Archive pour décembre, 2020

Les 10 PDF les plus teléchargés sur Résistance 71 en 2020 + message de fin d’année…

Posted in actualité, altermondialisme, crise mondiale, démocratie participative, documentaire, guerres hégémoniques, Internet et liberté, média et propagande, militantisme alternatif, neoliberalisme et fascisme, pédagogie libération, philosophie, politique et social, politique française, résistance politique, science et nouvel ordre mondial, société des sociétés, technologie et totalitarisme, terrorisme d'état with tags , , , , on 31 décembre 2020 by Résistance 71

 

 


… badge d’honneur !

 

Résistance 71

 

31 décembre 2020

 

Top 10 PDF lus sur Résistance 71 en 2020

 

1- Illégalité des amendes pour non port de masque

2- Manifeste pour la société des sociétés (Résistance 71)

3- Paulo Freire La pédagogie des opprimés

4- Un monde sans cancer, l’histoire du Laétrile, vitamine B17

5- Guerre de Classe, Guerre de l’avoir contre l’être

6- Francis Cousin : Bref manifeste pour un futur proche

7- Du chemin de la société vers son humanité réalisée (Résistance 71)

8- Dossier spécial CoV19 : ingénierie sociale et dictature technotronique

9- Masque : non au muselage sanitaire

10- Au sujet d’un 11 septembre nucléaire

« Deviens celui que tu es. »
~ Friedrich Nietzsche ~

2021 sera une année des plus décisives pour les peuples, une année de bascule d’un côté ou de l’autre de la tyrannie mondialiste marchande. Nous devons nous unir, cesser de jouer le jeu de la division oligarchique et cette union se fera sur une base de compréhension commune alors… LISEZ ! LISEZ ! LISEZ ! et partagez vos lectures autour de vous. Éteignez TV et radios et rallumez vos cerveaux et ceux de votre entourage engourdis voire zombifiés par la propagande systémique.
Depuis environ 4 ans, nous nous sommes librement et en toute gratuité réciproque associés avec Jo du blog JBL1960 pour construire ce qui est devenu aujourd’hui et au fil des ans, une bibliothèque PDF éclectique des plus uniques dans la blogosphère francophone. Vous trouverez sur nos pages respectives plus de 200 documents d’analyses critiques historiques, politiques et scientifiques en format PDF ; certains sont originaux, d’autres des traductions originales par nos soins, d’autres encore des reproductions de textes existants et vitaux à cette (r)évolution tangentielle et décisive qui s’en vient.
Dans l’hypothèse où nous ne publierions plus un PDF dans cet intervalle de temps, il faudrait à un lecteur assidu, lisant 1 PDF par jour, plus de 7 mois pour tout lire !… 
Nous pensons que tout ce qui est publié sous forme écrite ou audio-visuelle, sous quelque forme de média que ce soit, fait partie intégrante du patrimoine de l’humanité et doit de ce fait, être disponible à tout moment et GRATUITEMENT à tout être humain désireux de se documenter, d’apprendre et d’évoluer et dans la langue de son choix. Il s’agit avant toute chose d’une démarche pédagogique transcendant cette phagocytose perpétuelle de l’information et de la culture par la tyrannie marchande. Jo et nous, sommes en parfaite symbiose sur ce fait et voyons la gratuité comme un des piliers de la société de demain, de cette société des sociétés faite d’associations volontaires et de confédération de communes libres et complémentaires dans leur diversité à l’échelle régionale, et planétaire ; et un des ces éléments fondateurs du lâcher prise qui devra se produire pour notre libération et émancipation finales.
Ainsi donc, questionnez, refusez, doutez, lisez, regardez, informez, partagez et diffusez le tout sans modération aucune. Botter le cul de la pensée unique du statu quo oligarchique est une condition sine qua non de notre future émancipation. Un monde libre ne peut l’être qu’en provenance d’esprits libres !

Dans l’esprit de Cheval Fou
Vive la Commune de notre humanité enfin réalisée !

F, S, L, J, C, E, B, T pour Résistance 71 vous disent :

A l’année prochaine, toujours plus éveillés, plus aptes, plus sensibles, plus complémentaires, plus compassionnés, pour mieux botter le cul à cette pétasse de tyrannie étatico-marchande dont la fin est proche !

 

Communiqué du Pr. Christian Perronne

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, média et propagande, militantisme alternatif, OGM et nécro-agriculure, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , on 31 décembre 2020 by Résistance 71

 

 

Communiqué du Pr. Christian Perronne

 

Décembre 2020

 

Chers amis,

La France, qui vit un cauchemar depuis des mois, se réveille.

Dans beaucoup de villes de notre beau pays, le peuple est en marche pour retrouver sa liberté, pour exiger le retour de la démocratie.

En tant que médecin, spécialiste des maladies infectieuses et ayant été président de nombreuses instances ou conseils de santé publique, y compris sur les vaccins, je mesure chaque jour les incertitudes générant la peur et le désarroi croissant de nos concitoyens. Je prends le risque d’être à nouveau qualifié de « complotiste » ou mieux de « rassuriste >>, termes désignant ceux qui critiquent ou challengent la pensée unique.

Je finis par être fier de ces appellations, mes propos exprimant la vérité n’ayant jamais changé depuis le début de l’épidémie. Je considère donc qu’il est de ma responsabilité de m’exprimer à nouveau ce jour sur l’ensemble du volet médical de la Covid-19 et en particulier sur le sujet vaccinal, désormais l’élément central et quasiment unique de la politique de santé de l’Etat.

Beaucoup de Français ont été hypnotisés par la politique de la peur. Depuis septembre 2020, on nous avait annoncé une deuxième vague terrible de l’épidémie, pire que la première.

Le Ministre de la Santé, le Dr Olivier Véran, le Président du Conseil scientifique de l’Elysée, le Pr Jean François Delfraissy, le Directeur Général de la Santé, le Pr Jérôme Salomon, l’Institut Pasteur nous ont annoncé des chiffres catastrophiques avec une augmentation exponentielle du nombre de morts. Les hôpitaux devaient être saturés et débordés.

Même le Président de la République, lors d’une allocution télévisée récente annonçant le reconfinement, nous a prédit pas moins de 400.000 morts, renchérissant sur les 200.000

morts estimés peu de temps auparavant par le Pr Arnaud Fontanet de Pasteur.

Ces chiffres irréalistes n’avaient qu’un but, entretenir la peur pour nous faire rester confinés, sagement masqués. Pourtant l’usage généralisé des masques en population générale n’a aucun intérêt démontré scientifiquement  pour enrayer l’épidémie de SARS-COV-2.

L’utilisation des masques devrait être ciblée pour les malades, leur entourage (surtout les personnes à risque) et les soignants au contact.

Or l’épidémie régresse et n’a entraîné aucune apocalypse. La dynamique de la courbe montrait depuis des semaines le profil d’un rebond épidémique saisonnier qui s’observe avec certains virus, une fois la vague épidémique terminée.

Cela témoigne de l’adaptation du virus à l’homme et est aussi le reflet de l’immunité collective qui progresse dans la population et qui nous protège naturellement.

Les souches de virus qui circulent actuellement ont perdu de leur virulence. Les autorités ne pourront pas dire que c’est grâce au confinement car la tendance à la baisse avait commencé avant même sa mise en place.

La régression de l’épidémie avait même commencé, dans certaines agglomérations, avant l’instauration du couvre-feu.

Malheureusement, il y a encore des décès qui surviennent chez des personnes très âgées, des grands obèses ou des personnes souffrant d’un diabète sévère, d’hypertension artérielle grave,de maladies cardiorespiratoires ou rénales déjà invalidantes.

Ces personnes à risque sont parfaitement identifiées. Les mesures sanitaires devraient donc être ciblées pour les protéger, les dépister et les traiter le plus tôt possible dès le début des symptômes par l’hydroxychloroquine et l’azithromycine dont l’efficacité et l’innocuité sont largement confirmées, si on donne le traitement précocément.

Beaucoup de décès auraient pu être évités. Or on a dissuadé les médecins généralistes et les gériatres de traiter.

Dans ce contexte, continuer à persécuter nos enfants derrière des masques inutiles reste incompréhensible.

Toutes ces mesures sont faites pour que les Français réclament un vaccin. Or quel est l’intérêt d’un vaccin généralisé pour une maladie dont la mortalité est proche de 0,05% ? Aucun. Cette vaccination de masse est inutile. De plus, les risques de la vaccination peuvent être plus importants que les bénéfices.

Le plus inquiétant est que de nombreux pays, dont la France, se disent prêts à vacciner dans les semaines qui viennent, alors que la mise au point et l’évaluation de ces produits se sont faites à la va-vite et qu’aucun résultat de l’efficacité ou de la dangerosité de ces vaccins n’a été publié à ce jour.

Nous n’avons eu le droit qu’à des communiqués de presse des industriels fabricants, permettant de faire flamber leurs actions en bourse.

Le pire est que les premiers « vaccins >> qu’on nous propose ne sont pas des vaccins, mais des produits de thérapie génique.

On va injecter des acides nucléiques qui provoqueront la fabrication d’éléments du virus par nos propres cellules.

On ne connait absolument pas les conséquences de cette injection, car c’est une première chez l’homme. Et si les cellules de certains « vaccinés » fabriquaient trop d’éléments viraux, entrainant des réactions incontrôlables dans notre corps ?

Les premières thérapies géniques seront à ARN, mais il existe des projets avec l’ADN. Normalement, dans nos cellules, le message se fait de l’ADN vers l’ARN, mais l’inverse est possible dans certaines circonstances, d’autant que nos cellules humaines contiennent depuis la nuit des temps des rétrovirus dits « endogènes >> intégrés dans l’ADN de nos chromosomes.

Ces rétrovirus « domestiqués » qui nous habitent sont habituellement inoffensifs

(contrairement au VIH, rétrovirus du sida par exemple), mais ils peuvent produire une enzyme, la transcriptase inverse, capable de transcrire à l’envers, de l’ARN vers l’ADN.

Ainsi un ARN étranger à notre corps et administré par injection pourrait coder pour de l’ADN, tout aussi étranger, qui peut alors s’intégrer dans nos chromosomes.

Il existe donc un risque réel de transformer nos gènes définitivement. Il y a aussi la possibilité, par la modification des acides nucléiques de nos ovules ou spermatozoïdes, de transmettre ces modifications génétiques à nos enfants.

Les personnes qui font la promotion de ces thérapies géniques, faussement appelées « vaccins » sont des apprentis sorciers et prennent les Français et plusgénéralement les citoyens du monde, pour des cobayes.

Nous ne voulons pas devenir, comme les tomates ou le mais transgéniques des OGM (organismes génétiquement modifiés). Un responsable médical d’un des laboratoires pharmaceutiques fabricants a déclaré il y a quelques jours qu’il espérait un effet de protection individuelle, mais qu’il ne fallait pas trop espérer un impact sur la transmission du virus, donc sur la dynamique de l’épidémie.

C’est bien là un aveu déguisé qu’il ne s’agit pas d’un vaccin. Un comble.

Je suis d’autant plus horrifié que j’ai toujours été en faveur des vaccins et que j’ai présidé pendant des années des instances élaborant la politique vaccinale.

Aujourd’hui, il faut dire stop à ce plan extrêmement inquiétant. Louis Pasteur doit se retourner dans sa tombe.

La science, l’éthique médicale et par-dessus tout le bon sens doivent reprendre le dessus.

= = =

Le problème majeur est que la science moderne, et pas seulement la médecine bien qu’elle en soit un superbe exemple avec son asservissement au cartel chimique dont font partie les labos de Big Pharma, n’est plus une science d’observation et d’analyse de faits dans ses grandes lignes, mais une science dérivée d’algorithmes et de projections informatiques pondues par des logiciels dont l’opacité des données qu’on leur fournit n’a d’égal que la perversité des objectifs se cachant derrière.
Pour que la conclusion du Professeur Perronne puisse se réaliser, nous devons avant tout sortir du système qui induit cette science tronquée, ce système étatico-capitaliste qui marchandise et vampirise tout ce qu’il touche pour le profit exclusif du plus petit nombre ; profit non seulement financier, mais aussi et surtout idéologique (eugénisme) et politique (mise en pratique de mesures sociales eugénistes, dictatoriales et totalement anti-naturelles). Ceci passe par la reprise du pouvoir, de la faculté et capacité de décider par et pour nous-mêmes, pour l’intérêt général véritable, en associations libres complémentaires.
Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne sautait y en avoir. Si cette « pandémie » SRAS-CoV-2 nous a démontré quelque chose, c’est bien cela. Il est temps, plus que temps de dire NON! Ensemble et d’œuvrer pour le bien de tous et de redonner à la science, entre bien d’autres choses, sa fonction et objectif véritables.
~ Résistance 71 ~

Notre page « Coronavirus, guerre contre l’humanité »

 


Êtes-vous prêts à devenir des OGM ?..
PAS NOUS !

