus qui les dirigent, dans le conflit d’intérêt le plus grossier et ce à tous les niveaux, que ce soit financier ou politique.

Voici le document à faire signer, diffusez, imprimez, distribuez… (PDF)
Déclaration-de-responsabilité-civile-et-pénale-du-médecin-1

Test COVID-19 RT-PCR : deux textes vitaux pour comprendre la fraude des chiffres statistiques de la pandémie (PDF)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, média et propagande, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , , on 17 décembre 2020 by Résistance 71

 

 

Résistance 71

 

17 décembre 2020

 

Nous avons traduit et publié récemment ces deux textes que Jo nous a réunis en un temps record dans ce PDF vital à la compréhension de l’enfumage auquel nous sommes tous victimes et qui vise à la mise en place d’une bonne partie de la grille de contrôle technotronique planétaire, comme l’explique par ailleurs le physicien Philippe Guillemant, et du contrôle eugéniste de la population mondiale par l’oligarchie en charge de faire perdurer le système étatico-capitaliste en phase de mutation vers son objectif final transhumaniste.
La mise en place d’une dictature sanitaire planétaire ne peut reposer que sur une seule chose ressentie par la vaste majorité des gens: la peur, voire la psychose face à quelque chose qu’on ne peut pas voir ni maîtriser (plutôt, qu’on ne VEUT pas maîtriser). Quoi de mieux donc qu’un nouveau croquemitaine invisible et nuisible à souhait, entre ainsi en scène le nouveau coronavirus (créé en laboratoire) :

Bébert Corona. Pour que la peur soit effective, durable, ajustable et modulable il faut qu’elle s’appuie sur la « science », mais pas n’importe quelle science… celle des chiffres, des statistiques et des extrapolations modélisées, comme à l’accoutumée maintenant ; de cette science qui privilégie les modèles informatiques à l’observation de faits de terrain.
Pour ce faire, il faut des chiffres, mais pas n’importe lesquels et certainement pas ceux qui résulteraient d’une observation réelle de terrain, mais de chiffres « adaptés » pour la circonstance, non pas falsifiés par quelques personnes mal intentionnées, ce serait vite repérable, mais par un protocole litigieux à moins, frauduleux au pire, pratiqué à l’insu et au plein gré de toutes et tous. Entre en scène les kits de test RT-PCR pour Real Time-Polymerase Chain Reaction… Tout est en place… le virus a été largué dans la nature… Que la fête commence !

Qu’est-ce que ce test PCR et quel usage en est-il fait ? Quelques réponses essentielles dans ces deux articles que nous avons traduits et que Jo nous a mis en PDF, à lire et diffuser sans aucune modération.

Dossier-special-CoV19-fraude-tests-RT-PCR
format PDF

 

Entretien du Pr. Personne avec France-Soir au sujet de sa suspension.
Nous devons dire ici que depuis quelques semaines, nous sommes étonnés de voir France-Soir
comme voix critique dans les médias de masse français au sujet de cette crise COVID.
Tout à leur honneur, ne crachons pas dans la soupe…

 

Vaccin CoV19 et stérilisation des populations ?…Des éléments plus que troublants

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, N.O.M, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , on 12 décembre 2020 by Résistance 71

 

 

Un vaccin covid qui stérilise la population pour un virus moins mortel que la grippe ?

 

Anonyme (reçu par courriel)

 

12 décembre 2020

 

La protéine d’origine virale du placenta et la protéine d’origine virale du sperme ressemblent à la protéine d’origine covid

vaccination covid= stérilisation des femmes et des hommes ?

8% de l’ADN humain est d’origine virale, les virus participent au système de reproduction humaine, si le covid ressemble au virus participant à la reproduction humaine, le vaccin covid s’attaquera à la fertilité humaine

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

La protéine d’origine virale chargé de la création du  placenta ressemble à la protéine créé par le covid,  donc il y a un risque que le vaccin covid  va causer l’infertilité tant des femmes que des hommes, car la syncytine 1 est présent aussi dans le sperme

https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

La syncytine 1 est une protéine d’origine virale joue un rôle essentiel lors de la formation du placenta au moment de la grossesse

La syncytine est une glycoprotéine d’enveloppe rétrovirale possédant des capacités fusogéniques induisant la formation de syncytium (cellules polynucléées découlant de fusion cellulaire). Elle est abondamment exprimée au niveau du placenta durant la grossesse. Chez l’humain les cytotrophoblastes jouent un rôle crucial dans le développement fœtal et placentaire. https://fr.wikipedia.org/wiki/Syncytine_1

« Qu’y a-t-il, dans ces protéines syncytines créés par les virus de l’ADN humain https://fr.wikipedia.org/wiki/Syncytine_1, de si nécessaire à la formation du placenta ? « Pour qu’ils puissent pénétrer dans la cellule hôte, les rétrovirus ont la faculté de faire fusionner la membrane de leur enveloppe avec la paroi cellulaire, explique M. Heidmann. Cette fusion de deux membranes est rendue possible par les syncytines puisque ce sont elles qui interagissent avec la surface de la cellule qui va être infectée. » Or ce mécanisme de fusion membranaire permet la formation de structures géantes appelées « syncytia » et constituées par la réunion de cellules individuelles… Une structure que l’on retrouve dans le placenta, à l’interface entre le foetus et la mère. »

https://www.lemonde.fr/planete/article/2009/08/28/le-placenta-invention-virale_1232882_3244.html

là une preuve que le covid 19 est en partie similaire au virus du placenta qui permet la création des bébés: 

« les protéines de pointe du COVID 19 contiennent également des protéines homologues à la syncytine protéine d’origine virale chargé de la formation du placenta »

.http://www.francesoir.fr/societe-sante/vaccination-sars-cov-2-le-dr-wodarg-et-le-dr-yeadon-disent-stop

Pfizer admet que son vaccin peut causer la stérilisation des femmes

« Responsable de la recherche chez Pfizer : Le vaccin Covid entrainera la stérilisation des femmes

Le vaccin contient une protéine de pointe (voir image) appelée syncytine-1, vitale pour la formation du placenta humain chez la femme. 

Si le vaccin fonctionne de telle sorte que nous formons une réponse immunitaire CONTRE la protéine de pointe, nous entraînons également le corps féminin à attaquer la syncytine-1, ce qui pourrait entraîner une stérilité chez les femmes pour une durée indéterminée.

Après quelques recherches, il s’avère que la syncytine 1 est également présente dans le sperme, de sorte que ce ne sont pas seulement les femmes qui seront stérilisées, mais aussi les hommes

https://www.researchgate.net/publication/261257414_Syncytin-1_and_its_receptor_is_present_in_human_gametes

https://healthandmoneynews.wordpress.com/2020/12/02/head-of-pfizer-research-covid-vaccine-is-female-sterilization/

Contrairement aux trolls qui prétendent que l’ARN ne peut pas modifier notre génome car est dans le cytoplasme de la cellule, ils oublient que certains virus possèdent une enzyme appelés transcriptase inverse qui permet de transcrire de l’ARN à l’ADN, et donc de modifier l’ADN à partir de l’ARN
https://fr.wikipedia.org/wiki/Transcriptase_inverse

 

or le covid qui est un virus manipulé en laboratoire https://fort-russ.com/2020/05/major-researchers-uncover-new-evidence-showing-covid-19-was-lab-created/, possède des fragments du VIH selon Le prof luc Montaigner qui l’a étudié
https://youtu.be/Vx91DZTjNTI

 

or le VIH possède dans son génome l’enzyme transcriptase inverse
https://en.wikipedia.org/wiki/Reverse-transcriptase_inhibitor#Non-nucleoside_reverse-transcriptase_inhibitor