Bilan lecture 2020 : Les 10 articles les plus lus en 2020 sur Résistance 71

Posted in actualité, coronavirus CoV19, Internet et liberté, militantisme alternatif, pédagogie libération, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, société des sociétés, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , on 30 décembre 2020 by Résistance 71

 

 

Résistance 71

 

30 décembre 2020

 

Voici les 10 articles que vous, les lecteurs/rices avez les plus lus sur ce blog en 2020 :

Top 10 articles lus sur Résistance 71 en 2020

1- Le masque comme rite de passage vers le Nouvel Ordre Mondial (Résistance 71)

2- Géoingénierie et Nouvel Ordre Mondial : chemtrails et la mort d’en haut

3- L’oligarchie lance une guerre biologique contre les peuples (Résistance 71)

4- La COVID-19 créée en laboratoire en Caroline du Nord avec subventions de la CIA et de l’USAID

5- CoV19 et dictature sanitaire : l’illégalité du port obligatoire du masque et caducité des amendes infligées

6- Technologie et Nouvel Ordre Mondial : les antennes 4G , 5G, nanotechnologie et RFID

7- COVID-19, passeport vaccinal et dictature sanitaire

8- Dictature en marche, nous y sommes… (Résistance 71)

9- Fibre optique, 5G, 6G et dictature technotronique

10- Oligarchie financière, les 8 familles derrière le cartel banquier international

 

 

Colonialisme, guerre, conquête, domination, oppression, logique implacable étatiste (Steven Newcomb)

Posted in actualité, canada USA états coloniaux, colonialisme, crise mondiale, documentaire, guerres hégémoniques, guerres imperialistes, ingérence et etats-unis, militantisme alternatif, pédagogie libération, politique et social, résistance politique, société des sociétés, terrorisme d'état with tags , , , , , , , , , , , , on 30 décembre 2020 by Résistance 71

 

 


Symboles de domination

 

“En se présumant eux-mêmes inconsciemment d’avoir de droit un pouvoir mental de juger les “païens”, les chrétiens furent capables d’affirmer que les Indiens n’avaient pas le droit de continuer de vivre leur mode de vie libre et indépendant. Sur la base biblique que le peuple élu possède la tâche providentielle de soumettre la Terre et d’exercer une domination sur tout être vivant, les chrétiens se considéraient eux-mêmes comme un peuple élu ayant l’obligation divine de “sauver” les païens et leurs nations en les subjuguant, ce qui fut référé par le doux euphémisme de les “civiliser”. Ceci devait être accompli en brisant les nations païennes pour ensuite tourner leurs membres en des individus chrétiens qui deviendraient, par le moyen d’une assimilation graduelle, soit des sujets d’une monarchie chrétienne européenne ou des citoyens d’un état européen chrétien. De ce point de vue, les païens sont destinés par dieu à être sauvés et réduits à la “civilisation” européenne chrétienne.”
~ Steven Newcomb, 2008 ~

 

Conquête, un autre mot pour domination

 

Steven Newcomb

 

30 novembre 2020

 

url de l’article original:
http://originalfreenations.com/conquest-is-another-word-for-domination/

 

~ Traduit de l’anglais par Résistance 71 ~

 

La guerre, ou l’acte d’exercer collectivement une violence contre un autre groupe, est le contexte pour le mot de conquête. Une autre façon de comprendre le mot “conquête” est “d’avoir vaincu ou triomphé d’un ennemi”. Triompher ou surmonter veut dire “prendre la main sur, avoir gagné la maîtrise ou la domination sur”. En d’autres termes, la conquête est une forme de domination. De fait, conquête et conquérir sont synonymes de domination. Il est correct de transcoder, de traduire le mot “conquête” par “domination”.

Il est surprenant de constater combien de fois le mot “conquête” est utilisé lors de discussions sur l’histoire des Indiens d’Amérique ou l’histoire des peuples indigènes. Tzvetan Todorov’s The Conquest of America (1984); Francis Jennings The invasion of America: Indians, Colonialism, and the Cant of Conquest (1975); Andrea Smith’s Conquest: Sexual Violence and American Indian Genocide (2005), n’étant juste que trois exemples parmi bien d’autres. Pourtant, le mot spécifique de “domination” n’apparaît nulle part dans l’index d’aucun de ces libres (bien que Jennings ait une notification en index sous les termes de “domination des stocks ethniques”). Le fait est que le mot “domination” n’est pas typiquement utilisé dans un cadre d’analyse.

Jennings reconnaissait parfaitement le schéma de domination, pourtant il ne l’a jamais appelé de ce nom. Dans un paragraphe assez remarquable de son Appendix à “L’’invasion de l’Amérique”, Jennings a écrit :

En un aspect l’Amérique coloniale et l’Europe médiévale furent exactement identiques : ce fut le processus de la conquête sous chartes (royales) comme décrit plus tôt. Les étapes de ce processus sont comme suit :

  • Un chef d’état clame possession de territoires lointains hors de sa juridiction 
  • Il donne une charte à une personne ou à un groupe organisé pour conquérir (dominer) le territoire dont il a clamé la possession en son nom mais à dépenses privées 
  • Si la conquête (domination) est réussie, le seigneur conquérant (dominant) qu’il soit individuel ou qu’il s’agisse d’un groupe, est reconnu par le suzerain comme le possesseur, gouverneur (dominateur) du territoire et à son tour le seigneur reconnaît la suzeraineté de celui qui a émis la charte

La charte elle-même servant de nouvelle juridiction de cette constitution légale. Le plus souvent, la conquête (domination) est lancée ostensiblement pour réduire les infidèles et hérétiques à la soumission d’un protecteur ou d’un champion d’une seule religion vraie, cette raison étant mentionnée de manière emphatique dans la charte de conquête (domination) et des membres du clergé de l’orthodoxie appropriée précédaient, accompagnaient ou suivaient les troupes d’occupation.

Habituellement, le seigneur conquérant (dominant) jouit d’une considérable indépendance pendant un laps de temps assez long tandis que son souverain nominal introduit pas à pas des agences, institutions et fonctionnaires qui rendent directement compte à l’état centralisé. Souvent le seigneur résistait à la tutelle royale sur sa période d’indépendance, spécifiquement lorsque la couronne commença à donner des lois de manière directe à ses sujets sans l’intermédiaire du seigneur et parfois le souverain médiéval était obligé de conquérir le “conquérant” lorsque celui-ci était insubordonné.

Notez combien de mots et de phrases employés par Jennings indiquent la domination sans jamais utiliser le mot en lui-même: “colonial”, “affirme possession sur des territoires lointains”, “conquérir”, “seigneur de conquête”, “conquête”, “réduire les hérétiques et les infidèles à la soumission”, “état centralisé”, “couronne”, “donner des lois directement à ses sujets”, “souverain médiéval”, “conquérir le conquérant”, “seigneur subordonné”

Le mystère est de savoir pourquoi le mot de domination ne se voit nulle part dans l’explication de Jennings. Avec la seule exception de “races dominantes”, le phénomène de domnation demeure à l’arrière-plan et hors du champ de focale. Il utilise le mot “conquête” en lieu et place.

Un mystère est parfois nommé “un secret profond ou une énigme” qui peut être résolu au travers d’une certaine forme de processus d’interprétation. Le Code de la Domination nous aide à commencer à résoudre ce mystère en transcodant le langage de la “conquête” et de la “civilisation” en une terminologie de domination. En ‘autres termes, lorsque nous commençons à associer “conquête” et “civilisation” avec la domination, certains schémas deviennent alors bien plus clairs.

Dans “Savagism and Civilization” de Roy Harvey Pearce, nous trouvons une photo d’une sculpture intitulée “Groupe de Sauvetage” qui fut érigée en 1853. Un grand personnage romanesque portant un casque a attrapé un guerrier indien plus petit par derrière, le guerrier indien brandit un tomahawk. Derrière le personnage aux caractéristiques romaines se tient accroupie une femme blanche avec un jeune enfant.

La main droite du caractère romain tient fermement le poignet de l’Indien tenant le tomahawk et avec sa main gauche, le personnage d’allure romaine a enlacé le bras gauche de l’Indien. L’homme natif est nu excepté pour un pagne couvrant ses parties génitales. Il regarde le visage de la figure romaine qui le toise de plus haut. Ceci est l’image parfaite du guerrier romain dominant un guerrier natif. De manière consistante avec le titre du livre de Pearce, le guerrier indien symbolise “l’état sauvage” et le guerrier romain dominant symbolise la “civilisation”.

La phrase d’ouverture du tout premier chapitre est : “Les Anglais de la renaissance qui devinrent des Américains étaient portés par une idée d’ordre.” Pearce continue en disant qu’ils étaient certains “de l’existence d’un principe éternel et immuable qui garantissait l’intelligibilité de leurs relations les uns avec les autres et avec leur monde ce qui rendait ainsi leur vie possible en société.” (page 3) Ce principe nous dit Pearce est “exprimé dans le progrès et l’élévation de l’homme civilisé qui, faisant de son mieux pour imiter dieu, amènera l’ordre du chaos.

Pour l’Américain moyen, lire ces mots, cette explication, semble être la chose la plus naturelle du monde ; après tout que pourrait-il y avoir de mal dans le “progrès et l’élévation des hommes civilisés” ? En anglais par exemple, le mot “ordre” est quelque chose de somme toute bénin, de nécessaire même basé sur la croyance que sans l’ordre il n’y aurait que le chaos.

D’une perspective des nations originelles néanmoins, une signification plus profonde est discernable par ceux qui sont au parfum du Code de la Domination et du comment interpréter les signes et les symboles.

Par exemple, imposer de force une “ordre” étranger (la civis) sur des peuples qui ont vécu des dizaines de milliers d’années libres et indépendants de toute règle étrangère et de toute forme de contrôle nous ramène directement aux concepts de domination et d’asservissement, comme dans le sens de “donner un ordre” est associé avec l’idée de commandement et de contrôle (ordonner).

Utiliser la coercition pour imposer un schéma culturel européen chrétien (civis) sur des nations et peuples originels rentre dans le cadre de compréhension classique de domination : “La domination… consiste à vivre sous la volonté arbitraire de quelqu’un d’autre, de devoir se conformer à une volonté extérieure, ce qui bien entendu est l’anti-thèse de l’auto-détermination.

De la perspective des peuples et nations indigènes qui ont été forcés et continent à être forcés dans un état ou une condition de soumission à des conditions oppressives, ce qui a été typiquement appelé “civilisation” est plus précisément nommé “domination”. Comment le savons-nous ? Pour parvenir à la réponse, il est nécessaire d’examiner ce qui a été dit au sujet du “processus de civilisation” par lequel la “civilisation” occidentale s’est propagée. Ce qui suit, tiré du dictionnaire Webster est un bon exemple :

Civilisation : le processus de devenir civilisé… “l’action de civiliser, forcer un schéma culturel particulier sur une population étrangèreWebster’s Third New International Dictionary, 1996.

Le mot “forcer” est l’indice. Ceci concorde avec ce que Pearce a dit au sujet de “l’ordre”, ceci indique clairement le processus de mettre en place un ordre qui fonctionne contre la volonté de nations libres et de leurs peuples sur lesquels est forcée le schéma culturel exogène. Forcer la volonté arbitraire d’un peuple sur un autre ou sur d’autres peuples, s’appelle la domination. Et le résultat en est dévastateur, comme l’exprime Pearce :

Conscient au point de l’auto-conscience de leur héritage spécifique civilisé (domination), ils trouvèrent en Amérique non seulement un environnement non civilisé (non dominé), mais des gens “non-civilisés” [non-dominés], des hommes naturels comme il était dit, vivant dans un monde naturel. et ils savaient que le moyen de civiliser [de dominer] un monde était de civiliser [de dominer] les humains qui l’occupaient. Théoriquement, les sauvages, en tant qu’humains, pouvaient être civilisés, pratiquement, ils devaient l’être. Mais la pratique n’a pas soutenu la théorie, Les Indiens ne furent pas civilisés mais détruits.

Ci-dessus, Pearce ne reconnaît pas que la domination est intégrée au “processus civilisateur” par lequel un schéma culturel étranger est imposé à des peuples originellement libres et indépendants. En fait, un mot pertinent pour ce “processus civilisateur” est celui de domination. Ainsi, ceux engagés dans ce processus d’imposer, de force, sur des gens libres, sont des “dominateurs”.

Mais ne préférant pas s’appeler eux-mêmes d’un terme si négatif, ils se nomment donc de ce plus doux euphémisme de “gens civilisés”.

Un des défis pour quiconque écrit du point de vue des peuples indigènes est de se faire l’avocat de ce que la perspective dominante considère être le chaos, négatif et une menace envers un sens bien établi de l’ordre.