 

ainsi donc les vaccins à ARN pourront modifier notre génome mais rassurez vous, les virus à ARN seuls sans vaccins ne peuvent pas modifier votre génome
la raison est que les enzymes de nos corps ainsi que nos anticorps détruisent tout ARN étranger venant de l’extérieur
c’est la raison pour laquelle pour protéger leur ARN de virus, ils l’engloberont de nanoparticules lipides, afin que le corps l’identifie comme lui appartenant et ne l’attaque pas, et le laisse entrer dans ses cellules pour faire de la modification génétique à partir de la transcription inverse une fois que l’ARN sera dans le cytoplasme de la cellule, donc le vaccin à ARN modifiera le génome à partir de la transcriptase inverse (de l’ARN à l’ADN)
la transcriptase normal tout court dont parlent les trolls c’est de l’ADN à l’ARN, mais vu que le covid contient la fonction transcriptase inverse, leur théorie bidon que les vaccins à ARN ne peuvent pas modifier le génome ne fonctionnera pas
la preuve les fabricants de vaccins sont obligés d’englober leur précieux virus RNA (the mRNA) modifié de nanoparticules lipidiques (lipid nanoparticles), car sinon les enzymes secrétés par les mucus du nez, la salive, les muqueuses de l’estomac, et autres émetteurs d’enzymes présents partout dans le corps, anticorps tueraient leur précieux RNA virus modifié
citations:
« lipid nanoparticles can be synthesized with relative ease in a scalable manner, protect the mRNA against degradation, facilitate endosomal escape, can be targeted to the desired cell type by surface decoration with ligands, and as needed, can be codelivered with adjuvants.
https://pubmed.ncbi.nlm.nih.gov/27075952/

As mRNA molecules are vulnerable to ribonuclease enzymes that widely exist in the biological systems and highly negatively charged, which compromise their internalization through cell membranes, suitable in vivo mRNA delivery systems are urgently needed (4). To protect and deliver mRNA, extensive efforts have been devoted to construct biocompatible carriers, such as LNPs, polymeric nanoparticles, peptides/protein-mRNA complexes, and other types of biomaterials (9, 22, 23). Among these reported platforms, lipid-like nanoparticles (LLNs) are one of the representative materials that have been extensively used for mRNAs delivery

https://advances.sciencemag.org/content/6/34/eabc2315.full

 

RNA molecules are also fragile molecules, easily degraded in the body https://www.pharmaceutical-journal.com/news-and-analysis/features/rna-interference-therapies-could-be-on-the-cusp-of-success/20204853.article?firstPass=false

le virus est composé d’un ARN, donc est facile à dégrader par le corps

il ne peut être protégé de la destruction du corps que si il est protégé et encapsulé à l’intérieur de nanoparticules biocompatibles dans le corps humain via le vaccin

Nanoparticle-based delivery systems protect RNA molecules from enzymatic degradation and immune system attacks https://www.biosyn.com/tew/Nanocarriers-for-RNA-delivery.aspx#!

la famine programmée par le gouvernement par les confinements meurtriers (morts de la faim à cause du chômage à cause de la fermeture des commerces non essentiels pour permettre à Amazon qui fraude sur la TVA de se remplir les pocheshttp://www.cielvoile.fr/2020/12/fraude-massive-a-la-tva-sur-les-places-de-marche-des-acteurs-du-e-commerce.html )http://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html,  future loi finance 2021https://strategika.fr/2020/12/04/appel-aux-francais-faites-pression-sur-vos-elus-afin-quils-sopposent-au-vote-de-la-prochaine-loi-de-finances-pour-2021/ et les compteurs linkyhttps://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/   en revanche fait réduire la production d’enzymes pouvant détruire les virus d’où le fait que dans l’histoire de l’humanité, les épidémies n’ont lieu uniquement que dans les périodes de famines, et disparaissent automatiquement avec la fin de celles ci
https://fr.wikipedia.org/wiki/Liste_de_famines

 

d’où le fait qu’ils font tout pour accroitre la crise économique avec les confinementshttp://www.cielvoile.fr/2020/12/james-corbett-a-propos-des-confinements.html

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/  , fermeture des commerces non essentiels mettant en chomage des millions de personnes
les masques assèchent la bouche, donc réduction de la salive qui contient des enzymes tuant les virus

le Ribonucléase Rnase ennemi mortel du covid (RNA) et présent naturellement dans tout le corps humain
https://en.wikipedia.org/wiki/Ribonuclease

les vaccinateurs veulent nous imposer le covid à travers le vaccin obligatoire, en protégeant leur précieux virus à l’intérieur de nanoparticules lipidiques pour l’empêcher d’être détruits par nos méchants enzymes et méchants anticorps

La stérilité causé par les vaccinés sera-t-elle imputée au Covid19 ? Regardez ces liens ou faites votre propre recherche.

https://www.nationalheraldindia.com/health/coronavirus-can-cause-male-infertility-study

https://www.thailandmedical.news/news/breaking-male-infertility-research-shows-that-sars-cov-2-coronavirus-may-indirectly-cause-testicular-damage-in-male-covid-19-patients-and-also-orchiti

https://www.forbes.com/sites/victoriaforster/2020/11/15/covid-19-compromises-sperm-count-and-quality-in-recovering-patients/

https://www.urotoday.com/recent-abstracts/men-s-health/male-infertility/124144-male-fertility-and-the-covid-19-pandemic-systematic-review-of-the-literature-beyond-the-abstract.html

https://journals.physiology.org/doi/full/10.1152/ajpendo.00183.2020

https://www.bionews.org.uk/page_152485

https://healthandmoneynews.wordpress.com/2020/12/03/oxford-designer-of-covid-vaccine-admits-vaccine-will-only-sterilize-70-per-cent-of-the-population/

Les tests PCR sont bidons et à 90% d’asymptomatiques, leur objectif c’est de stériliser la jeunesse fertile via la vaccination

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

Autre preuve que le covid est bidon:
en l’année 2020 du covid 2019, la population mondiale augmente, donc aucun risque qu’un virus puisse faire que l’espèce humaine disparaisse, la vie continue normalement comme des millénaires avant
https://www.worldometers.info/fr/

Evidemment le gouvernement enrage que le virus covid n’arrive pas à dépeupler les gueux et ne les stérilise pas et ne leur fait aucun symptôme du tout, donc il a fait pondre la loi pour avorter les bébés à 9 mois dans le ventre et une autre loi pour euthanasier les vieux, et une autre loi pour baillonner tout le monde pour empêcher tout le monde de respirer, et une loi pour autoriser le glyphosate de Monsanto

https://www.ouest-france.fr/environnement/glyphosate/glyphosate-l-assemblee-refuse-d-inscrire-l-interdiction-de-l-herbicide-dans-la-loi-5789451

alors qu’on sait que les pesticides tout comme les autres polluants chimiques abiment les poumons donc entravent la respiration

https://observatoire-des-aliments.fr/sante/pesticides-et-problemes-respiratoires-chez-les-enfants
https://www.lefigaro.fr/vox/societe/img-jusqu-au-9e-mois-pour-detresse-psychosociale-le-danger-d-un-motif-imprecis-20200812

preuve que le covid n’a aucun impact sur la fertilité et n’empêche pas la naissance de bébés en excellente santé

https://indianexpress.com/article/cities/chandigarh/covid-positive-woman-delivers-healthy-baby-6552509/

http://stoplinkyvarest.canalblog.com/archives/2020/09/14/38533480.html

En plus vu que la population mondiale augmente, on voit que le covid n’a aucun impact sur la fertilité des hommes et des femmes, que s’il y a une épidémie de gens stériles après, ce sera bien causé par la vaccination…

Mais ils feront croire que la stérilisation est causé par le covid pour pousser les gens à se vacciner, et bien sur, ils feront passer leurs exemples d’individus stériles à cause de la vaccination comme des gens qui n’ont jamais été vaccinés pour faire croire à leurs mensonges

Alors ne vous vaccinez pas, tant que les labos n’ont pas fait de garanties écrites et sont prêts à être responsables judiciairement si leurs vaccins causent un impact sur la fertilité et toute autre déraillement de la santé par effets secondaires mortifères !