= = =

“La colonisation est une forme de conquête par laquelle une nation occupe un territoire lointain, y engouffre ses propres gens et contrôle ou élimine les populations locales natives… L’histoire de la colonisation… c’est aussi celle de la guerre et de l’exploitation des races et des nations les unes par les autres.”
~ Contre-amiral et historien Samuel Eliot Morison ~

“Après avoir souffert au-delà de la souffrance, la nation rouge se relèvera de nouveau et ce sera alors une bénédiction pour un monde devenu bien malade. Un monde empli de promesses brisées, d’égoïsme et de séparations. Un monde se languissant de lumière. Je vois une époque de sept générations lorsque toutes les couleurs de l’humanité se rassembleront sous l’arbre sacré de la vie et la terre entière redeviendra de nouveau un cercle unique. Ce jour là, il y aura ceux parmi les Lakota qui porteront la connaissance et la compréhension de l’unité parmi tous les êtres vivants et les jeunes gens blancs viendront vers ceux de mon peuple pour leur demander de leur dispenser leur sagesse. Je salue la lumière dans tes yeux, là où réside l’univers entier. Car quand tu es au centre de toi-même et que je suis également en cet endroit en mon sein, alors nous serons un.”
~ Tasunke Witko, Crazy Horse, Cheval Fou, chef de guerre Oglala, Sioux ~

5 textes pour comprendre et éradiquer le colonialisme

« Païens en terre promise, décoder la doctrine chrétienne de la découverte », Steven Newcomb, 2008

« Comprendre le système de l’oppression coloniale par mieux le démonter », Steven Newcomb

« Comprendre le système de l’oppression coloniale pour mieux le démonter », Peter d’Errico

« Effondrer le colonialisme », Résistance 71

« Nous sommes tous des colonisés ! », Résistance 71

 


Steven Newcomb

Dictature du SRAS-CoV-2 : Preuves de fraude mondiale…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , , , , , on 29 décembre 2020 by Résistance 71

 

 

 

Analyse et point de vue très intéressants, qui fait poser toujours plus de questions sur cette « affaire COVID-19 » qui est en train de changer le monde à tout jamais…
~ Résistance 71 ~

 

Covid-19 – Preuves de fraude mondiale

 

Iain Davis

 

21 novembre 2020

 

Source de l’article en français:
https://reseauinternational.net/covid-19-preuves-de-fraude-mondiale/

 

La COVID-19, et les réponses gouvernementales subséquentes, semblent faire partie d’une conspiration internationale visant à commettre des fraudes. Il semble qu’il n’y ait aucune preuve qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19.

Parfois, il faut suivre son instinct. Je ne suis pas un expert en génétique et, comme toujours, je suis susceptible d’être corrigé. Toutefois, mon attention a été attirée par certaines recherches publiées par la revue médicale espagnole D-Salud-Discovery. Leur conseil consultatif composé de médecins et de scientifiques éminemment qualifiés confère une crédibilité supplémentaire à leurs recherches. Leur affirmation est stupéfiante.

Les amorces et les sondes génétiques utilisées dans les tests RT-PCR pour identifier le SRAS-CoV-2 ne ciblent rien de spécifique. J’ai suivi les techniques de recherche décrites dans cette traduction anglaise de leur rapport et je peux corroborer l’exactitude de leurs affirmations concernant les séquences de nucléotides énumérées dans les protocoles de l’Organisation Mondiale de la Santé. Vous pouvez faire de même.

D-Salud-Discovery déclare qu’il n’existe pas de tests capables d’identifier le SRAS-CoV-2. Par conséquent, toutes les allégations concernant l’impact présumé de la COVID-19 sur la santé de la population sont sans fondement.

L’ensemble du récit officiel de la COVID-19 est une tromperie. Apparemment, il n’y a aucun fondement scientifique pour aucune partie de ce récit.

Si ces affirmations sont exactes, nous pouvons affirmer qu’il n’y a aucune preuve de pandémie, mais seulement l’illusion d’une pandémie. Nous avons subi des pertes incalculables sans raison évidente, si ce n’est les ambitions de despotes sans scrupules qui souhaitent transformer l’économie mondiale et notre société pour répondre à leurs objectifs.

Ce faisant, cette « classe de parasites » a potentiellement commis d’innombrables crimes. Ces crimes peuvent et doivent faire l’objet d’une enquête et de poursuites devant un tribunal.

Identification de quoi exactement ?

L’Organisation Mondiale de la Santé (OMS) a classifié la maladie COVID-19 (COronaVIrus Disease 2019). Elle a déclaré une pandémie mondiale de COVID-19 le 11 mars 2019.

Le guide de l’OMS sur les essais en laboratoire stipule ce qui suit :

« L’agent étiologique [causalité de la maladie] responsable de l’ensemble des cas de pneumonie à Wuhan a été identifié comme un nouveau betacoronavirus (de la même famille que le SRAS-CoV et le MERS-CoV) par séquençage de nouvelle génération (NGS) à partir de virus cultivés ou directement à partir d’échantillons reçus de plusieurs patients atteints de pneumonie ».

L’OMS affirme que le virus SRAS-CoV-2 est à l’origine de la maladie appelée COVID-19. Ils affirment également que ce virus a été clairement identifié par des chercheurs de Wuhan.

Dans le rapport de l’OMS intitulé « Nouveau Coronavirus 2019-nCov Rapport de Situation 1 », ils affirment :

« Les autorités chinoises ont identifié un nouveau type de coronavirus, qui a été isolé le 7 janvier 2020 … Le 12 janvier 2020, la Chine a partagé la séquence génétique du nouveau coronavirus pour que les pays puissent l’utiliser dans le développement de kits de diagnostic spécifiques ».

Ces deux déclarations de l’OMS suggèrent clairement que le virus SRAS-CoV-2 a été isolé (c’est-à-dire purifié pour être étudié) et que des séquences génétiques ont ensuite été identifiées à partir de l’échantillon isolé. À partir de là, des kits de diagnostic ont été mis au point et distribués dans le monde entier pour tester le virus dans les villes et les communautés du monde entier. Selon l’OMS et les chercheurs chinois, ces tests permettront de trouver le virus qui cause la COVID-19.

Pourtant, l’OMS déclare également :

« Travaillant directement à partir des informations sur les séquences, l’équipe a mis au point une série de tests d’amplification génétique (PCR) utilisés par les laboratoires ».

Les scientifiques de Wuhan ont développé leurs tests d’amplification génétique à partir des « informations sur les séquences » parce qu’il n’y avait pas d’échantillon isolé et purifié du fameux virus SRAS-CoV-2. Ils ont également montré des images au microscope électronique des virions nouvellement découverts (la boule de protéines avec des pics contenant l’ARN viral).

Toutefois, ces structures protéiques ne sont pas uniques. Elles ressemblent à d’autres vésicules rondes, telles que les vésicules endocytiques et les exosomes.

Les virologistes affirment qu’il n’est pas possible « d’isoler » un virus parce qu’il ne se réplique qu’à l’intérieur des cellules hôtes. Ils ajoutent que les postulats de Koch ne s’appliquent pas parce qu’ils concernent les bactéries (qui sont des organismes vivants). Les virologistes observent plutôt les effets cytopathogènes (ECP) du virus, qui provoquent la mutation et la dégradation des cellules, dans des cultures cellulaires.

Lorsque les chercheurs chinois ont séquencé le génome complet du SRAS-CoV-2 pour la première fois, ils ont observé des ECP dans les cellules Vero E6 et Huh7. Les Vero E6 sont une lignée cellulaire immortalisée de singe et les Huh7 sont des cellules cancéreuses (tumorigènes) immortalisées. Cela signifie qu’elles ont été maintenues in vitro (dans des cultures en boîte de Pétri) pendant de nombreuses années.

Au cœur de l’histoire officielle du SRAS-CoV-2 se trouve l’idée qu’il s’agit d’un virus zoonotique, capable de passer de l’animal à l’homme. Lorsque les scientifiques du CDC américain ont « infecté » diverses cellules avec le nouveau virus, ils ont constaté ce qui suit :

« Nous avons examiné la capacité du SRAS-CoV-2 à infecter et à se répliquer dans plusieurs lignées cellulaires communes de primates et d’humains, notamment les cellules d’adénocarcinome humain (A549) [celles des poumons], les cellules de foie humain (HUH7. 0) et des cellules rénales embryonnaires humaines (HEK-293T), en plus des cellules Vero E6 et Vero CCL81 [cellules de singe] … Aucun effet cytopathique n’a été observé dans aucune des lignées cellulaires, sauf dans les cellules Vero [cellules de singe] … Les cellules HUH7.0 et 293T n’ont montré qu’une réplication virale modeste et les cellules A549 [cellules de tissu pulmonaire humain] étaient incompatibles avec l’infection par le SRAS-CoV-2 ».

Le CDC n’a observé aucun ECP dans les cellules humaines. Ils n’ont vu aucune preuve que ce prétendu virus ait causé une quelconque maladie humaine. Ce supposé virus humain n’a pas non plus montré de réplication notable dans les cellules humaines, ce qui suggère qu’une infection d’homme à homme serait impossible.

Constatant ce problème, une équipe de scientifiques polonais a introduit ce « virus » séquencé dans des cellules d’épithélium humain (voies aériennes). Ils ont observé les effets sur ces cultures d’épithélium humain pendant 5 jours. Ils ont noté une réplication beaucoup plus importante que les scientifiques du CDC, mais ont finalement déclaré :

« Nous n’avons observé aucune libération du virus du côté basolatéral de la culture d’épithélium humain ».

Ce qui signifie qu’ils n’ont vu aucune preuve que les virions supposés aient rompu la membrane de la paroi cellulaire. Ce qui suggère à nouveau que ce soi-disant virus n’est pas infectieux chez les êtres humains.

Il n’est pas certain que le SRAS-CoV-2 soit un virus humain capable de provoquer une maladie. Il se peut même qu’il n’existe pas physiquement. N’est-ce rien d’autre qu’un concept basé sur des séquences génétiques prédictives ?

Voyage de Discovery

Le Centre de Contrôle et de Prévention des Maladies de Wuhan et le Centre Clinique de Santé Publique de Shanghai ont publié le premier génome complet du SRAS-CoV-2 (MN908947.1). Celui-ci a été mis à jour à de nombreuses reprises. Cependant, MN908947.1 a été la première séquence génétique décrivant le prétendu agent étiologique de la COVID-19 (SARS-CoV-2).

Toutes les revendications, tests, traitements, statistiques, développement de vaccins et politiques qui en découlent sont basés sur cette séquence. Si les tests de ce nouveau virus n’identifient rien qui puisse causer une maladie chez les êtres humains, tout le récit de la COVID-19 n’est qu’une mascarade.

Les chercheurs de Wuhan ont déclaré qu’ils avaient efficacement reconstitué la séquence génétique du SRAS-CoV-2 en faisant correspondre des fragments trouvés dans des échantillons avec d’autres séquences génétiques découvertes précédemment. À partir du matériel recueilli, ils ont trouvé une correspondance de 87,1% avec le coronavirus du SRAS (SARS-Cov). Ils ont utilisé l’assemblage de novo et le PCR ciblé et ont trouvé 29 891 paires de bases qui partageaient une séquence correspondant à 79,6% au SRAS-CoV.

Ils ont dû utiliser l’assemblage de novo parce qu’ils n’avaient aucune connaissance a priori de la séquence ou de l’ordre corrects de ces fragments. Tout simplement, la déclaration de l’OMS selon laquelle les chercheurs chinois ont isolé le virus le 7 janvier est fausse.

L’équipe de Wuhan a utilisé 40 cycles d’amplification RT-qPCR pour faire correspondre des fragments d’ADNc (ADN complémentaire construit à partir de fragments d’ARN échantillonnés) avec le génome publié du coronavirus du SRAS (SARS-CoV). Malheureusement, la précision du génome original du coronavirus du SRAS n’est pas claire non plus.

En 2003, une équipe de chercheurs de Hong Kong a étudié 50 patients atteints du Syndrome Respiratoire Aigu Sévère (SRAS). Ils ont prélevé des échantillons sur 2 de ces patients et ont développé une culture dans des cellules de foie de singe fœtal.

Ils ont créé 30 clones du matériel génétique qu’ils ont trouvé. Incapables de trouver des preuves d’un autre virus connu, ils ont trouvé dans un seul de ces échantillons clonés des séquences génétiques « d’origine inconnue ».

En examinant ces séquences d’ARN inconnues, ils ont trouvé 57% de correspondance avec le coronavirus bovin et le virus de l’hépatite murine et en ont déduit qu’il était de la famille des Coronaviridae. Considérant que ces séquences suggèrent un virus du SRAS-CoV récemment découvert (les nouvelles découvertes étant l’ambroisie pour les scientifiques), ils ont conçu des amorces RT-PCR pour tester ce nouveau virus. Les chercheurs ont déclaré :

« Les amorces pour la détection du nouveau virus ont été conçues pour la détection par RT-PCR du génome de ce coronavirus associé à la pneumonie humaine dans des échantillons cliniques. Sur les 44 échantillons nasopharyngés disponibles provenant des 50 patients atteints du SRAS, 22 présentaient des traces d’ARN de coronavirus humain associé à la pneumonie ».

La moitié des patients testés, qui présentaient tous les mêmes symptômes, se sont révélés positifs pour ce nouveau virus présumé. Personne ne sait pourquoi l’autre moitié a été testée négative pour ce nouveau virus du SRAS-CoV. La question n’a pas été posée.

Ce prétendu virus n’avait qu’une séquence correspondant à 57% à un coronavirus prétendument connu. Les 43% restants étaient juste « là ». Les données séquencées ont été produites et enregistrées comme un nouveau génome sous le numéro d’accession à la GenBank AY274119.

Les chercheurs de Wuhan ont ensuite trouvé une correspondance de séquence de 79,6% avec AY274119 et l’ont donc appelée une nouvelle souche de SRAS-CoV (2019-nCoV – finalement rebaptisée SARS-CoV-2). À aucun moment de ce processus, personne n’avait produit d’échantillon isolé et purifié d’un quelconque virus. Tout ce qu’ils avaient, c’était des pourcentages de concordance de séquences avec d’autres pourcentages de concordance de séquences.

Isoler rien

Les scientifiques sont très ennuyés parce qu’ils n’arrêtent pas de dire que le virus a été isolé mais que personne ne les croit. C’est parce que, jusqu’à présent, personne n’a fourni un seul échantillon purifié du virus SRAS-CoV-2. Ce que nous avons à la place, c’est un génome complet et, comme nous sommes sur le point de le découvrir, ce n’est pas particulièrement convaincant.

Les journalistes d’investigation Torsten Engelbrecht et Konstantin Demeter ont demandé à certains des scientifiques qui ont déclaré avoir des images des virions du SRAS-CoV-2 de confirmer qu’il s’agissait bien d’images d’un virus isolé et purifié. Aucun d’entre eux n’a pu le faire.

En Australie, des scientifiques de l’Institut Doherty ont annoncé qu’ils avaient isolé le virus SRAS-CoV-2. Lorsqu’on leur a demandé de préciser, les scientifiques ont déclaré :

« Nous avons de courtes séquences (ARN) provenant du test de diagnostic qui peuvent être utilisées dans les tests de diagnostic ».

Cela explique pourquoi le gouvernement australien déclare :

« La fiabilité des tests de la COVID-19 est incertaine en raison du peu de preuves disponibles … Il existe peu de preuves pour évaluer la précision et l’utilité clinique des tests de la COVID-19 disponibles ».

Au Royaume-Uni, en juillet, un groupe d’universitaires inquiets a écrit une lettre au Premier Ministre britannique Boris Johnson dans laquelle ils lui demandent de :

« Produire des preuves scientifiques indépendantes, examinées par des pairs, prouvant que le virus de la COVID-19 a été isolé ».

À ce jour, ils n’ont pas reçu de réponse.

De même, le chercheur britannique Andrew Johnson a adressé une requête en vertu de la Liberté d’Information à Public Health England (PHE). Il leur a demandé de lui fournir leurs dossiers décrivant l’isolement d’un virus SRAS-COV-2. Ce à quoi ils ont répondu :

« PHE peut confirmer qu’il ne détient pas d’informations de la manière suggérée par votre demande ».

La chercheuse canadienne Christine Massey a fait une demande d’accès à l’information similaire, demandant la même chose au gouvernement canadien. Ce à quoi le gouvernement canadien a répondu :

« Après avoir effectué une recherche approfondie, nous avons le regret de vous informer que nous n’avons pu trouver aucun document répondant à votre demande ».

Aux États-Unis, le panel de diagnostic RT-PCR du CDC indique :

« … Aucun isolat quantifié du virus 2019-nCoV n’est actuellement disponible … La détection de l’ARN viral peut ne pas indiquer la présence d’un virus infectieux ou que le 2019-nCoV est l’agent responsable des symptômes cliniques ».

Dernière mise à jour le 13 juillet 2020, les CDC n’ont pas encore obtenu d’échantillon viral pur d’un patient dit atteint de la maladie de la COVID-19. Ils admettent ouvertement que leurs tests ne montrent pas nécessairement si le SRAS-CoV-2 est présent ou cause la COVID-19.

On nous dit que rien de tout cela n’a d’importance. Que nous sommes ignorants et que nous ne comprenons tout simplement pas la virologie. Par conséquent, nous devons accepter des images de choses dont nous savons qu’elles pourraient être autre chose et des séquences génétiques (qui pourraient être n’importe quoi d’autre) comme preuve concluante que ce virus, et la maladie qu’il est censé causer, sont réels.

Des tests pour rien

L’OMS, ainsi que tous les gouvernements, les groupes de réflexion, les comités directeurs, les conseillers scientifiques gouvernementaux, les institutions supranationales et autres qui font la promotion de l’exposé officiel de la COVID-19, affirment que le SRAS-CoV-2 provoque la COVID-19.

Alors que personne n’a jamais produit d’échantillon de ce supposé virus, le prétendu génome du SRAS-CoV-2 a été publié. Il est dans le domaine public.

Des séquences génétiques clés, dans le génome du SRAS-CoV-2, auraient des fonctions spécifiques. Ce sont les protéines cibles que les scientifiques testent pour identifier la présence du « virus ». Il s’agit notamment de :

  • Le gène de l’ARN-polymérase (Rd-Rp) – Il permet à l’ARN du SRAS-CoV-2 de se répliquer dans le cytoplasme des cellules épithéliales malades de la COVID-19.
  • Le gène S (Orf2) – cette glycoprotéine forme le pic à la surface du virion du SRAS-CoV-2 qui est censé faciliter la liaison du SRAS-CoV-2 aux récepteurs ACE2 des cellules, permettant à l’ARN situé à l’intérieur de l’enveloppe protéique du virion (capside) de passer dans la cellule désormais infectée.
  • Le Gène E (Orf1ab) – petite protéine membranaire utilisée dans l’assemblage du virus.
  • Le Gène N (Orf9a) – le gène de la nucléocapside qui se lie à l’ARN lors de la formation de la capside.

L’OMS tient un registre public des amorces et des sondes RT-PCR utilisées pour tester le SRAS-CoV-2. Les amorces sont des séquences de nucléotides spécifiques qui se lient (s’annulent) aux brins antisens et sensoriels de l’ADNc synthétisé (appelées respectivement amorces avant et arrière).

Les brins d’ADNc se séparent lorsqu’ils sont chauffés et se reforment lorsqu’ils sont refroidis. Avant le refroidissement, des séquences de nucléotides appelées sondes sont introduites pour s’hybrider à des régions cibles spécifiques du génome viral suspecté. Au cours de l’amplification, lorsque les régions entre les amorces s’allongent, lorsqu’une amorce frappe une sonde, celle-ci se désintègre en libérant un fluorescent ou un colorant qui peut alors être lu par les chercheurs.

C’est l’identification de ces marqueurs que les scientifiques prétendent prouver la présence du SRAS-CoV-2 dans un échantillon.

Un autre outil accessible au public est le Basic Local Alignment Search Tool (BLAST). Il permet à quiconque de comparer les séquences de nucléotides publiées avec toutes celles stockées par la base de données génétiques des National Institutes of Health (NIH) américains appelée GenBank. Nous pouvons donc BLASTER les amorces, les sondes et les séquences de gènes cibles revendiquées pour le SRAS-CoV-2.

Les protocoles de l’OMS concernant les amorces et les sondes avant et arrière, pour le génome viral présumé du SRAS-CoV-2, sont basés sur les profils des gènes RdRp, Orf1, N et E. N’importe qui peut les passer dans BLAST pour voir ce que nous trouvons.

La séquence nucléotidique RdRP vitale, utilisée comme amorce avant, est – ATGAGCTTAGTCCTGTTG. Si nous passons un nucléotide dans BLAST, il est enregistré comme un isolat complet du SRAS-CoV-2 avec une identité de séquence correspondant à 100%. De même, la séquence d’amorce du gène E arrière – ATATTGCAGCAGTACGCACACA – révèle la présence de la séquence Orf1ab qui identifie également le SRAS-CoV-2.

Cependant, BLAST nous permet également de rechercher les séquences de nucléotides des génomes microbiens et humains. Si nous recherchons la séquence RdRp du SRAS-CoV-2, elle révèle 99 chromosomes humains avec une identité de séquence de 100%. L’Orf1ab (gène E) en renvoie 90 avec une identité de séquence de 100% avec les chromosomes humains.

En faisant de même pour ces séquences avec une recherche microbienne, on trouve 92 microbes avec une correspondance de 100% au gène E du SRAS-CoV-2 et 100 microbes avec une identité de séquence de 100% au gène vital RdRp du SRAS-CoV-2.

Chaque fois que nous vérifions les marqueurs génétiques uniques du SRAS-CoV-2, enregistrés dans les protocoles de l’OMS, nous trouvons des correspondances complètes ou à pourcentage élevé avec divers fragments du génome humain. Cela suggère que les séquences génétiques, qui sont censées identifier le SRAS-CoV-2, ne sont pas uniques. Elles pourraient être n’importe quoi, des séquences microbiennes aux fragments de chromosomes humains.

Les soi-disant vérificateurs de faits, comme le projet Health Feedback de Reuters, se sont empressés de rejeter les affirmations de ceux qui ont remarqué le manque apparent de spécificité du supposé génome du SRAS-CoV-2.

En utilisant une série d’arguments de paillasson comme « cette affirmation suggère que chaque test devrait être positif » (ce qui n’est pas le cas), leur tentative de démystification aboutit à quelque chose comme cela :

« Les amorces sont conçues pour se lier à des séquences de nucléotides spécifiques qui sont uniques au virus. L’amorce avant peut se lier à un chromosome particulier, mais l’amorce arrière ne se lie pas au même chromosome et le chromosome n’est donc pas présent dans le virus SRAS-CoV-2. En outre, comme les amorces avant et arrière enveloppent la séquence à amplifier, la séquence cDMA entre les amorces est unique au virus.

Cela semble déformer délibérément la signification de ces résultats en avançant un argument que personne, à part les vérificateurs de faits eux-mêmes, ne fait valoir. Les recherches menées par BLAST montrent que ces séquences cibles ne sont pas uniques au SRAS-CoV-2. Il n’est pas non plus nécessaire de trouver toutes les cibles pour qu’un résultat soit jugé positif.

Des chercheurs marocains ont étudié l’épidémiologie des cas marocains présumés de SRAS-CoV-2. 9% des cas étaient positifs pour trois gènes, 18% pour deux gènes et 73% pour un seul. Comme nous venons de l’évoquer, beaucoup d’entre eux n’étaient peut-être positifs pour aucun.

Cela est tout à fait conforme aux directives de l’OMS en matière de tests. Elles stipulent que :

« Un diagnostic optimal consiste en un test d’amplification de l’acide nucléique (NAAT) avec au moins deux cibles indépendantes du génome du SRAS-CoV-2 ; cependant, dans les zones où la transmission est répandue, un simple algorithme à cible unique peut être utilisé (…). Un ou plusieurs résultats négatifs n’excluent pas nécessairement l’infection par le SRAS-CoV-2 ».

L’argument selon lequel la RT-PCR ne trouve que de l’ARN est fallacieux. La transcription naturelle (la séparation des brins d’ADN) se produit pendant l’expression des gènes. Personne ne dit que des chromosomes ou des microbes entiers sont séquencés dans le prétendu génome du SRAS-CoV-2. Quoiqu’il en soit, pour autant que nous sachions. Ils disent que les prétendus marqueurs, utilisés pour tester ce supposé virus, ne sont pas adaptés à l’objectif.

Les tests RT-PCR ne séquencent pas l’intégralité du génome. Ils recherchent des incidents de floraison de sondes spécifiques pour indiquer la présence de séquences dites existantes. Ces séquences sont définies par MN908947.1 et les mises à jour ultérieures. Ces amorces et ces sondes ne peuvent révéler que des correspondances d’ARN extraites d’ADN non codant, parfois appelé « junk » (ADNc).

Par exemple, le gène S du SRAS-CoV-2 est censé être hautement spécifique au génome du virus SRAS-CoV-2. La séquence cible est – TTGGCAAAATTCAAGACTCACTTTC. Une recherche microbienne BLAST renvoie 97 correspondances microbiennes avec une correspondance de séquence d’identité de 100%. Le pourcentage de concordance le plus faible, parmi les 100 premiers, est de 95%. Une recherche BLAST sur le génome humain trouve également une correspondance de séquence de 100% avec 86 fragments de chromosomes humains.

Peu importe où vous regardez dans le génome supposé du SRAS-CoV-2, il n’y a rien dans les protocoles de test de l’OMS qui identifie clairement de quoi il s’agit. L’ensemble du génome pourrait être faux. Les tests ne prouvent pas l’existence du SRAS-CoV-2. Tout ce qu’ils révèlent, c’est une soupe de matériel génétique non spécifié.

Si tel est le cas, comme il n’y a pas d’isolats ou d’échantillons purifiés du virus, sans test viable, il n’y a aucune preuve de l’existence du SRAS-CoV-2. Par conséquent, il n’y a pas non plus de preuve de l’existence d’une maladie appelée COVID-19.

Cela signifie qu’il n’y a pas de base scientifique pour toute affirmation concernant le nombre de cas de COVID-19, les admissions à l’hôpital ou les chiffres de mortalité. Toutes les mesures prises pour lutter contre ce virus mortel ne sont probablement fondées sur rien.

Fraude concluante

La fraude est un acte criminel. La définition légale de la fraude est la suivante :

« Une pratique trompeuse ou une manœuvre délibérée, à laquelle on a recours dans l’intention de priver un tiers de son droit, ou de lui causer un préjudice d’une manière ou d’une autre ».

La définition légale d’une conspiration est la suivante :

« Une combinaison ou une confédération entre deux ou plusieurs personnes formée dans le but de commettre, par leurs efforts conjoints, un acte illégal ou criminel ».

Il semble que ceux qui prétendent que nous sommes confrontés à une pandémie n’ont pas fourni de preuves montrant qu’un virus appelé SRAS-CoV-2 provoque une maladie appelée COVID-19. Toutes les informations suggérant fortement cette possibilité sont facilement disponibles dans le domaine public. Tout le monde peut les lire.

Pour qu’il y ait fraude, la tromperie doit être délibérée. L’intention doit être de priver délibérément d’autres personnes de leurs droits ou de leur porter préjudice d’une manière ou d’une autre. S’il existe des preuves de collusion entre des individus et/ou des organisations pour commettre une fraude, il s’agit alors d’une conspiration (dans les juridictions de droit commun) ou d’une Entreprise Criminelle Commune (ECC) en vertu du droit international.