Tests PCR sinon bidons du moins bien peu fiable en contexte clinique et dépistage thérapeutique

https://resistance71.wordpress.com/2020/12/10/cov19-test-pcr-et-falsification-des-chiffres-le-test-rt-pcr-ne-devrait-pas-etre-utilise-a-fins-therapeutiques-il-nest-quun-outil-de-fabrique-comme-concu-par-son-inventeur-kary-mullis/

https://resistance71.wordpress.com/2020/10/16/voix-de-la-raison-cov19-et-tests-rt-pcr-comprendre-le-comment-de-lenfumage-general-permettant-de-maintenir-un-etat-de-terreur-accepte-du-plus-grand-nombre-et-de-dire-non-a-la-dictature-sanitair/

https://monde.taibaweb.com/index.php/2020/12/04/un-rapport-explose-le-test-pcr/

= = =

A lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

 

L’inquisition sanitaire par la dictature de la science des modèles… De la science des faits à la science des algorithmes (Jean-Claude Paye)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 11 décembre 2020 by Résistance 71

 

 

 

Coronavirus : une nouvelle inquisition

 

Jean-Claude Paye et Tülay Umay

 

9 décembre 2020

 

url de l’article original:
https://www.mondialisation.ca/coronavirus-une-nouvelle-inquisition/5651897

 

Installé depuis neuf mois, « l’état d’urgence sanitaire » a atteint le plus intime des individus. Afin de les conformer à des injonctions mortifères, il exhibe le spectacle d’un sacrifice permanent des populations. Celui-ci relève d’un théâtre gestuel, tel celui d’Antonin Artaud,[1] qui fait appel à une forme de purgation, impactant le Réel des êtres humains.

La « guerre contre le coronavirus » n’est pas une lutte contre la maladie et ne repose pas non plus sur sa prévention. Si la « pandémie » se limite à l’impact d’une grippe saisonnière, on constate, suite aux mesures prises, une dégradation globale de la santé des individus, confirmant ainsi que cette hostilité est bien une guerre contre les populations. Dans son dernier discours, le président Macron en précise les dernières modalités, en énonçant la possibilité d’organiser « l’isolement des personnes contaminées de manière plus contraignante,[2]» ce qui pourrait signifier, selon le sénateur Alain Houpert, la création de camps d’internement.

Bien que son cadre d’application ne soit pas précisé, le principe de précaution présente une primauté sur toute autre politique destinée à « gérer des risques incertains.[3] »  Dans le cas du coronavirus, il devient un « outil de gestion virtuel de risques virtuels.[4]». La « pratique scientifique » est alors réduite au principe moral de responsabilité. Ce dernier se résume à une monstration de la participation des populations à des mesures qui les asservissent. Les mesures de précaution relèvent alors d’une théologie de l’obscène, d’un faire-voir  amalgamant responsabilité et culpabilité. Elles s’inscrivent dans une nouvelle religion basée sur le sacrifice.

La facilité, avec laquelle les populations ont renoncé, à leur propre corps et au rapport à l’autre, produit un impensable. L’Inquisiteur du roman, Les frères Karamazov de Dostoïevski, donne sa réponse à cette interrogation, en énonçant que ce serait le propre de l’Homme de faire de Dieu le « responsable de la charge de sa vie ». 

Le pouvoir politique exerce actuellement la fonction réservée au grand Inquisiteur dans le roman de Dostoïevski. Il est aujourd’hui l’institution à laquelle les populations abandonnent la « charge du désir de l’autre », en offrant leur libre arbitre en sacrifice. Le principe de précaution relève de la culpabilité. Il donne du sens au sacrifice des populations et à la violence des mesures prises. 

Le principe de précaution

Depuis une vingtaine d’années, la « lutte antiterroriste » a permis de saper les fondements de l’organisation de la société, en détruisant, de l’intérieur, la forme de l’État de droit [5]. Aujourd’hui, dans la « guerre contre le coronavirus », les libertés fondamentales n’ont simplement plus lieu d’être et laissent la place à des notions morales, celles de  responsabilité et de culpabilité.

Lévinas nous éclaire sur cette problématique, car toute sa philosophie repose sur l’idée de responsabilité. Il reprend, à son compte, les propos de Dostoïevski dans Les frères Karamazov, sur la culpabilité de chacun de nous « devant tous, pour tout». Lévinas précise que cette culpabilité ne résulte pas «  de fautes que j’aurais commises, mais parce que je suis responsable d’une responsabilité totale, qui répond de tous les autres et de tout chez les autres.[6]» 

En devenant responsable de l’autre, chaque individu deviens, tout particulièrement, comptable de sa mort. Il entre dans « l’inquiétude-pour-la-mort-de-l’autre-homme [7]». La responsabilité n’est pas d’ordre juridique, mais est fondée sur une « communion spirituelle de tous les humains », ici, une communion dans l’universalité du coronavirus. 

Ainsi, le principe de précaution suspend l’observation des faits et dénie l’ordre juridique, pour laisser la place à « l’amour du prochain ». La communication du pouvoir n’est-elle pas :  « soyez solidaire, sauvez des vies, rester chez vous  » ? Les injonctions du pouvoir se réduisent à des commandements d’amour, relevant de la perversion.  L’amour qui se sacrifie est bien pire que l’exigence de la Loi : il rend la dette impossible à solder et la culpabilité infinie. 

Le principe de précaution libère alors le pouvoir, des contraintes de la loi écrite et de la Loi symbolique, afin d’intégrer un discours hors-sens, reposant sur des impératifs catégoriques nous entraînant dans une forme nouvelle d’inquisition. « Il faut » est la réponse standardisée des personnes, portant le masque ou respectant scupuleusement les mesures de distanciation. 

En se plaçant hors-sens, le « covidé » fonde une religion, celle d’un Dieu pervers, dénoncé par le théologien Maurice Bellet [8]. Le régime de précaution réclame un sacrifice. L’injonction repose sur « une volonté capricieuse, arbitraire, sans foi ni loi, qu’il faudrait satisfaire [9] ». Ce qui nous engage dans le cercle infini, imposé par un nouvel inquisiteur, révèlant que « ce divin est semblable à une bouche dévorante et insatiable : plus on cherche à la satisfaire, plus elle en demande, puisqu’elle se nourrit précisément de nos renoncements [10]».

Les derniers propos, du ministre belge de la santé Franck Vandenbroeck, illustre bien ce discours d’amour et d’éducation reposant sur une politique se nourissant des renoncements successifs des citoyens.  Au micro de la radio RTBF, il a affirmé que la décision de fermer les magasins, « c’était pour  créer un choc  au sein des populations », puisque dit-il « faire du shopping seul, pendant une courte période ne représente pas un danger pour la circulation du virus .[11]»

Un principe moral inscrit dans le droit

Le principe de précaution est un principe moral. Il ne s’adresse pas à un sujet de droit. C’est une injonction qui se place au-delà de la loi. La mutation du comportement des individus est son objectif premier. En France, il a fait son entrée dans le droit positif, en 1995, avec la loi Barnier sur la protection de l’environnement. Son domaine d’application s’est ensuite développé dans les domaines de la santé publique et de la sécurité alimentaire [12].  Il a également été adopté par la Commission Européenne et de nombreux Etats membres. 

En 2005,  le législateur français a introduit le principe de précaution dans la Constitution. Un principe moral est ainsi devenu un principe constitutionnel. Le principe de précaution y est défini  comme « une norme-guide pour l’action en univers incertain, un outil de gestion virtuel des risques virtuels…[13]». Ainsi, son encadrement juridique ne peut être que formel. 

Le principe de précaution se dégage donc de la matérialité du fait. Il fait penser à la notion de « proactivité » relative à l’enquête policière, introduite dans le droit pénal afin développer une recherche en l’abscense d’infraction [14]. L’inscription juridique du principe de précaution permet également de justifier l’intervention de l’administration dans un contexte ou « elle légitime le pouvoir de police »[15].

Dans l’enquête policière proactive, s’il s’avère que l’infraction est finalement inexistante, l’enquête a bien eu lieu, mais elle ne pourra pas produire d’effets de droit. Il en va bien autrement pour le principe de précaution qui permet d’agir en dehors de tout rapport avec la réalité des faits, de confiner la population ou d’isoler, dans des camps, les personnes testés positives, bien que le test utilisé produise essentiellement des faux positifs.

L’intervention des autorités sanitaires n’est pas donc déterminée en fonction de l’observation, mais bien par la prédiction de résultats et leur modélisation, comme les 500.000 morts du covid prévus par le docteur Neil Fergunson. Bien que l’oracle soit constamment démenti par les faits, il sert toujours de référence et de caution aux diverses mesures gouvernementales.

Précaution versus prévention

Le principe de précaution participe de la rationalité instrumentale, celle de la technique et du calcul économique. Il n’a pas pour ambition d’anticiper l’évènement, afin d’éviter sa survenance ou d’en minimiser les effets, il s’en tient à une gestion probabiliste des risques [16].