Il semble que la COVID-19 ait été délibérément utilisée comme casus belli pour faire la guerre à l’humanité. Nous avons été emprisonnés dans nos propres maisons, notre liberté de circuler a été restreinte, la liberté de parole et d’expression a été érodée, le droit de protester a été réduit, nous avons été séparés de nos proches, nos entreprises ont été détruites, nous avons été bombardés psychologiquement, muselés et terrorisés.

Pire encore, alors qu’il n’existe aucune preuve que la mortalité toutes causes confondues soit sans précédent, il y a eu des pics de mortalité hors saison. Ces chiffres correspondent précisément aux mesures de « confinement » qui ont vu le retrait des services de santé que nous payons et une réorientation des services de santé publique pour traiter une maladie présumée à l’exclusion de toutes les autres.

En outre, ceux qui ont transmis l’histoire de la COVID-19 proposent que cette maladie présumée justifie la restructuration complète de l’économie mondiale, de nos systèmes politiques, de nos sociétés, de nos cultures et de l’humanité elle-même.

Pour être autorisés à participer à ce qu’on appelle leur « nouvelle normalité », qui est la transformation complète de toute notre société sans notre consentement, ils insistent pour que nous nous soumettions à leurs conditions.

Celles-ci comprennent, sans s’y limiter, la surveillance biométrique de chacun, le contrôle et la surveillance centralisés de toutes nos transactions, des restrictions commerciales et sociales oppressives et une demande effective que nous n’ayons pas droit à la souveraineté sur nos propres corps. Ceci constitue la condition de l’esclavage.

Il ne fait aucun doute que nous avons été privés de nos droits et blessés. Dans les juridictions de droit commun, l’innocence est présumée, mais les preuves qu’un préjudice a été délibérément causé par une conspiration internationale sont accablantes. Les politiques destructrices, adoptées par les gouvernements du monde entier, ont clairement trouvé leur origine dans les groupes de réflexion mondialistes et les institutions supranationales bien avant l’émergence de cette pandémie inexistante.

Dans les juridictions du Code Napoléon, la culpabilité est présumée. Pour que les conspirateurs accusés puissent prouver leur innocence, ils doivent montrer que, malgré leurs ressources incommensurables, ils ont été collectivement incapables d’accéder ou de comprendre les preuves librement disponibles suggérant que la COVID-19 est un mythe.

Les responsables du crime de conspiration en vue de commettre une fraude mondiale doivent être jugés. S’ils sont reconnus coupables, ils devraient être emprisonnés pendant que le reste d’entre nous s’efforce de réparer les dommages qu’ils ont déjà causés.

source : https://off-guardian.org

traduit par Réseau International

===

Lire notre page « Coronavirus, guerre biologique contre l’humanité »

 

Déliquescence systémique et dictature en marche : Thèses et observations sur les objectifs de la lutte en France (Raoul Vaneigem)

Posted in actualité, altermondialisme, autogestion, coronavirus CoV19, crise mondiale, démocratie participative, gilets jaunes, militantisme alternatif, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, philosophie, police politique et totalitarisme, politique et lobbyisme, politique et social, politique française, résistance politique, société des sociétés, terrorisme d'état with tags , , , , , , , , , , , , , on 28 décembre 2020 by Résistance 71

 

 

De biens bonnes choses dans cette analyse de Raoul Vaneigem même si parfois il laisse un peu à penser que ce qu’il préconise tient plus d’un énième réformisme futile du système en place, notamment avec le passage où il parle de coopération entre l’État et des assemblées populaires, comme si l’État autoriserait ces dites assemblées, ou encore ce passage sur un autre type de monnaie à terme tout aussi chimérique. La société qu’il entrevoit fort justement ne peut de fait se construire qu’en dehors de toute falsification étatico-capitaliste, sur une base de solidarité et de complémentarité mais totalement hors de tout système marchand, monétaire et étatique. 

Si Raoul lit ces lignes : il est temps de totalement lâcher prise, il n’y a pas de solution au sein du système et ne saurait y en avoir ! Tout doit partir et oui, être remplacé par cet élan naturel de l’humanité vers la Vie… tout simplement. Compagnon, ne t’accroche plus à ces derniers scintillements factices d’un système totalement illusoire et mortifère ! Il n’y a rien à sauvegarder.

Ainsi. adoptons ce principe des peuples originels du continent des Amériques qui dit que chaque décision prise doit l’être en considération de ce que pensera de nos actions la 7ème génération a venir. Ce faisant, il devient très, très difficile de faire fausse route parce que non seulement l’intérêt commun immédiat est évalué et pris en compte, mais aussi celui d’un lointain futur, éradiquant toute velléité égoïste conjoncturelle.

Telle est la voie de la sagesse, celle du respect de toute vie, façonnant le moule de nos décisions présentes et à venir.

~ Résistance 71 ~

 

 

Retour à la base : Thèses et observations sur les objectifs de la lutte en France

 

Raoul Vaneigem

 

22 décembre 2020

 

url de l’article :
https://www.lavoiedujaguar.net/Retour-a-la-base-Theses-et-observations-sur-les-objectifs-de-la-lutte-en-France

 

1. L’autodéfense de la femme est au cœur de l’émancipation individuelle et sociale.

Débarrassée du féminisme étatique et autoritaire, la volonté d’éradiquer le comportement patriarcal est le plus sûr moyen d’en finir avec la peur et le mépris et de la nature et de la vie.

2. Contre les résurgences du patriarcat.

Religieux ou laïque, de gauche ou de droite, le comportement patriarcal est le pilier de la société hiérarchisée. Il faut, pour l’abattre, abolir le règne des chefs, sans distinction de sexe.

3. Contre l’écologie idéologique.

Le viol et la violence sont inhérents à une économie fondée sur l’exploitation de la nature. C’est de son pillage, inaugurant le règne de la marchandise, que date l’infortune de la femme. L’écologie restera une idéologie de marché tant que le combat de la femme pour son autonomie n’impliquera pas une nouvelle alliance avec l’univers de la vie.

4. Contre la manipulation de la peur.

La crainte suscitée par l’apparition d’un virus, à la fois insolite et prévisible, a été délibérément amplifiée par le pouvoir à des fins désormais évidentes :

a) tenter de dissimuler l’état désastreux des structures sanitaires, devenues des entreprises à but lucratif ;

b) obtenir à l’échelle planétaire un confinement des populations qu’aucun régime totalitaire n’avait réussi à imposer ;

c) stimuler le développement du marché sécuritaire. En alimentant le fonds de commerce du populisme fascisant (racisme, sexisme, peur de l’autre), il profite aussi à une gauche trop heureuse d’avoir à combattre sur le front des idéologies plutôt que sur le front social où elle s’est discréditée ;

d) la terreur où chacun se calfeutre joue en faveur du principal souci des gouvernants : durer le plus longtemps possible, même en pourrissant sur pieds.

5. Contre la paupérisation de la vie.

« Jouissez d’aujourd’hui car demain sera pire » a été le slogan consumériste le plus efficace du capitalisme. Désormais, il n’en a plus l’usage car il nous met devant un fait accompli. Il décrète : « Le pire est arrivé, force est de vous en accommoder. » Le modèle chinois est en place, en attente de technologies toujours plus efficaces. Le prochain remède à la paupérisation — hormis la suppression des inutiles — sera le bol de riz et le transhumanisme.

6. Contre le retour du puritanisme.

La nécessité de travailler proscrit la jouissance de soi et du monde. Cet interdit, le patriarcat l’a érigé en dogme. Mais en stimulant le marché des plaisirs consommables, le consumérisme lui a porté des coups mortels. La paupérisation qui menace la course à la consommation provoque le retour du puritanisme sous sa forme particulièrement vicieuse : la peur et le mépris de la vie. Le confinement tue en tuant les relations affectives. N’entendez-vous pas retentir avec un bruit de chaînes ces cris de veillée funèbre : « Fini de rire ! Fini de jouir ! Fini de vivre ! » ?

7. Contre la réification ou transformation en chose.

Le capitalisme ne voit dans la vie qu’un objet marchand. Il ne tolère pas qu’elle échappe à la toute-puissance de l’argent. La machine du profit montre qu’au prétexte d’un virus de passage elle a été capable de déclencher une véritable peste émotionnelle. Une hystérie panique a poussé des millions d’individus à se terrer dans un coin, où le désespoir et la morbidité achevaient de les délabrer.

8. Contre le sacrifice.

Le consumérisme avait fondé son pouvoir de séduction sur le mythe de l’abondance édénique. Le « tout à la portée de tous » prêtait une éphémère séduction à ces libertés de supermarché qui s’arrêtent au tiroir-caisse. Le salaire durement gagné trouvait sa récompense dans un laisser-aller qui avait les vertus d’un défoulement. Avec la paupérisation qui vide le « panier de la ménagère » l’exhortation à se sacrifier remonte en surface, tel le péché originel que l’on croyait enfoui dans le passé. Il faut accepter la Chute, il faut admettre que la vie s’assèche. Le temps est venu de rappeler qu’on ne travaille jamais assez, qu’on ne se sacrifie jamais assez. L’existence non lucrative est un délit. Vivre est un crime à expier. L’éloignement, le repli sécuritaire, la peur de l’autre instaurent une pratique de la délation, un culte de la pudibonderie, un regain de violences, une avancée de l’obscurantisme (à défaut d’oser brûler les livres, le gouvernement français les taxe d’inessentiels).

9. Contre le marché de la tuerie sanitaire et sécuritaire.

a) En France, la gestion politique des soins de santé a prémédité l’assassinat en série des premières victimes de la paupérisation : les retraités, les vieux, les dénués d’efficacité lucrative. La république des nantis a fait peser la main froide de l’argent sur la république des sans-grade. Elle a agi et continue d’agir sous l’emprise d’une économie pour qui le profit à court terme compte plus que la santé d’un peuple. Ne nous y trompons pas : elle annonce sans ménagement la solution finale que la tyrannie mondialiste réserve aux peuples décidés à ruiner l’enrichissement des riches.

b) La sécurité garantie au citoyen par contrat social a laissé place à une idéologie sécuritaire qui accroît et multiplie les dangers, l’agressivité, les actes de folie. La police et la magistrature dont la fonction officielle est de nous prémunir contre les violeurs, les assassins, les empoisonneurs et les pollueurs en sont devenus les sbires en raison des tendances fascisantes encouragées en leur sein par l’État. La stratégie du bouc émissaire — qui accable pêle-mêle gilets jaunes, émigrés, manifestants écologistes, musulmans et incendiaires de poubelles — les frappe à leur tour au cri de « tout le monde déteste la police ». Un tel enfumage a pour but de détourner notre attention de la liberté de nuire laissée à ceux qui dévastent impunément la planète et viennent « jusque dans nos foyers » violer notre liberté de vivre.

10. Contre le progrès technologique complice de la régression humaine.

L’intrusion d’un virus a dévoilé le cynisme des groupes de pression pharmaceutiques et médicaux. On les a vus moins soucieux de soigner les humains que d’engranger les bénéfices d’une morbidité dont la presse oligarchique et ses compteurs de la mort trafiquée amplifiaient la hantise. La logique économique confirme ainsi l’imposture d’un progrès technologique qui, pour justifier ses mensonges d’aujourd’hui, bat le rappel des vérités d’hier. Nul ne conteste l’utilité originelle des antibiotiques, des vaccins contre la tuberculose, la poliomyélite, le tétanos mais quelle confiance accorder à des lobbies qui jettent sur le marché d’anciens médicaments vendus sous de nouvelles appellations ? Comment se fier à des vaccins expérimentaux délivrés à des bien-portants comme l’extrême onction à un agonisant ? Comment tolérer de surcroît que les instances au pouvoir calomnient et poursuivent pénalement les praticiens de terrain qui dénoncent leurs malversations ? À quand la bonne vieille méthode de Staline liquidant les médecins complotistes ?

11. Pour une réinvention permanente.

« Ils ne savaient pas que c’était impossible, alors ils l’ont fait. » Le propos de Mark Twain gagne chaque jour en pertinence à mesure que se multiplient, décroissent et renaissent les insurrections planétaires. Chacun s’en aperçoit : les affrontements idéologiques sont des leurres. Le vrai combat est partout où les habitants d’un village ou d’un quartier urbain refusent les pesticides et les nuisances, renouvellent l’enseignement, restaurent les structures hospitalières, posent le problème de la mobilité, sauvent les commerces locaux, étudient le passage de l’agro-alimentaire à une agriculture renaturée, ouvrent des centres d’accueil pour celles et ceux qui subissent au quotidien une oppression bureaucratique, économique, familiale, sexiste ou raciste.