Il ne s’agit plus de prévenir le développement d’une maladie, mais de révéler un danger  potentiel, non à partir d’une analyse concrète, mais grâce à une simulation mathématique, détachée de la matérialité des faits. Une succession de chiffres est censée indiquer une tendance, celle du l’intensité et de la progression exponentielle du virus. C’est donc à partir des algorithmes que le risque est révélé et non plus à partir de l’observation. Les chiffres avancés sont toujours des projections, des modélisations, comme les 9000 morts récemment annoncés par le président Macron qui se réduiront, dans les faits, à la moitié  du chiffre prévu.

Pour la généticienne Alexandra Henrion-Caude, les prévisions donnent l’impression « qu’on est revenu au temps des devins, des oracles ». « On était en plein pic épidémique, avec un nouveau virus, une nouvelle maladie, qu’on nous parlait déjà d’une deuxième vague. Là on entend une troisième, une quatrième [17] ».

On peut donc établir ce qui différencie le principe de précaution de la notion de prévention. La prévention vise des risques avérés, dont sait estimer l’ampleur et la fréquence du dommage encouru. Les mesures de prévention ont été conçues pour circonvenir les risques certains, fondés sur des relations déterminées de cause à effet. 

Ce qui n’est pas le cas du principe de précaution qui porte sur les risques incertains, dont on n’a pas à établir la réalité scientifique [18]. On a affaire ici à un droit purement procédural, car « en matière de précaution, la preuve du risque et la procédure sont liés [19]». Comme dans le droit de l’inquisition, la preuve fonde sa validité sur le strict respect de la procédure. Dans la guerre contre le coronavirus, la question n’a même pas à être posée, car la « connaissance » est immédiate, directement révélée par le chiffre de l’algorithme. 

Le contrôle juridictionnel est restreint.  Tel que l’a stipulé le Tribunal de première instance des Communautés européennes : l’autorité qui « prend un risque incertain ne doit pas faire la preuve du risque, mais celle de sa politique [20] ». Dans les faits, l’autorité concernée doit simplement mentionner ses bonnes intentions. 

Le principe de précaution : une théologie de « l’ob-scène » 

La prévention vise à gérer les conséquences d’une crise, à l’anticiper et à en réduire les effets. Quant au principe de précaution, il n’a pas pour objet d’affronter la maladie, mais, ici, de préparer la population à sa survenance inéluctable. Il s’agit de placer les individus dans une position d’accueil du discours sur la pandémie. Ce principe procède d’une exigence morale, conduisant non pas à une lutte contre le virus, mais à une mutation du comportement des individus.  

Ainsi, le principe de précaution, au contraire de la prévention, est un outil de gestion des populations, de leurs attitudes et de leurs croyances. Comme l’écrit Pierre Moscovici, «L’Etat ne se contente plus de gérer un risque, il doit gérer un rapport social… Le principe de précaution devient alors un outil de gestion de l’opinion publique.[21]»

Nous sommes ici dans l’incertitude d’un risque, dont la réalisation est elle-même incertaine. Le principe de précaution nous interdit de penser. Il s’oppose à toute possibilité d’observation, en supprimant la notion même de causalité, comme succession temporelle de causes et d’effets.  Sous la forme du délire, le discours sur la coronavirus colonise notre vie individuelle et notre réalité sociale. Il fonde un nouveau Réel, il porte sur quelque chose dont nous ne pouvons rien dire et sur lequel nous n’avons pas de prise.

Le principe de précaution n’impose pas des mesures destinées à confronter la réalité, mais il permet la fabrication d’un Réel obscène, dont le masque chirurgical devient le symbole. Par un dénombrement continu des victimes du coronavirus, il réactualise l’idéologie victimaire. Ainsi, il met en scène l’ob-scène en quantifiant la mort, tout en l’expulsant du symbolique, du lien social. 

L’obscénité des mesures réside aussi dans leur caractère volontairement exorbité, dans le fait de rendre non seulement visible, mais surtout médusant, leur aveuglante abération, celle, par exemple, d’un couvre-feu imposé entre minuit et cinq heures, ainsi que leur violence sans limite, tel le massacre des personnes âgées dans les Ehpad. 

L’obscénité réside dans leur caractère religieux, dans la donation de sens qu’apportent les populations à leur participation compulsive aux mesures imposées. Celles-ci donnent alors vie à des dispositions administratives qui conduisent à leur destruction. L’obscénité réside non seulement dans l’expression de la toute puissance du pouvoir, mais surtout dans la monstration des populations de leur extrème faiblesse. Cette dernière trouve leur source dans la capacité des médias d’engendrer des images et un bruit permanent, empêchant l’installation d’un refoulement [22].

Le grand Inquisiteur

Si « la guerre contre le terrorisme » avait pour objet de supprimer toute résistance, ici dans « la guerre contre le coronavirus », il s’agit d’abandonner toute possibilité même de résistance. À travers « la gestion de cette pandémie », cette perspective est entrée dans notre quotidien, pourtant, ce n’est pas la première fois qu’elle apparaît dans l’histoire de l’humanité. 

L’humanité réduite à un troupeau est une réalité qui s’est présentée à chaque fois que la population s’est trouvée totalement démunie, placée dans une position de détresse par rapport au pouvoir. La détresse des individus résulte d’une perte des repères et surtout d’une impossibilité de faire face, de dire non aux injonctions qui leur sont adressées. Confrontées au fait de « ne pouvoir attendre l’aide de personne », les populations sont alors plongées dans une radicale impuissance.

Le roman de Dostoïevski, Les frères Karamazov, en situant l’action dans la période historique de l’inquisition, fait ressortir une problématique qui rappelle étrangement ce que nous vivons présentement. L’organisation de l’inquisition repose sur le personnage du grand Inquisiteur qui considère l’humanité comme un troupeau. Il conçoit que l’homme ne peut trouver son salut qu’en renonçant à sa subjectivité et en se dépersonnalisant. 

Si l’humanité doit être réduite à l’état de troupeau docile, l’individu, en déléguant sa liberté au grand inquisiteur, redevient un « infans », coupable de renoncer à sa liberté. Il devient alors complètement dépendant d’un pouvoir qui lui dicte sa conduite. Si bien que le grand Inquisiteur peut affirmer : « Oh, nous arriverons à les convaincre qu’ils ne deviendront libres qu’au moment où ils renonceront pour nous à leur liberté et ils se soumettront [23]».   Dans cette « pandémie », il est signifié aux individus qu’ils ne redeviendront « libres » qu’au moment où ils auront acceptés le vaccin et qu’ils auront abandonné toute volonté d’avoir une maîtrise de leur existence.

Le grand Inquisiteur préconise également une logique de déresponsabilisation de l’individu, de renoncement à son libre arbitre, aboutissant à sa déshumanisation. Le règne du grand Inquisiteur, c’est également la disparition totale de la sphère privée, jusqu’à l’ultime intimité que représente la conscience. 

Si l’Homme n’est plus libre et, par conséquent, n’est plus responsable, il lui revient le « droit de pêcher. » Plus précisément, il lui est permis de ne plus être un homme, en transgressant les lois symboliques, comme dans les différentes réformes éthiques, tel que le « mariage pour tous », la législation sur l’euthanasie et les lois sur la bio-éthique. Ces « nouveaux droits » ne sont en fait qu’un moyen supplémentaire pour le pouvoir d’asservir les hommes. « Tout est permis », tel est le mot d’ordre du nihilisme [24].

Autrefois, l’inquisition était une institution spécialisée, destinée à empêcher l’éclatement du corps social, en criminalisant tout questionnement d’ordre religieux. Aujourd’hui, elle ne se focalise plus sur une partie de la société, mais porte sur son ensemble. C’est la société toute entière qui est mobilisée, en vue de sa propre destruction. Ce qui occupe actuellement la place du grand Inquisiteur n’a plus pour objectif de bloquer une mutation sociale et politique, mais au contraire d’être le catalyseur d’un changement radical de société. Ici, le sacrifice n’est plus limité et codifié, mais permanent et généralisé. 

« État d’urgence sanitaire »

Le principe de précaution s’inscrit étroitement dans « l’état d’urgence sanitaire ». La notion doit être prise à la lettre, dans le sens où il s’agit bien, ici, d’une suspension du droit d’être soigné. Cet abandon se traduit par des mesures de confinement des personnes âgées et malades avec celles ne présentant aucun symptôme et par le refus d’accès à l’hôpital des personnes ne présentant pas de symptôme du corona, mais ayant, par exemple, un problème cardiaque. Au nom de ce principe, les personnes âgés, malades du Covid 19, ne sont pas prises en charge et sont renvoyées chez elles, avant que l’on abrège les souffrances grâce au Rétrovil . La question de la précaution est aussi convoquée pour interdir des médicaments, permettant de faire face à l’épidémie, telle l’hydroxychloroquine. 

L’état d’urgence juridique implique la suspension des libertés individuelles et des droits politiques, comme disposition permettant de faire face à la « menace terroriste ». L’état d’urgence juridique, par le biais de la lutte antiterroriste, se définit également, tel l’exprimait W. Bush, comme une « lutte contre du bien contre le mal ». Le nouvel ordre juridique permettait, en l’abscence de peuves, d’emprisonner les personnes, nommées comme terroristes par le pouvoir exécutif. L’état d’urgence juridique permet de s’attaquer à l’Habeas Corpus des citoyens et, en Grande Bretagne et aux Etats-Unis, de se saisir du corps des personnes créant « un climat favorable au terrorisme [25]» ou simplement désignées comme « ennemi du gouvernement ». 

L’état d’urgence sanitaire permet, quant à lui, de supprimer le corps par des mesures de confinement, tandis que le port, obligatoire et généralisé, du masque est une remise « en marche » de ce corps, mais comme « corps sans tête », comme corps-machine. La suppression du corps, induite par la « guerre contre le coronavirus », grâce au port permanent d’un masque ou de gants, trouve déjà un antécédent dans les images de prisonniers, détenus au bagne de Guantanamo [26]. 

Le type d’enfermement, induit par la « lutte contre la pandémie », est une rupture complète avec le type d’emprisonnement qui visait à séparer le corps du prisonnier du corps social. Ici, c’est l’ensemble des citoyens qui est touché par les mesures de confinement. La prison n’est plus un lieu clos, séparé de la société, mais bien cette dernière qui, en confinant chez lui le « citoyen responsable » participant du « souci de l’autre », devient une prison. 

La prison, comme partie distincte de la société, reste cependant présente, comme une menace d’enfermer, dans des camps, les personnes déclarés positives par un test PCR, une procédure qui permet considérer, comme positifs, une grande proportion des individus testés [27]. L’ensemble de ces mesures et projets participent d’une volonté du pouvoir d’installer les citoyens dans la psychose.

Comme les images des tortures de Guantanamo, ces mesures ont pour objet de nous signifier notre impuissance, de nous montrer à quel point nous sommes dépendant d’un pouvoir qui, cependant, nous veut du bien, qui, pour Noêl, comme le président du parti libéral francophone belge, Louis Bouchez, nous communique : « si les chiffres le permettent, on tentera encore de donner plus  d’humanité. [28]»

Jean-Claude Paye

Tülay Umay

 

Notes :

1 Lire : Jean-Claude Paye, Tülay Umay, « Pandémie ou le retour du grand Pan », Réseau International, le 3 novembre 2020,  https://www.mondialisation.ca/pandemie-ou-le-retour-du-grand-pan/5650703

2 Sud radio, Macron 20H: analyse avec Alain Houpert, Sénateur de la Côte-d’Or et médecin radiologue,

https://www.youtube.com/watch?v=i-vHz-M-Eys 

3 Dominique Bourg et Alain Papaux, « Des limites du principe de précaution : OGM, transhumanisme et détermination collective des fins », Economie publique, 2007/2,  https://journals.openedition.org/economiepublique/7932 

4 Matthieu Paillet, « Le principe de précaution. Concept, application, enjeux », p. 8,  https://www.pourlasolidarite.eu/sites/default/files/publications/files/wp_-le_principe_de_precaution.pdf 

5 Jean-Claude Paye, La fin de l’Etat de droit, de l’état d’exception à la dictature, La Dispute, Paris 2004.

6 Emmanuel Lévinas, Éthique et infini, Paris, Le livre de poche, 1982, p. 95.

7 Emmanuel Lévinas, De Dieu qui vient à l’idée, Paris, Vrin, 1992, p. 248.

8 Maurice Bellet, Le dieu pervers, éditions du Cerf, Paris 1987.

9 Jean-Daniel Causse, Lacan et le christianisme, in Valérie Chevassus-Marchionni, Raymond  Lemieux, et François Nault, « Psychanalyse et christianisme : note critique à propos du dernier livre de Jean-Daniel Causse (1962-2018) ». Laval théologique et philosophique 75, no 1 (2019), p. 134.. https://doi.org/10.7202/1067506ar 

10 Ibidem

11 https://plus.lesoir.be/340753/article/2020-11-30/la-fermeture-des-commerces-non-essentiels-avait-ete-decidee-pour-creer-un 

12  Catherine Larrère, « Le principe de précaution et ses critiques » , Innovations 2003/2 (n°18), pages 9 à 26 , https://www.cairn.info/revue-innovations-2003-2-page-9.htm 

13 Moscovici, Pierre, «Le principe de précaution: implications politiques et juridiques», cours donné à l’Ecole Nationale d’Administration (ENA), avril 2010, p. 26

14 Sur l’enquête proactive, lire Jean-Claude Paye, Vers un Etat policier en Belgique ?, EPO, Bruxelles 1999.

15 M. Gros, D.Deharbe, La controverse du principe de précaution, Chron. Adm.,R.D.P.,2002-3., p.834.

16 Matthieu Paillet, https://www.pourlasolidarite.eu/sites/default/files/publications/files/wp_-le_principe_de_precaution.pdf 

17 Alexandra Henrion-Caude : « J’ai l’impression qu’on est revenu au temps des devins », La Rédaction, le 16 novembre 2020, https://www.sudradio.fr/societe/alexandra-henrion-caude-jai-limpression-quon-est-revenu-au-temps-des-devins/ 

18 Le Conseil d’État et le principe de précaution,  Journal des Tribunaux, Bruxelles, Larcier, le 28 février 2004, p. 21

https://orbi.uliege.be/handle/2268/7260 

19 C.Noiville et N.de Sadelleer, o.c., Revue du droit de l’Union européenne, 2/2001, p. 444

20 T.P.I., 11 septembre 2002, Pfizer Animal Health et a.c.Conseil, Aff.T-13/99, motifs 164 et 165

21 Pierre Moscivici, Ibid., p. 23.

22 Entretien avec Serge Tisseron, « L’obscène est une machine de guerre contre la métaophore », La voix du regard n° 15, septembre 2002,https://www.youscribe.com/catalogue/documents/loisirs-et-hobbies/humour/l-obscene-est-une-machine-de-guerre-contre-la-metaphore–376961     

23 Fédor Mikhaïlovitch Dostoïevski, Les frères Karamazov, vol. 1 – § Le Grand Inquisiteur, Éditions Actes Sud © 2002, collection Babel, traduit du russe par André Markowicz, pp. 444, 445, 449 à 470 et 474. https://www.philo5.com/Mes%20lectures/Dostoievski_GrandInquisiteur_1880.htm  

24 Matthieu Giroux, « Dostoïevski : La légende du grand inquisiteur dans Les Frères Karamazov », Philitt, le 25 septembre 2012, 

  https://philitt.fr/2012/09/25/dostoievski-la-legende-du-grand-inquisiteur-dans-les-freres-karamazov/ 

25 Lire : Jean-claude Paye, « Royaume-Uni, menaces sur l’Habeas Corpus, » Le Monde, le 13 avril 2005  https://www.lemonde.fr/idees/article/2005/04/13/royaume-uni-menaces-sur-l-habeas-corpus-par-jean-claude-paye_638494_3232.html 

26 Lire : Jean-Claude Paye, « Guantanamo comme réel de la lutte antiterroriste », in L’emprise de l’image, de Guantanamo à Tarnac, Editions Yves Michel 2011, pp.140 à 149.