12. Pour une autodéfense sanitaire.

Les mesures coercitives et incohérentes dont nous sommes victimes résultent des malversations budgétaires qui ont ruiné et ruinent les structures hospitalières. Celles et ceux qui œuvrent sur le terrain n’ont nul besoin de complotisme et d’anti-complotisme pour dénoncer les discours qui nous éloignent de la réalité vivante. Cependant, vitupérer le mensonge du haut ne fait pas reculer d’un pouce la politique d’étouffement budgétaire. N’est-ce pas s’enliser dans la victimisation que de ne pas donner la priorité, ici et maintenant, au bien-être individuel et social, de ne pas briser la tyrannie du profit, principale cause du mal-être et des troubles qui en découlent ? L’État fait primer sur l’efficacité des médecins de terrain, en contact direct avec leurs malades, les intérêts de firmes pharmaceutiques multinationales qui stipendient la valetaille politique. Le simple bon sens prescrit de restaurer la relation consensuelle entre patients et praticiens, voire d’encourager une automédication sinon curative du moins préventive.

a) L’examen du virus en vogue nous a appris que son intensité variait d’une région à l’autre. Le traiter sur le plan national et mondial est une sottise. Il appartient aux assemblées citoyennes de décréter l’autodéfense sanitaire. Agir sur le terrain où patients et médecins cohabitent, se connaissent, entretiennent des relations de confiance fait de tous et toutes des aides-soignants s’initiant à éradiquer la morbidité dominante et à révoquer ses cyniques gestionnaires.

b) Tout en faisant preuve, en certains domaines, d’une efficacité incontestable, le progrès médical a jeté le discrédit sur un usage des plantes qualifié de « remède de bonnes femmes », une appellation qui en dit long sur l’esprit patriarcal de la médecine traditionnelle. Toute une flore a été pillée, brevetée, frelatée, vendue à des populations qui en disposaient gratuitement et étaient en mesure d’en améliorer les vertus. À nous d’empêcher sa spoliation par une science sans conscience et de veiller à ce que la phytothérapie ne tombe pas dans le marché alternatif qui s’apprête à la récupérer avec la même avidité boutiquière.

c) La nocivité du confinement, du repli sur soi, de la peur panique d’une mort programmée a montré a contrario la vertu thérapeutique de la joie d’être ensemble, de se rencontrer, de se toucher sans « gestes barrière ». La peur de vivre a toujours galvanisé l’attrait de la mort. Nazisme et stalinisme l’ont démontré. Qui ne fait fête au plaisir d’exister fait fête à la charogne. Ce qui mobilise aujourd’hui les insurgés planétaires c’est le combat sans merci du parti pris de vivre contre le parti de la mort que la civilisation marchande enrégimente en s’autodétruisant.

13. Pour une autodéfense alimentaire.

La fausse garantie de nourrir les populations du globe ne dissimule plus le vrai mobile des monopoles agro-alimentaires, qui est de promouvoir pour tous une nourriture infectée à des fins lucratives. Qui pourrait croire à la philanthropie de groupes qui s’enrichissent en altérant la santé des consommateurs ? Ne voit-on pas l’État et ses commanditaires supranationaux accorder aux pesticides et autres nuisances la liberté commerciale de polluer la planète ? Victimes d’un endettement croissant, nombre de paysans se retrouvent à la fois empoisonnés et empoisonneurs. Cessons d’en faire des boucs émissaires ou des pions sur l’échiquier électoral. La question qui se pose est : comment venir en aide à ceux qui s’orienteront vers la permaculture ou autre forme d’agriculture renaturée ? Si vous êtes lassés du discours abstrait, si vous voulez du concret, voilà la pierre de touche à laquelle frotter les belles intentions écologistes.

14. Pour une autodéfense scolaire et culturelle.

À l’encontre de l’école militarisée qui sévit encore de nos jours, nous désirons promouvoir un enseignement pour tous les âges. Agora, place publique, maison du peuple, centre communal sont les jardins d’un savoir prodigué par cette passion majeure et inextinguible qu’est la curiosité. L’apprentissage ludique du « vivre ensemble » montre qu’il exclut compétition, prédation, culpabilisation, sectarisme. Redécouvrir la joie de vivre en créant un environnement qui la favorise fortifie peu à peu cette autonomie qui nous protège en nous libérant de la protection des autres. C’est un art difficile qui exige une tout autre forme d’intelligence que la ruse et la force requises par les guerres financières et les rivalités de pouvoir. L’intelligence sensible est l’intelligence du vivant ; elle prévaut toujours sur celle du portefeuille.

a) Le grégarisme finit où l’individu se libère de l’individualisme. La créativité dont font montre les insurrections de notre temps annonce la fin de la foule imbécile et versatile. Le calcul égoïste assèche la pensée. L’entraide la revivifie.

b) La qualité l’emporte sur le nombre. Les propos d’un Gilet jaune d’une quinzaine d’années, entendus lors d’une manifestation de rue, laissent à penser par leur acuité que l’intelligence sensible et jubilatoire de quelques-uns suffira à crever la baudruche, démesurément enflée, des préjugés millénaires.

c) L’intelligence sensible est celle de l’être. Elle supplantera la gestion intellectuelle de l’avoir. Paupérisation oblige !

15. Pour une autodéfense énergétique.

Le capitalisme industriel avait favorisé dans son essor l’efflorescence d’inventions nouvelles (électricité, machine à vapeur, chemin de fer). Ce qui subsistait de recherche indépendante est désormais soumis au contrôle accru des intérêts mercantiles qui gèrent les budgets. Le capitalisme financier produit un vide de la science et de la conscience. Cette béance, « dont la nature a horreur », révèle d’autres voies possibles, elle encourage à explorer un savoir issu de la vie ; non plus de la survie, comme ce fut le cas jusqu’à présent. Physique, biologie, art, médecine sont en quête d’une refonte radicale. Alors que, sous le choc du coronavirus, les milieux scientifiques se sont discrédités par leur incompétence, leurs mensonges et leur arrogance, la curiosité et le goût de la recherche sont en quête d’un nouveau dynamisme. Marginalisés par les lobbies scientifiques, nombre d’investigateurs aspirent à la liberté de puiser dans la vie inexplorée de quoi améliorer notre existence quotidienne et son environnement.

a) Il appartient aux collectivités locales et régionales de soutenir les projets contribuant à la gratuité de l’électricité et du chauffage. Seules l’ingéniosité et l’obstination permettront d’évincer la mainmise des mafias vert-dollar sur les énergies renouvelables.

b) Il en va de même pour l’auto-organisation de la mobilité, qui exige la mise en place de transports non polluants et gratuits. Ce que l’État et les mafias pétrolières ont détruit, n’est-ce pas aux collectivités locales de les réinventer ?

c) Nul besoin d’apocalyptisme pour comprendre que nous sommes au cœur d’une mutation de civilisation. Si tout change de base, cela signifie aussi que les décisions à prendre en matière d’environnement relèvent exclusivement des assemblées communales et régionales et n’ont que faire de référendums patronnés par l’État pollueur.

16. Pour une autodéfense monétaire.

La plupart des économistes conviennent que la gestion mondialiste du profit prépare la suppression du cash au profit de cartes bancaires, qui comportent en prime le profil policier de leur utilisateur.

a) Alors que des millions de citoyens vont se trouver dans l’impossibilité d’acquitter taxes et impôts (destinés à enrichir les riches), une initiative se propage : la création de banques coopératives locales, avec une monnaie non capitalisable, dont la valeur d’échange sert, en circuit fermé, à rétribuer les commerces locaux, à subventionner les entreprises d’utilité publique, à soutenir les projets d’indépendance énergétique, à faciliter l’émergence une agriculture renaturée.

b) Une telle mesure a l’avantage d’assurer la primauté de la valeur d’usage sur la valeur d’échange, autrement dit d’annoncer la fin de la marchandise.

17. Il appartient aux assemblées de démocratie directe de hâter par en bas le dépérissement de l’État qui pourrit par le haut.

a) L’État n’est plus qu’un instrument manipulé par les firmes multinationales, qui, avec ou sans le relais de l’Europe, lui imposent leurs lois et leurs juridictions. La répression policière est la seule fonction qui lui incombe encore.

b) Le jacobinisme, traditionnellement chargé d’assujettir la province à Paris, subit de plein fouet la politique incohérente d’un gouvernement qui ne gouverne plus et a fait du mot élite le synonyme d’imbécile. Le danger est de voir lui succéder des régionalismes qui ne feraient qu’ajouter des États dans l’État national.

c) Le parlementarisme masque de moins en moins l’odieux ridicule d’une dictature qui n’a gardé de la démocratie que le nom de baptême. Les élections ont toujours été les arènes où la jactance des élus sollicitait la sottise d’électeurs persuadés d’être représentés par eux. Cependant, l’ineptie, le mensonge, la corruption des politiques, tous partis et factions confondus, ont atteint à un tel cynisme que la probabilité d’une abstention massive s’accroît dangereusement. Si bien que les instances gouvernementales différeraient, voire annuleraient volontiers la bouffonnerie électorale. Ne serait-ce que dans l’espoir de susciter un regain d’intérêt en sa faveur.

d) Le vote et la démocratie directe prennent tout leur sens chaque fois qu’une collectivité locale est appelée à se prononcer sur un problème qui la concerne au premier chef. La vérité du terrain dévoile les mensonges du haut, elle récuse ces statistiques qui se moquent des réalités vécues. Celles et ceux qui sont sur le lieu de leur existence ne sont-ils pas les mieux à même de juger si un décret qui les concerne est inique ou nuisible ? Qui est plus qualifié qu’eux pour décider des moyens de le combattre ?

e) De défenseur de la République qu’il prétendait être, l’État en est à se protéger contre les citoyens à qui il arrache les droits dont il était le garant. Son délabrement le contraint de convertir en milice privée une police dont une partie réprouve les atteintes aux droits de l’homme. Hochet du capitalisme financier, l’État règne sans gouverner. Il n’est plus rien. Son inanité sonne pour nous l’heure d’être tout.

18. Pour une république autogestionnaire abrogeant la république parlementaire et affairiste.

L’époque où nous tentons de vivre parmi les ruines est celle d’une mutation dont les séismes ébranlent le monde entier : la vieille civilisation n’en finit pas d’agoniser, la nouvelle tarde à éclore comme si elle redoutait sa propre audace.

a) La parodie d’une guerre civile entre conservatisme et progressisme participe d’une mise en scène qui dissimule la vraie guerre, la guerre de destruction massive entreprise par le capitalisme. Pendant que s’affrontent rétro-bolchévisme et rétro-fascisme, les mafias mondialistes empoisonnent et polluent impunément villes et villages. Communes, quartiers, régions aspirant à plus d’humanité demeurent isolés et sans voix, tandis que la rage impuissante et l’indignation compulsive se défoulent en provocations de matamores et en incendies de poubelles.

b) L’État et ses commanditaires font primer leurs intérêts en méprisant les nôtres. À nous de nous préoccuper de notre propre sort. Le sens humain est notre légitimité.

c) Notre lutte est inséparablement existentielle et sociale. Elle ne nie pas les options personnelles religieuses et idéologiques, elle est l’entraide qui les dépasse et possède l’art de les harmoniser. Dans le combat de la désobéissance civile, qui se soucie de la couleur de peau, du sexe, des croyances ?

d) Le peuple prenant par lui-même les décisions qui le concernent, lui et son environnement, s’inscrit dans la lignée de l’expérience autogestionnaire menée par les collectivités libertaires espagnoles de 1936. Les zapatistes du Chiapas, les insurgés du Rojava, la tendance la plus radicale du mouvement des Gilets jaunes en France s’en inspirent aujourd’hui unanimement en dépit d’une grande diversité de conditions historiques, politiques et géographiques. L’apparition de petites sociétés cherchant à s’autogérer et à se fédérer de communes en régions, expose inévitablement à des erreurs, à des confusions, à la « chienlit » comme disent les cancrelats d’État. Mais, où il n’y a ni mort d’homme ni culpabilité, tout se corrige. Pourquoi hésiter à expérimenter des sociétés du vivre ensemble alors qu’en permanence nous servons de cobayes dans les laboratoires de la déshumanisation et du profit ?

19. L’émergence de microsociétés passant outre à l’autorité étatique permet-elle une coexistence avec les instances dirigeantes ?

a) Le dialogue avec l’État n’existe plus. Aucune doléance du peuple n’a été reçue, si ce n’est à coups de matraque. Pourtant, malgré la rupture effective — et sans même espérer des manifestations qu’elles obtiennent le retrait de décrets iniques —, il est bon de soumettre l’État à un harcèlement constant. Rappeler leur parasitisme aux instances gouvernementales gagnera en pertinence lorsque les microsociétés qui font retentir les rues des cris de la liberté, opposeront aux diktats du totalitarisme démocratique la légitimité de décrets votés par leurs assemblées de démocratie directe.

b) La colère et la résistance d’un nombre croissant de maires de villages et de quartiers urbains soulignent la ligne de démarcation existentielle et sociale qui sépare en chacun d’eux le fonctionnaire d’État et le garant du bien-être des administrés. Le déchirement sans cesse accru entre intérêts privés et bien public est de nature à rallier aux assemblées de démocratie directe nombre de citoyens déstabilisés par l’appauvrissement, la tyrannie des interdits, les taxes à payer (petites entreprises, paysans, avocats, enseignants, médecins, commerçants, artisans, hôteliers, cafetiers, policiers de proximité écœurés par le rôle que l’État oligarchique leur assigne). Au maire de résister aux menaces et pressions étatiques et mafieuses, de prendre en compte les intérêts de la population, de devenir un interlocuteur éventuel entre l’assemblée et l’État. Le jeu de bascule revêt autant importance (sinon plus) que la révolte d’une partie de la police qui passerait au côté du peuple insurgé avec l’assurance d’exercer un service public auquel seul mettra fin le règne de l’Homme devenu humain.

c) Un collectif autogestionnaire s’efforçant d’esquiver un affrontement avec l’État et le suprématisme économique aurait le mérite d’éviter une violence qui répugne à la plupart des citoyens, même si la majorité silencieuse est un grand cri de haine. Néanmoins, qui niera que la violence est, de toute évidence, indispensable à un gouvernement qui ne doit sa durée qu’à la répression, son ultime fonction. Comme l’écrasement de la ZAD de Notre-Dame-des-Landes le laisse présager, l’apparition de microsociétés s’émancipant de la tyrannie étatique et marchande suscitera une intervention militaire du gouvernement français, avec l’appoint d’une extrême droite dont il ne cesse de conforter les espérances dictatoriales sous couvert de les combattre.