27 Dr Pascal Sacré, « COVID-19: RT-PCR ou comment enfumer toute l’humanité », Mondialisation.ca, le 14 octobre 2020, https://www.mondialisation.ca/covid-19-rt-pcr-ou-comment-enfumer-toute-lhumanite/5650143 

28 Aurelie Demesse, «  Noël pourrait-il être sauvé, in-extremis ?, La Libre Belgique, le 29 novembre 2020,  https://www.lalibre.be/belgique/politique-belge/un-assouplissement-des-mesures-pour-noel-si-les-chiffres-le-permettent-on-tentera-encore-de-donner-plus-d-humanite-5fc375e0d8ad585a459299a3 

 

Nouvel excellent documentaire « Mal Traités », à voir et diffuser sans relâche…

Posted in actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, média et propagande, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, presse et média, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , on 9 décembre 2020 by Résistance 71


Halte à la supercherie et à la politique anxiogène !…

Résistance 71

9 décembre 2020

Décidément !… Les Gaulois réfractaires d’un corps médical en rébellion mettent le paquet pour dénoncer ce crime d’État planétaire en collusion avec Big Pharma que constitue la « gestion » de la « pandémie » du SRAS-CoV-2 donnant la COVID-19
A voir et diffuser sans relâche, ce nouveau excellent documentaire « Mal Traités », qui après « Hold-Up » devrait enfoncer le clou définitif dans le cercueil de l’oligarchie eugéniste mettant en place la dictature sanitaire. Bravo à tous les intervenants qui disent ce qui doit être dit.
Dommage quand même que rien ne soit dit sur l’outil qui permet de générer les chiffres bidouillés divulgués en boucle et donc la peur 24/24 et 7/7 : le fameux test RT-PCR qui ne détecte en rien spécifiquement le SRAS-CoV-2 et qui ne peut donc être qu’approximatif et livrer bien des erreurs que le système exploite… Nous allons revenir très bientôt sur ce sujet… Traductions en cours.

Vidéo documentaire « Mal Traités » (durée : 1h27)

https://odysee.com/@Vivresainement:f/mal-traites-le-documentaire-choc-sur-la-covid-19:9

L’ancien directeur de la recherche en pneumologie du labo Pfizer demande un arrêt immédiat des études sur le vaccin pour raison de sécurité… Sait-il quelque chose qu’on ne dit pas sur la stérilisation par exemple ?

Posted in actualité, altermondialisme, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 8 décembre 2020 by Résistance 71

Dépeuplement ? Les docteurs Wordarg et Yeadon demandent l’arrêt immédiat de toutes les études sur le vaccin COVID-19 qu’ils considèrent dangereuses [pour les personnes servant de cobayes]

M.K scarlett

5 décembre 2020

Source de l’article en français:
https://fr.sott.net/article/36362-Depeuplement-Les-docteurs-Wodarg-et-Yeadon-demandent-l-ARRET-immediat-de-toutes-les-etudes-vaccinales-anti-Covid-19-qu-ils-considerent-dangereuses

Le 1er décembre 2020, l’ancien directeur de la recherche en pneumologie de Pfizer, le Dr Michael Yeadon, et le pneumologue et ancien directeur du département de santé publique, le Dr Wolfgang Wodarg, ont déposé une demande auprès de l’Agence européenne des médicaments — responsable de l’approbation des médicaments à l’échelle de l’Union européenne — pour la suspension immédiate de toutes les études sur le vaccin Sras-CoV-2, et en particulier l’étude BioNtech/Pfizer sur le BNT162b (numéro EudraCT 2020-002641-42). 

répondre aux importantes préoccupations en matière d’innocuité, préoccupations exprimées par un nombre croissant de scientifiques de renom à l’encontre du vaccin et du protocole d’étude. 

Les pétitionnaires demandent d’une part qu’un séquençage dit de Sanger soit utilisé en raison du manque patent d’études sérieuses quant au test PCR. C’est la seule façon de faire des déclarations fiables sur l’efficacité d’un vaccin anti-Covid-19. Sur la base des nombreux tests PCR de qualité très variable, ni le risque de maladie ni l’éventuel bénéfice d’un vaccin ne peuvent être déterminés avec une certitude suffisante, et c’est la raison pour laquelle les tests du vaccin sur des humains sont en soi contraires à l’éthique. 

En outre, ils exigent qu’il soit exclu, par exemple au moyen d’expérimentations animales, que des risques déjà connus par des études antérieures — qui proviennent en partie de la nature des coronavirus — puissent se concrétiser. Les préoccupations portent en particulier sur les points suivants : 

  • La formation d’anticorps dits « non neutralisants » peut entraîner une réaction immunitaire exagérée, surtout lorsque la personne testée est confrontée après la vaccination au vrai virus « naturel ». Cette amplification dite aggravation dépendante des anticorps, l’ADE, est depuis longtemps connue grâce à des expériences avec des vaccins anti-coronavirus chez les chats, par exemple. Au cours de ces études, tous les chats qui avaient initialement bien toléré la vaccination sont morts après avoir attrapé le virus « naturel ».
  • On s’attend à ce que les vaccins produisent des anticorps contre les protéines Spike du Sras-CoV-2. Cependant, ces protéines Spike contiennent également des protéines analogues à la syncytine, qui sont essentielles pour la formation du placenta chez les mammifères tels que l’homme. Il faut absolument exclure qu’un vaccin contre le Sras-CoV-2 puisse déclencher une réaction immunitaire contre la syncytine-1, sous peine de provoquer une stérilité de durée indéterminée chez les femmes vaccinées.
  • Les vaccins à ARNm de BioNTech/Pfizer contiennent du polyéthylène glycol (PEG). Il se trouve que 70 % des personnes développent des anticorps contre cette substance — cela signifie que de nombreuses personnes peuvent, suite à cette vaccination, développer des réactions allergiques, potentiellement mortelles.
  • La durée beaucoup trop courte de l’étude ne permet pas une estimation réaliste des effets sur le long terme. Comme dans les cas de narcolepsie après la vaccination contre la grippe porcine, des millions de personnes en bonne santé seraient exposées à un risque inacceptable si une autorisation d’urgence était accordée et que la possibilité d’observer les effets sur le long terme de la vaccination ne devait qu’advenir ensuite. Néanmoins, BioNTech/Pfizer a apparemment soumis une demande d’approbation d’urgence le 1er décembre 2020.

APPEL À L’AIDE : Wodarg et Yeadon demandent au plus grand nombre possible de citoyens européens de cosigner leur pétition en envoyant à l’Agence européenne des médicaments le mail préparé ICI. 

Source de l’article initialement publié en anglais le 1er décembre2020 : 2020news.de 

====

Additif de M.K Scarlett de Sott.net

Considérons la possibilité que ce « vaccin » anti-Covid — notamment celui de BioNTech/Pfizer, mais ce n’est peut-être pas le seul, les données sont à ce jour trop partielles — cache une volonté de dépopulation… 

Tout d’abord, après quelques recherches, il s’avère que, selon cette étude publiée en avril 2014 sur le Journal of Assisted Reproduction and Genetics, la syncytine-1 est également présente dans le sperme. Ce ne serait donc pas seulement les femmes qui seraient stérilisées, mais aussi les hommes. 

EN PLUS de supprimer toute responsabilité qui pourraient incomber aux fabricants de vaccins, il est fait usage de tests PCR largement considérés comme inadéquats. En outre, ils exercent une forte pression sur les populations pour les inciter à se faire vacciner. 

Pourquoi ? 

S’agirait-il — sous couvert de lutter contre un coronavirus — de concrétiser ce qui est gravé sur les Guidestones en Géorgie ? 

Il n’existe à ce jour aucune données sur l’efficacité du vaccin chez les enfants et les femmes enceintes. Et pour cause, ces deux catégories n’ont pas participé aux essais. Pas encore… Le 2 décembre, Selon l’article de Nature du 3 décembre, Moderna a dévoilé ses plans pour tester son vaccin chez les enfants. 

La Grande-Bretagne est le premier pays à avoir autorisé l’usage du vaccin contre le Covid-19 mis au point par Pfizer et BioNtech, et son gouvernement précise que ce vaccin n’est pas destiné aux femmes enceintes ou aux femmes « qui prévoient de tomber enceintes » :

« Il n’existe pas encore de données sur l’innocuité des vaccins Covid-19 pendant la grossesse, qu’elles proviennent d’études sur l’homme ou sur l’animal. Étant donné le manque de preuves, la JCVI privilégie une approche de précaution et ne conseille pas actuellement la vaccination Covid-19 pendant la grossesse. 

Il convient de conseiller aux femmes de ne pas se présenter pour la vaccination si elles sont enceintes ou prévoient de l’être dans les trois mois suivant la première dose. 

Des données sont attendues qui alimenteront les discussions sur la vaccination pendant la grossesse. Le JCVI les examinera dès qu’elles seront disponibles. »

Donc, et selon Wodarg et Yeadon, dans le cadre d’une grossesse existante, le vaccin composé de syncytine-1 attaquerait le placenta et provoquerait rapidement une fausse couche. Des vaccins de l’OMS/Gates ont déjà produit ces effets aux femmes d’Amérique latine : « Quand Bill Gates stérilisait des millions de femmes à coups de seringue ». 

Pourquoi ne veulent-ils pas — à ce stade — que les femmes enceintes soient vaccinées ? Il peut bien sûr exister tout un tas de bonnes raisons de ne pas le faire, et d’ailleurs, les femmes enceintes ne font en général pas partie des essais vaccinaux. Toutefois, est-il possible que ce soit parce que les fausses couches se produiraient tellement rapidement qu’il pourrait devenir par trop évident que le « vaccin » en serait la cause ? Le fait de ne pas vouloir — au début — inclure dans leurs programmes de vaccination des femmes qui sont enceintes ou veulent tomber enceintes leur permettrait-il d’enterrer la vérité sur les effets réels du vaccin, suffisamment longtemps pour que la majorité de la population l’accepte ? 

Beaucoup de questions, mais peu de réponses. À ce stade, on ne peut que conjecturer en prenant en compte notre connaissance des desiderata d’une élite mondialiste psychopathe.

= = =

Notre page « Coronaviru, guerre biologique contre l’humanité »


Vaccination… bien public ou imposture ?

SRAS-CoV-2 et dictature sanitaire… Décryptage d’une « pandémie » annoncée et critique de la critique officielle du documentaire « Hold Up »…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, gilets jaunes, guerres hégémoniques, N.O.M, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, terrorisme d'état with tags , , , , , , , , , , , , , , , , on 22 novembre 2020 by Résistance 71

Ite missa est ! La “pandémie” COVID19 enfin décryptée

Jean-Yves Jézéquel

18 novembre 2020

url de l’article original:
https://www.mondialisation.ca/ite-missa-est-la-pandemie-covid-19-enfin-decryptee/5651204

Voilà, la Messe est dite ! Maintenant nous savons clairement, tout ce que nous supputions, depuis le début de cette « crise » provoquée, volontaire, en nous posant bien des fois la même question : « Mais à qui donc profite ce désastre sans nom, cette hécatombe programmée, ce massacre organisé détruisant tous les secteurs de la vie économique, politique, sociale, individuelle, sans proposer une autre manière de vivre en harmonie avec la Terre ? »

L’ensemble des articles publiés dans Mondialisation.ca sur toutes les questions gravitant autour de la COVID-19, représente un dossier exhaustif, détaillé, exceptionnel, de données, d’informations et d’analyses qui, dès le début, de cette « crise », voyait juste, quant aux « non-dits » de cette affaire, quant à la partie immergée de l’iceberg qui venait soudainement saborder la vie politique, économique et sociale de tout l’Occident, en achevant sans scrupules les acquis de la liberté pour les peuples.

[Note de R71: voir aussi notre page « Coronavirus, guerre contre l’humanité »]

Relevons que cette tentative de meurtre voulait en tout premier lieu entraîner avec elle la Chine et la Russie. Il faut souligner aujourd’hui, que ce bloc de l’Est a su mettre vigoureusement en échec la destruction programmée pour l’imposition d’un Nouvel ordre mondial dont le programme a si bien été détaillé par le FEM (Forum Économique Mondial). Bien évidemment, nous trouvons les chiens de garde habituels qui, assumant leur mission, n’ont pas manqué de décrier les méthodes « dictatoriales » de la Chine et de la Russie, mais sans savoir vraiment ce que font la Chine et la Russie dans le secret de leur résistance à l’hégémonie occidentale, autour de la question COVID-19. C’est un autre sujet à lui tout seul, qui mériterait une enquête de fond…

( Cf., Le Forum économique mondial (FEM) vient de publier (octobre 2020) un livre blanc intitulé « Resetting the Future of Work Agenda – in a Post-Covid World” (Réinitialiser l’agenda du travail de demain – dans un monde post-covidien). En français voir : Le Sommet pour la réinitialisation de l’emploi – FEM )

Tout ce que nous avons découvert dans le film « Hold-Up », coréalisé par Pierre Barnerias et Christophe Cossé, présenté comme une synthèse sur l’histoire de ce « massacre coronavirus », a été accusé avec une violence inouïe, de « reportage complotiste » et censuré sans ménagement dans tous les médias qui sont aux mains des quelques patrons milliardaires de l’aristocratie stato-financière au pouvoir, fondamentalement engagée dans ce « coup d’État sanitaire » pour le triomphe indiscutable de la société Orwellienne enfin presque advenue. 

Lorsqu’un grand homme, au-dessus de tout soupçon, Arnaud Mercier, professeur en sciences de l’information et de la communication à l’Université Panthéon-Assas, commente le fait « indubitable » de la « Fake news complotiste » dans ce reportage construit sur « les règles du journalisme authentique », il souligne indirectement le fait que, seule la « factualité » est la règle de la « vérité journalistique » et que ce reportage, en quelque sorte, pèche gravement en se référant beaucoup plus à « l’existentialité » ! Arnaud Mercier dit : « Plus le système, que ce soit le monde politique, les scientifiques ou les médias, cherche à s’opposer à la factualité, plus certains vont y voir la preuve que ce que dit le documentaire est digne d’intérêt ou digne de foi. »

En réalité il traite de « rumeur » le contenu même de ce reportage et par définition, une « rumeur » est mensongère ! Je renvoie le lecteur à mon article « Coronavirus : un délire collectif », posté le 31 août 2020 sur ce même média indépendant, qui montrait justement que la « rumeur » était le fondement du délire collectif engendré par les décisions unilatérales du pouvoir macronien en France, avec la complicité de ses motivations conscientes et inconscientes de volonté de puissance. Précisément, la « rumeur » n’est pas applicable à ce reportage authentiquement anti-complotiste, mais justement à ce qui a permis les incohérences volontaires des mesures gouvernementales toutes prises à huis-clos, sans concertation aucune avec les autres instances du pouvoir et des contre-pouvoir! 

Puis, notre professeur d’Assas explique le fait d’une adhésion massive à ce reportage par la question de la « croyance idéologique ». Les gens adhèrent à cette démonstration parce que ce discours « correspond » à ce qu’ils ont envie de « croire » ! La « factualité » est donc relativisée selon cette présentation des choses et par le fait même c’est « l’existentialité », la réalité existentielle qui est clouée au pilori. Car, dans notre monde, il n’y a de place qu’à la réalité factuelle dite par le seul autorisé à la proclamer : le pouvoir. Chacun doit se poser la question : « Qui décide ce qui relève du factuel et ce qui relève de l’existentiel ? »

Aucun journaliste, quel qu’il soit, ne peut prétendre à la pure objectivité : tout récit journalistique passe par le filtre existentiel, le vécu, le ressenti de la personne humaine qui fait son travail d’informateur. L’objectivité pure et simple d’un discours « factuel » au-dessus de tout soupçon, n’existe pas, (il est d’ailleurs inintéressant en soi) et le fait de le prétendre tranquillement en regardant de haut les pauvres « croyants complotistes », donne la certitude que le « politiquement correct », la « pensée unique », « la vérité révélée du pouvoir médiatique en place », via, dans ce cas un professeur de l’Université – qui elle, vous le savez, est garante du dressage étatique – sont les pires mensonges que même la « rumeur » est incapable d’égaler ! L’Université représente le pouvoir de la pensée contrôlé par l’État. Ses serviteurs sont donc conformes à son projet de formatage des intelligences et des consciences. Or, tout pouvoir se prévaut d’une « innocence », sans quoi il ne serait pas pouvoir. Tout pouvoir se dit « innocent », « le vrai et le bien », faute de quoi personne ne pourrait se soumettre à lui. Comment peut-il prétendre à une telle « vertu » ? En se basant implicitement, sans le dire, sur une matrice théocratique fantasmatique lui donnant sa « légitimité » indiscutable. (Cf., sur l’analyse d’Arnaud Mercier,  voir ladepeche.fr, le 16 novembre 2020)

On peut donc adresser la même critique aux commentateurs zélés défendant les « élites » de la bien-pensance, en les renvoyant à leur « complotisme » spécifique : celui de la vérité révélée par le pouvoir impliquant une transcendance, celle de l’État qui est le « Pontife infaillible » de la société laïque. 