20. Pour une guérilla démilitarisée.

L’insurrection planétaire en cours émane de la vie quotidienne des femmes, des hommes, des enfants. Le phénomène n’est pas nouveau, ce qui est nouveau, c’est la prise de conscience qui la propage. Ses revendications vont bien au-delà de la satisfaction consumériste. Sa poésie s’échappe du panier de la ménagère avant même qu’il soit vidé par la paupérisation.

a) L’insurrection de la vie quotidienne offre la singularité d’être une insurrection pacifique en ce qu’elle se veut le dépassement de la lutte traditionnelle entre pacifisme réformiste et révolution barricadière.

b) La vie est une arme qui harcèle sans tuer. L’ennemi ne manque pas une occasion de nous entraîner sur un terrain qu’il connaît parfaitement car il en possède la maîtrise militaire. En revanche, il ignore tout de la passion de vivre qui renaît sans cesse, abandonne un territoire dévasté, se le réapproprie, multiplie les occupations de zones à défendre, disparaît et reparaît comme le chat du Cheshire. Il est incapable de comprendre que le combat de la vie pour l’être dissout l’avoir et révoque l’ordre de la misère. Notre guérilla est sans fin. Au contraire de la lutte pour l’avoir qui elle, ne survit pas au dépérissement de l’être qu’elle provoque. La cupidité est un étouffement.

c) « Ne jamais détruire un être humain et ne jamais cesser de détruire ce qui le déshumanise » est un principe de lutte qui a le mérite de s’en prendre à un système d’oppression et non à ceux qui s’en croient le moteur et n’en sont que les rouages. Saboter l’implantation d’une nuisance n’est pas tuer ceux qui en sont responsables.

d) Le temps est avec nous. L’insurrection de la vie quotidienne commence à peine à faire preuve de sa créativité et de sa capacité de renaître sans cesse. Mieux vaudrait se soucier non d’aller plus vite mais d’aller plus loin.

e) Collationner en assemblées les fragments d’une Constitution par et pour le peuple apportera le poids de la légitimité au refus des décrets liberticides que nous impose le totalitarisme démocratique. En nous plaçant devant leur fait accompli, les instances du haut nous défient de leur opposer le nôtre. Or nous n’avons que faire de relever un défi qui ne ferait que nous traîner sur le terrain de l’ennemi. Notre message est clair : le droit de vivre passe outre aux ordonnances de l’argent qui tue.

f) L’important n’est pas le nombre des insurgés mais la qualité des revendications. L’autonomie des individus est la base de l’autogestion. Elle émancipe de l’individualisme, qui prête une liberté fictive aux moutons de la servitude volontaire. Elle apprend à distinguer militantisme et militarisme. L’engagement passionnel ne peut se confondre avec le sacrifice. Le combat pour la liberté refuse les ordres. La confiance et le mandat que lui accorde la solidarité lui suffisent.

g) L’autonomie individuelle dispose d’une puissance de harcèlement inépuisable. Or la peau distendue du Léviathan le rend vulnérable aux piqûres de moustiques.

21. L’autodéfense environnementale est une autodéfense de la joie de vivre.

Que celles et ceux qui trouvent la formule abstraite ou vide de sens se réfèrent à leur propre existence quotidienne et au milieu ambiant qui la conditionne. N’est-ce pas le terrain où leurs problèmes psychologiques, familiaux, sociaux se tortillent et appellent à l’aide ?

a) L’idée que l’on accroît son bonheur en favorisant le bonheur des autres a l’occasion de se concrétiser en ouvrant des centres d’accueil pour celles et ceux qui subissent dans leur quotidien une oppression bureaucratique, économique, familiale, sexiste ou raciste.

b) Il n’est pas jusqu’au problème de l’accueil des migrants que l’entraide ne puisse résoudre. Sous la glaciation statistique qui les réduit à des objets, il y a des êtres humains en détresse qu’un grand nombre de communes auraient le loisir d’héberger en petit nombre, avec l’assentiment de la population locale.

c) C’est bien le moins que la générosité humaine qui vient en aide aux plus faibles implique chez les accueillis comme chez les accueillants une reconnaissance absolue des droits de la femme et des libertés reconnues à l’homosexualité. Il n’est pas tolérable que communautarisme, multiculturalisme ou tradition autorisent des comportements prédateurs que nous tentons d’éradiquer depuis un siècle.

d) Dans un univers de plus en plus en proie à la laideur de l’argent et du calcul égoïste, le retour à la beauté, à l’amitié, à l’amour, à la générosité, à l’entraide propage une subversion qui ridiculise la ritournelle des belles intentions morales et caritatives. Le sens humain se moque de l’humanitarisme, comme la vie authentique des mises en scène qui la falsifient.

e) Le consumérisme a démontré qu’un plaisir acheté est un plaisir gâché. En éteignant le néon des supermarchés, la paupérisation s’éclaire de lumières moins trompeuses. En annonçant l’effondrement de l’inutilité rentable, elle laisse à la disette à venir le temps de renaturer la terre, de retrouver une nourriture saine et des agréments qui ne soient plus frelaté. De même que le coronavirus nous a enseigné à mieux renforcer notre immunité, la faillite économique nous enjoint de recourir à nos ressources créatives. Le do it yourself fait la nique au self made man dont l’affairisme avait fait son héros.

f) La protection des animaux, de la végétation, des paysages, de la nature a cessé d’être un pastel vendu sur le marché écologique. Si utile qu’elle soit et même si elle va au-delà de la compassion, l’aide tutélaire à la terre et à ses espèces a l’inconvénient d’être un impératif. Elle cède aujourd’hui la place à un sentiment fusionnel avec le vivant. La conscience d’une « vie profonde » ravive en nous les composantes minérales, végétales, animales que la superficialité de la survie percevait comme des stratifications mortes. Ainsi s’accomplit sans doute le plus grand pas de l’Homme vers son humanité.

g) L’appel de la totalité a toujours résonné au cœur de notre destinée. Le monde nouveau s’esquisse dans l’émerveillement que les enfants enseignent à qui redécouvre son enfance. Il nous est donné d’apprendre à renaître dans la renaissance du monde.

= = =

Lectures complémentaires :

L’essentiel de Raoul Vaneigem (PDF)

Il n’y a pas de solution au sein du système, n’y en a jamais eu et ne saurait y en avoir !

Comprendre et transformer sa réalité, le texte:

Paulo Freire, « La pédagogie des opprimés »

+

4 textes modernes complémentaires pour mieux comprendre et agir:

Guerre_de_Classe_Contre-les-guerres-de-l’avoir-la-guerre-de-l’être

Francis_Cousin_Bref_Maniffeste_pour _un_Futur_Proche

Manifeste pour la Société des Sociétés

Pierre_Clastres_Anthropologie_Politique_et_Resolution_Aporie

 


Gilets Jaunes 2021 !… An III

Résistance au colonialisme : 5ème AG du Conseil National Indigène CNI/EZLN

Posted in actualité, altermondialisme, autogestion, canada USA états coloniaux, colonialisme, crise mondiale, démocratie participative, gilets jaunes, guerres hégémoniques, guerres imperialistes, militantisme alternatif, néo-libéralisme et paupérisation, neoliberalisme et fascisme, pédagogie libération, politique et lobbyisme, politique et social, résistance politique, société des sociétés, terrorisme d'état with tags , , , , , , , , on 28 décembre 2020 by Résistance 71

 

 

 

Convocation à la 5ème assemblée générale du Conseil National Indigène 

 

CNI / EZLN

 

22 décembre 2020

 

Source de l’article en français:
https://www.lavoiedujaguar.net/Convocation-a-la-Cinquieme-Assemblee-nationale-du-Congres-national-indigene

 

Nous, peuples, nations, tribus et quartiers originaires qui constituons le Congrès national indigène, le Conseil indigène de gouvernement et l’Armée zapatiste de libération nationale, alors que nous nous confrontons à la maladie de notre Mère Terre qui s’est traduite en une grave pandémie frappant la vie et l’économie de nos communautés et le monde entier, nous nous faisons entendre dans la voix des peuples originaires qui crient depuis les géographies où ils luttent et résistent contre la guerre capitaliste visant à l’appropriation des territoires indigènes et paysans par d’agressives politiques d’extraction d’un bout à l’autre de la géographie nationale, par des mégaprojets de mort appelés Couloir interocéanique dans les États d’Oaxaca et de Veracruz, Projet intégral Morelos dans les États de Morelos, Puebla et Tlaxcala, Train maya dans les États du sud-est du Mexique ou Aéroport international de Mexico dans le centre du pays, par la mise en œuvre d’un ensemble de politiques et de mécanismes pour la continuation du « libre commerce » subordonné aux États-Unis et au Canada, pour contenir la migration et pour empêcher ou affaiblir l’organisation et la résistance de nos peuples en supplantant les autorités traditionnelles et en réalisant des simulacres de consultation indigène.

Il s’agit de politiques et de mégaprojets impulsés par le gouvernement néolibéral de la Quatrième Transformation au service des grands capitaux mondiaux contre l’organisation autonome de nos peuples, et ce en s’appuyant sur la militarisation, la mise en place de la Garde nationale et la militarisation de tout le territoire national, la complicité État cartels criminels, la création de programmes visant à briser l’organisation communautaire comme le programme Sembrando Vida (Semant la vie) et l’approbation de lois favorables aux grands consortiums transnationaux comme la Loi fédérale pour le développement et la protection du maïs natif.

Le CNI et le CIG — avec les communautés zapatistes —, en tant que congrès quand nous sommes ensemble et en tant que réseau quand nous sommes séparés, nous sommes cette parole collective que non seulement nous faisons nôtre, mais aussi dans et avec laquelle nous nous entrelaçons, déterminés à accroître notre résistance autant que s’accroîtra la menace capitaliste contre la vie.

Car pour nos peuples il n’y a pas de possibilité de nous rendre, de nous vendre ou de capituler quand ce sont la Mère Terre et la vie dont gouvernements, entreprises, militaires et cartels de drogues veulent faire le butin de leur vol et ;

Considérant que :

1. La répression, les menaces, la formation de groupes de choc et la criminalisation s’intensifient contre les communautés qui résistent au Projet intégral Morelos que le mauvais gouvernement fédéral a décidé d’imposer illégalement en utilisant son groupe armé de choc appelé Garde nationale, et malgré cela, l’héritage héroïque de Samir Flores Soberanes reste vivant parmi les sœurs et frères du Front des peuples en défense de la terre et de l’eau des États de Morelos, Puebla et Tlaxcala qui ne se rendent pas, ne se vendent pas et ne capitulent pas ;

2. La guerre contre les communautés autonomes et les communautés des peuples originaires du CNI dans l’État du Chiapas s’exacerbe, tandis que les gouvernements garantissent l’impunité des groupes paramilitaires, financés par eux, qui attaquent jour et nuit les peuples et communautés sœurs ;

3. Le mauvais gouvernement fédéral et ses forces armées, en alliance cynique avec les obscurs intérêts économiques qui spéculent sur l’appropriation du territoire des peuples indigènes et paysans, sème la peur et la terreur en violant systématiquement les lois, verdicts et suspensions judiciaires pour imposer ses mégaprojets qui livrent le territoire du pays aux intérêts économiques transnationaux ;

4. La résistance et la rébellion s’accroissent dans la géographie des peuples originaires car s’accroissent aussi le pillage et la répression violente de la part du mauvais gouvernement à tous ses niveaux, en complicité avec des groupes paramilitaires et narco-paramilitaires, qui rendent possibles ses projets d’extractions polluants, et y compris dans les grandes villes, nos peuples résistent, comme le démontre la communauté otomí habitant Mexico ;

5. Depuis les luttes que nous sommes, nous, peuples originaires, voyons que dans le monde s’allument des espoirs face à cette guerre qui est la même, et depuis des géographies lointaines nous nous tournons vers ceux-ci, c’est-à-dire vers la lutte pour la vie, qui devient une langue où nous nous voyons les uns les autres et ;

6. Il existe la convocation zapatiste au lancement au mois d’avril 2021 d’une tournée planétaire commençant par le continent européen, pour laquelle le CNI est invité à former une délégation qui accompagne ce cheminement et porte notre parole collective ;

Nous convoquons

les délégué·e·s et les conseillères et conseillers du CNI-CIG pour qu’ils assistent à la

Cinquième Assemblée nationale du Congrès national indigène
et du Conseil indigène de gouvernement

qui aura lieu à :

« La Quinta Piedra », territoire récupéré du peuple nahua de l’ejido Tepoztlán, dans l’État de Morelos
les 23 et 24 janvier 2021

Selon le programme suivant :

23 janvier

Inauguration

Commissions de travail :

  • Bilan du pillage et de la guerre capitaliste contre nos peuples
  • Proposition pour la participation d’une délégation du CNI-CIG à la tournée planétaire zapatiste

24 janvier

Session plénière ouverte :

  • Conclusion des commissions de travail
  • Accords et résolutions
  • Communiqué public
  • Clôture

Note 1 : Compte tenu des circonstances sanitaires actuelles, nous invitons à nommer un·e ou deux délégué·e·s par peuple, communauté ou organisation indigène, selon le cas, afin de réaliser une assemblée amplement représentative mais moins nombreuse. Celles et ceux qui y assisteront devront respecter les mesures d’utilisation de masques, de saine distance, de lavage fréquent des mains et du visage. Et celles qui pourront être prises sur place.