Conclusion : entre la « réalité factuelle » et la « réalité existentielle », c’est la réalité existentielle qui l’emporte, car c’est elle qui traduit précisément le vécu des personnes qui sont confrontées à la réalité. La « réalité factuelle » n’a aucun intérêt en soi, car elle ne dit rien à personne, elle est figée, parole morte dans le discours des sectateurs du dogme de la « révélation » étatique. Ce n’est pas ce que « dit le pouvoir » qui est important, c’est ce que vivent les personnes réelles qui est important ! Voilà pourquoi « Hold Up » l’emporte sur le discours officiel des « élites » qui s’agitent avec violence contre le « complotisme imposteur » des insoumis et des contestataires de la parole sacrée de l’État Pontife. Les serviteurs dévoués du pouvoir, considèrent ainsi logiquement ce reportage « Hold-Up » comme blasphématoire et réagissent avec fanatisme !

Voilà aussi pourquoi, dans les médias collaborateurs des « autorités », on a eu le droit à une avalanche de menaces, de censures intempestives, de condamnations, et d’une volonté de criminaliser la parole critique, le ressenti des personnes, ressenti accusé d’être « rumeur », mensonge, c’est-à-dire hérésie au regard du dogme tout puissant de la révélation étatique et donc passible de la répression inquisitoriale et du bûcher, lynchage médiatique et persécution moderne du récalcitrant ! On a appris que Pierre Barnerias était non seulement censuré et rejeté de partout, mais harcelé par les limiers de Bercy et subissant tous les tracas administratifs classiques lorsque l’on veut faire crever rapidement un empêcheur de tourner en rond ou un lanceur d’alertes… Cet acharnement du système contre un journaliste indépendant ne peut être pris que pour un aveu confirmant toujours plus la vérité de ce qui a été dénoncé… 

Edgar Morin disait : « Toute contestation d’une affirmation officielle ou d’une croyance largement répandue est désormais considérée comme « complotiste » . (Edgar Morin, sur Twitter, le 14/11/2020)

Faisant partie des « élites » qui, selon Laurent Alexandre, fondateur de Doctissimo, doivent éliminer purement et simplement les « inutiles », les réactionnaires violents de LREM et les commis d’office de la « bien-pensance », se sont mobilisés pour hurler au scandale, pour écumer de rage contre ce reportage insurrectionnel, et débiter les mesures de répression qui seront prises contre tous ceux qui se laisseront aller à rejeter le conditionnement de la peur ; contre tous ceux qui oseront n’avoir pas peur ou plus peur ; contre tous ceux qui seront considérés comme criminels ayant osé penser autrement que les dieux qui nous gouvernent !

(Nota Bene : Selon Emmanuel Todd, ces « inutiles » dont parlent les « élites », sont constitués de tous ceux qui font partie de la classe des professions intermédiaires : de certains intellectuels et professions indépendantes, les artisans et les ouvriers qualifiés, paysans et employés qualifiés. Cette catégorie sociale n’a pas la conscience d’exister en tant que classe, car elle est informelle et très diversifiée dans ses structures. Puis, le prolétariat, l’essentiel des Gilets jaunes (composé aussi d’un grand nombre de personnes de la classe précédente), regroupant les ouvriers et les employés non qualifiés, avec leur fraction importante d’immigrés. Ce prolétariat se pense très clairement ouvrier, défavorisé, opprimé, Français mais exclu. C’est surtout dans ces deux classes sociales maudites que se « recrutent » les « complotistes » et « inutiles » ou « hérétiques » pour la bien-pensance. Les Bobos et l’aristocratie stato-financière ne représentent que 28% de la population. Le problème majeur qui se pose aux « élites » c’est que les « complotistes » se recrutent majoritairement dans le groupe le plus important de la société : 72% !) 

C’est ce qui explique en bonne partie pourquoi les défenseurs de la classe au pouvoir se mettent dans tous leurs états pour essayer de discréditer ceux qui osent n’avoir plus peur en encourageant un grand nombre de leurs concitoyens à ne plus répondre aux injonctions de la peur et à une salutaire et résolue désobéissance civique !

Nous avons désormais en mains, tous les critères qui nous permettent de comprendre cet acharnement et comment les « élites » sont tout à fait prêtes à aller jusqu’à construire des camps dits de « quarantaine et d’isolement » pour les positifs de la COVID-19 et qui sont donc ouvertement des « camps de concentration » pour « l’isolement » des contestataires, comme il en est déjà question au Canada. Le parlementaire Randy Hillier a posé des questions claires et précises sur l’appel d’offres du Gouvernement fédéral pour les « camps d’isolement/quarantaine » en Ontario. (Cf., https://www.youtube.com/watch?v=AzWLlfwfD4Y )

En France on a entendu parler d’un « Guantanamo » français qu’il faudrait construire et qui devrait servir à mater toute rébellion contre les autorités politiques, sanitaires et « scientifiques » ! C’est, même au simple stade de l’évocation d’une éventualité, quelque chose de sidérant et de réellement abject !

Nous voyons surgir de ces « élites » une pensée typiquement « nazie » et des réflexes typiquement « nazis » de répression et d’élimination… Il est vrai que c’est parfaitement inquiétant d’entendre un Laurent Alexandre, déjà cité, affirmer publiquement et devant une assemblée de jeunes étudiants, future « élite » de la France : « Il faut éviter la multiplication des Gilets jaunes, ce sont des êtres inutiles et substituables ! »

La formulation est odieuse et si nous souhaitons, en effet, qu’il n’y ait plus de Gilets jaunes, parce que tous auraient les mêmes chances et les mêmes droits dans une solidarité, une liberté, une justice et une fraternité, la motivation du fondateur de « Doctissimo » est tout autre : elle est criminelle, elle exprime l’élimination de gens qui sont inutiles et que l’on peut remplacer par des robots par exemple ! L’être humain est humilié dans ce discours et l’arrogance représentative de cette « élite » est insupportable. Le mépris est destructeur, il est meurtrier !

Chacun doit prendre conscience que cette espèce de « renouveau » d’un « eugénisme » de classes s’est réveillée et que les « élites » ont organisé un monde dans lequel il n’y a plus de place pour les pauvres, pour ceux qui ont moins reçu que d’autres, pour le partage et la solidarité…

Comme il est difficile de faire entendre à beaucoup de ceux qui seront impitoyablement éliminés, à quel point ils se bercent d’illusions. Souvenez-vous que beaucoup de Juifs ont répété à quel point un certain nombre d’entre eux ne cherchait pas à se cacher ou à fuir tant qu’il en était encore temps, tellement ils se trouvaient dans l’impossibilité d’imaginer qu’ils pouvaient faire partie d’un plan génocidaire de masse. On a l’impression d’être revenus à cette époque et à ce genre d’éventualité inconcevable pour nous, mais cette fois à l’adresse du plus grand nombre : les « inutiles » !

« Hold-Up » est un révélateur en quelque sorte. Ce film démontre à quel point l’humanité occidentale a régressé ; à quel point la violence des dominants sur les dominés a été exacerbée ; à quel point le pouvoir et l’argent sont la plaie de ce monde…

« Vous ne réalisez pas à quel point il est difficile d’exposer la vérité dans un monde rempli de gens qui ne sont pas conscients de vivre dans le mensonge. » (Edward Snowden)

= = =

A voir, dernière analyse du Pr. Raoult sur la chute brutale de l’épidémie à Marseille ainsi que la fumisterie du Redemvisir, médicament inutile et dangereux, poussé à la vente par des intérêts bien particuliers:

Notre page “Coronavirus, guerre biologique contre l’humanité”

Visionner le documentaire Hold Up:

https://odysee.com/@laileastick:4/HOLD-UP-Le-film-documentaire-en-version-intégrale:8

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir !

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie


Esprit Gaulois…Esprit de Cheval Fou
Hoka Hey !