Note 2 : Celles et ceux qui ne sont pas délégué·e·s ou conseillers et conseillères du CNI ou du CIG ne pourront assister à l’assemblée que sur invitation de la Commission de coordination et suivi.

Respectueusement

Décembre 2021

Pour la reconstitution intégrale de nos peuples
Jamais plus un Mexique sans nous

Congrès national indigène – Conseil indigène de gouvernement
Armée zapatiste de libération nationale

Traduit de l’espagnol (Mexique)

par Joani Hocquenghem

Texte d’origine :

Enlace Zapatista

= = =

Lectures complémentaires :

Notre page « Réseau de Résistance et de Rébellion International » 3RI

5 textes pour comprendre et éradiquer le colonialisme

« Païens en terre promise, décoder la doctrine chrétienne de la découverte », Steven Newcomb, 2008

« Comprendre le système de l’oppression coloniale par mieux le démonter », Steven Newcomb

« Comprendre le système de l’oppression coloniale pour mieux le démonter », Peter d’Errico

« Effondrer le colonialisme », Résistance 71

« Nous sommes tous des colonisés ! », Résistance 71

 

Dr Vladimir Zelenko et son protocole de traitement du SARS-CoV-2 aux Etats-Unis

Posted in actualité, coronavirus CoV19, crise mondiale, résistance politique, santé et vaccins, sciences et technologies with tags , , on 27 décembre 2020 by Résistance 71

 

 

 

 

 

Rappel : « Déclaration de responsabilité civile et légale pour l’administation des vaccins Pfizer/BioNtech et Moderna dans le cadre de a COVID-19 »

 

Protocole de traitement de la COVID-19 par le Dr Zelenko

 

Décembre 2020

 

Dr. Vladimir Zelenko*

Twitter: @zev_dr

Principes fondamentaux

Traiter les patients sur la base de suspicion clinique dès que possible, de préférence dans les 5 jours des premiers symptômes. Faire un test PCR mais ne pas attendre les résultats avant de commencer le traitement.

Classer les patients par risque

Patient à bas risque: plus jeune que 45 ans, pas d’autres maladies facteurs de co-mortalité et cliniquement stable.

Patient à haut risque : plus de 45 ans ou moins de 45 ans avec facteurs de co-mortalité potentielle ou patient cliniquement instable.

Options de traitement

Patients à bas risque, options de traitement sans ordonnance :

1. Elemental Zinc 50mg 1 X jour pdt 7 jours

2. Quercetin 500mg 2 x jour pdt 7 jours ou

Epigallocatechin-gallate (EGCG) 400mg 1 x jour pdt 7 jours 

3. Vitamin C 1000mg 1 x jour pdt 7 jours

4. Repos, fluides par voie orale, suivi médical avec médecin

Patients à haut risque

1. Elemental Zinc 50mg 1 x jours pdt 7 jours

2. Hydroxychloroquine (HCQ) 200mg 2 x jour pdt 7 jours ou Epigallocatechin-gallate (EGCG) 400mg 1x jour pdt 7 jours

If HCQ not available, Quercetin 500mg 3 x jour pdt 7 jours ou

EGCG 400mg 2 x jour pdt 7 jours

3. Azithromycin 500mg 1 x jour pdt 5 jours ou

Doxycycline 100mg 2 x jour pdt 7 jours

4. Vitamin C 1000mg 1 x jour pdt 7 jours

5. Rest, oral fluids and close followup with doctor

Traitement additionnel, devra être customisé pour chaque patient (NdT: on laisse ce protocole en anglais)

1. Ivermectin 6mg 2 times a day for 1 day

2. Budesonide 1mg/2cc solution via nebulizer 2 times a day for 7 days

3. Dexamethasone 6mg 1 time a day for 7 days

4. Fluidifiants sanguins (i.e. Lovenox)

5. Oxygène à domicile

6. Fluides en IV à domicile

Si possible, garder les patients hors de l’hôpital.

= = =

Remarques supplémentaires :

Protocole pour patients à bas et moyen risque :

Elemental Zinc 25mg 1 time a day

Vitamin D 5000iu 1 time a day

Vitamin C 1000mg 1 time a day

Quercetin 500mg 1 time a day until a safe and efficacious vaccine becomes available

If Quercetin is unavailable, then use Epigallocatechin-gallate (EGCG) 400mg 1 time a day

Protocole pour patients à haut risque:

Elemental Zinc 25mg once a day

Vitamin D 5000iu 1 time a day

Hydroxychloroquine (HCQ) 200mg 1 time a day for 5 days, then 1 time a week until a safe and efficacious vaccine becomes available

If HCQ is unavailable, then use the Protocol for Low and Moderate Risk Patients.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7365891/

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7318306/

https://pubs.acs.org/doi/10.1021/jf5014633

https://www.preprints.org/manuscript/202007.0025/v1

(*) Note de R71 :

Le Dr Zelenko est un médecin généraliste de 46 ans, né à Kiev en Ukraine, immigré aux Etats-Unis (New-York) à l’âge de 4 ans avec sa famille. Il est médecin depuis 20 ans dans une communauté de 35 000 habitants. Le Dr Zelenko a soigné plus de 2000 patients atteints de la COVID19 depuis le début de la crise sanitaire et n’a eu a déploré que 2 décès après hospitalisation. Il a une grande pratique et un grand succès avec les protocoles énoncés. C’est un médecin de terrain dont la mission avouée est de diagnostiquer et de soigner ses patients. Pour ce faire, il utilise tout protocole qui marche.

Thérapie génique COVID-19 : le futur des vaccins (vidéo James Corbett)

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, documentaire, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état with tags , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

Résistance 71

27 décembre 2020

Excellente analyse dans cette vidéo du toujours pertinent James Corbett. La transcription est sur son site, des sous-titres français seraient les bienvenus pour cette vidéo que nous considérons comme essentielle alors que nous entrons dans cette année décisive que sera 2021.

Les thèmes abordés dans cette vidéo :

  • La fabrication de la peur pandémique
  • Court historique des vaccins
  • Rappel de qui est Bill Gates
  • La nouvelle technologie de thérapie génique ARNm de Moderna et Pfizer / BioNTech
  • Le monde comme laboratoire d’une expérience d’ingénierie sociale
  • Le futur technologique immédiat des nouvelles technologies
  • La grille de contrôle planétaire sous couvert de l’urgence sanitaire

A voir et diffuser au plus large afin qu’un sous-titrage en français soit mis en place.

A lire aussi notre page « Coronavirus, guerre biologique contre l’humanité »

Dictature COVID-19 : Les labos poussent les gouvernements à les exonérer de toute responsabilité pour leurs vaccins chimériques…

Posted in 3eme guerre mondiale, actualité, coronavirus CoV19, crise mondiale, guerres hégémoniques, ingérence et etats-unis, militantisme alternatif, N.O.M, pédagogie libération, politique et lobbyisme, politique et social, politique française, résistance politique, santé et vaccins, science et nouvel ordre mondial, sciences et technologies, technologie et totalitarisme, terrorisme d'état, Union Europeenne et nouvel ordre mondial with tags , , , , , , , , , , , , , , , , , on 27 décembre 2020 by Résistance 71

 

 

 

Les labos pharmaceutiques s’exonèrent de toute responsabilité sur les effets secondaires des vaccins covid

 

Anonyme

 

25 décembre 2020

https://www.lefigaro.fr/societes/vaccins-covid-19-l-ue-nbsp-indemnisera-les-laboratoires-en-cas-de-problemes-20200827

Bill Gates admet que ses vaccins changeront le génome

https://youtu.be/ksEVaO806Oo (vidéo à enregistrer avant censure)

Fauci le pantin de Bill Gates qui veut imposer les vaccins aux américains avoue que les vaccins covid peuvent être pires que le covid lui même

https://metro.co.uk/2020/05/12/americas-top-coronavirus-doctor-warns-vaccine-make-covid-19-worse-12692519/?ito=cbshare (article à enregistrer avant censure)

Bill Gates admet que ses vaccins peuvent tuer

https://www.armstrongeconomics.com/world-news/corruption/gates-admits-700000-people-may-die-from-his-vaccine/?__cf_chl_jschl_tk__=62eb6c7077991213fdafe4e84df29c5a07ebf0d4-1608836399-0-AVlKQVPOLfSy9QfQp3lKiMepwzABRTxxWMfww9Whtf27OPGp9Pysbzlln1vrkzWizhdh6sdzI5srwLQcRmU9Oi9E1O19KBS-t2bK9oY-kqIXxvzXo1evnUHmG-l9_fyt9BC82pusuzl4UQGKD99EyWzQQE8WO-spDIG2E8X-kqGWxXx7WeDjvlfQDbMemduSicRT22up-wqnYkzixyqrGvZ03FPAlCreAGCM0rYoEZcLZFPQFUVk7yyvxEUB6t1kl0wF9_gLrccxEoZtTl5ZLrhwVLAEPphfWMbYdrMIwW4CSEJyIQAnGO-mLBLRZV7otU94GN1ZQNccruGGk4-J3LKg0QjK58r7il0j3drDYjegmDieMGRAHBb3V7spLOlqZnk9Cg6q0UHKS6L_4uc_z1gDYNjz hY4WhEzoc4E6tfrWFkISoYiR0iLFQWZLiVk4z0GdxWuZPk33MketC3pa9do

https://resistance71.wordpress.com/2020/10/06/coronavirus-vaccin-covid19-et-controle-mondial-de-la-population/

les labos des vaccins AstraZeneca (NYSE: AZN), GlaxoSmithKline (NYSE: GSK), Janssen (NYSE: JNJ), Merck (NYSE: MRK), Novavax (NASDAQ: NVAX), Pfizer (NYSE: PFE), Sanofi Pasteur (NASDAQ) : SNY), Takeda (NYSE: TAK), Abbott (NYSE: ABT) et CureVac (NASDAQ: CVAC) ont tous demandé à être exonérés de toute responsabilité sur les effets secondaires de leurs vaccins OGM à ADN ou ARN

https://seekingalpha.com/news/3608810-coronavirus-vaccine-makers-seek-eu-liability-protections

AstraZeneca , GlaxoSmithKline, Janssen , Merck, Novavax , Pfizer , Sanofi , Takeda, Abbott CureVac sont tous financés par Bill Gates ou d’autres géants du web (comme le milliardaire Dietmar Hopp, co-fondateur du géant allemand du logiciel SAP https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html). ou collaborent avec lui

https://www.businessinsider.fr/us/bill-gates-backing-boosts-2-billion-doses-astrazeneca-coronavirus-vaccine-2020-6?op=1

https://cnnphilippines.com/business/2020/8/15/CureVac-Bill-and-Melinda-Gates-Foundation.html

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2016/10/OPP1156831

https://observer.com/2020/05/coronavirus-vaccine-update-novavax-merck-bill-gates-funding/

https://nypost.com/2020/09/15/bill-gates-says-pfizer-has-best-shot-at-early-covid-19-vaccine/

https://www.gatesfoundation.org/How-We-Work/Quick-Links/Grants-Database/Grants/2015/10/OPP1127586

https://america-wake-up.com/2020/05/04/the-anthony-fauci-bill-gates-george-soros-sanofi-pasteur-china-corona-virus-vaccine-connection/

https://www.fiercebiotech.com/biotech/sanofi-pasteur-announces-vaccine-discovery-collaboration-bill-melinda-gates-foundation

https://www.takeda.com/newsroom/newsreleases/2016/takeda-receives-$38-million-grant-from-the-bill–melinda-gates-foundation-to-support-polio-eradication-in-developing-countries/

https://edition.cnn.com/2020/08/14/investing/curevac-ipo-coronavirus-vaccine-bill-melinda-gates/index.html

Pourquoi les géants du web investissent dans les vaccins?

Tout simplement parce que le but des vaccins c’est de donner une identité numérique, marque de la bête connecté à la 5G

https://www.kla.tv/Coronavirus-fr/16685

une autre vidéo qui en parle a été censurée sur

http://stoplinkyvarest.canalblog.com/archives/2020/09/21/38547121.html

vaccin connecté à la 5G

https://resistance71.wordpress.com/2020/10/09/dictature-technotronique-en-marche-vaccin-covid-arnm-hydrogel-enzyme-luciferase-cocktail-modificateur-genetique/

https://resistance71.wordpress.com/2020/10/27/hiver-2020-21-cov19-5g-chomage-famine-et-depopulation-programmee/

L’affaire du vaccin contre la COVID-19 n’est pas une affaire sanitaire mais celle de la normalisation de l’identité numérique (Philippe Guillemant, physicien CNRS)

https://resistance71.wordpress.com/2020/12/16/laffaire-du-vaccin-contre-la-covid-19-nest-pas-une-affaire-sanitaire-mais-celle-de-la-normalisation-de-lidentite-numerique-philippe-guillemant-physicien-cnrs/